scholarly journals First Report of a Phytoplasma Associated with Witches'-Broom of the Giant Coral Tree (Erythrina poeppigiana, Fabaceae) in Costa Rica

Plant Disease ◽  
2007 ◽  
Vol 91 (11) ◽  
pp. 1512-1512 ◽  
Author(s):  
G. Saborío-R. ◽  
W. Villalobos ◽  
C. Rivera
Keyword(s):  
Costa Rica ◽  
Fungal Infections ◽  
Shoot Proliferation ◽  
San Jose ◽  
Erythrina Poeppigiana ◽  
Coffee Plantations ◽  
First Report ◽  
Plant Extraction ◽  
Two Samples ◽  
Coral Tree

The giant coral tree (Erythrina poeppigiana, Fabaceae) is a common shade tree in coffee plantations in Costa Rica. Coral trees are pruned to decrease fungal infections and increase nitrogen fixation. Recently, severe shoot proliferation, internodes shortening, and leaf reduction were observed in pruned shade trees in the south of San José Province, Costa Rica. Leaf samples from 10 symptomatic E. poeppigiana trees were collected. Also, two samples from symptomless coral trees were collected from areas free of witches'-broom. Total DNA was extracted from 0.5 g of petiole tissue from all samples with the plant extraction mini kit (Qiagen GmbH, Hilden, Germany) with a modified protocol (2) and assayed by nested PCR with phytoplasma universal rDNA primers (P1/P7) (1) and R16F2n/R16R2 (3). All symptomatic trees tested positive for phytoplasmas by PCR, yielding the expected 1.2-kb band. DNA from the symptomless trees was not amplified by PCR. The restriction fragment length polymorphism analyses (HaeIII, AluI, RsaI, BfaI, HpaII, KpnI, HhaI, and MseI) and the sequence of the 1.2-kb PCR fragment (GenBank Accession No. DQ485305) revealed that the phytoplasma associated with coral tree witches'-broom belongs to the aster yellows phytoplasma group (16SrI) (4). To our knowledge, this is the first report of a phytoplasma belonging to the aster yellow group causing witches'-broom in the Erythrina genus. References: (1) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (2) M. J. Green et al. Plant Dis. 83:482, 1999. (3) D. E. Gundersen and I. M. Lee. Phytopathol. Mediterr. 35:144, 1996. (4) I. M Lee et al. Int. J. Syst. Bacteriol.48:1153, 1998.

scholarly journals Molecular Detection and Genotyping ofChlamydia psittaciin Captive Psittacines from Costa Rica

2013 ◽  
Vol 2013 ◽  
pp. 1-6 ◽  
Author(s):  
Jessica Sheleby-Elías ◽  
Ántony Solórzano-Morales ◽  
Juan José Romero-Zuñiga ◽  
Gaby Dolz
Keyword(s):  
Costa Rica ◽  
Potential Risk ◽  
Molecular Detection ◽  
San Jose ◽  
First Report ◽  
Representative Species ◽  
Two Samples ◽  
Ara Macao ◽  
Positive Results ◽  
Genotype A

Oropharyngeal and cloacal swabs from 117 captive psittacine birds presented at veterinary clinics (88) and from shelters/rescue centers of wildlife (29) were collected to determine the prevalence ofC. psittaciin captive birds in Costa Rica. Samples were collected during 2009 from a total of 19 different species of parrots, withAra macao(33),Amazona autumnalis(24),Amazona ochrocephala(21), andAra ararauna(8) being the most representative species sampled.C. psittaciwas detected in four (3.4%) birds using molecular detection (PCR). The positive samples belonged to birds presented at veterinary clinics; three of them wereAra macaoand oneAmazona ochrocephala. Three birds were adults; all positive birds showed no symptoms of illness and lived in homes with other birds, two in San José and two in Heredia. Sequencing was used to confirm the PCR positive results, showing that two samples ofC. psittacibelonged to genotype A, representing the first report of the presence of this genotype in Costa Rica. The detection of this bacterium in captive psittacine birds shows that there is a potential risk for people living or having contact with them and that there is a possibility of infecting other birds.

scholarly journals First Report of Orange Rust of Sugarcane Caused by Puccinia kuehnii in Costa Rica and Nicaragua

Plant Disease ◽  
2009 ◽  
Vol 93 (4) ◽  
pp. 425-425 ◽  
Author(s):  
E. Chavarría ◽  
F. Subirós ◽  
J. Vega ◽  
G. Ralda ◽  
N. C. Glynn ◽  
...  
Keyword(s):  
Costa Rica ◽  
Morphological Characteristics ◽  
Brown Rust ◽  
Western Hemisphere ◽  
Sugar Mill ◽  
San Jose ◽  
First Report ◽  
Rdna Sequences ◽  
Monte Rosa ◽  
Symptoms And Signs

Symptoms and signs of orange rust on sugarcane (a complex hybrid of Saccharum L. species) were observed from July 2007 on cv. SP 71-5574 in Costa Rica at the Coopeagri Sugar Mill located in Pérez Zeledón, San José and on multiple cultivars (CP 72-2086, Pindar, Q 132, Q 138, SP 71-5574, and SP 79-2233) at the Providencia Sugar Mill near Muelle, San Carlos and Cutris Sugar Mill near Los Chiles during August 2007. The same symptoms and signs were observed on cv. CP 72-2086 during September 2007 in Nicaragua at Ingenio San Antonio, located near Chinandega, and Ingenio Monte Rosa near El Viejo, Nicaragua. Disease symptoms and uredinia appeared different from brown rust caused by Puccinia melanocephala, and brown rust usually does not occur on these cultivars. Uredinia and urediniospores were similar to those described for orange rust (1,2). Cvs. SP 71-5574 and SP 79-2233 are susceptible and cv. CP 72-2086 is moderately susceptible to orange rust in Costa Rica and cvs. ISACP 00-1075, ISA 00-1000, and CP 72-2086 are moderately susceptible in Nicaragua. Samples from both locations (Costa Rica BPI No. 878816 and Nicaragua BPI No. 878817) examined at the USDA-ARS Mycology and Microbiology Laboratory in Beltsville, MD showed morphological characteristics consistent with those of P. kuehnii. Analysis of ITS1, 5.8S, and ITS2 rDNA sequences of the rust infecting cv. CP 72-2086 (GenBank Accession No. FJ532477) from Costa Rica and cv. ISA 00-1000 from Nicaragua (GenBank Accession No. FJ532476) confirmed the identity as P. kuehnii, the causal agent of sugarcane orange rust. Beside the cultivars already mentioned, orange rust also was confirmed on cvs. RB 73-9735 and CPCL 02-2130 in Costa Rica. To our knowledge, this is the first report of orange rust of sugarcane in Costa Rica and Nicaragua and the third confirmation of the disease in the Western Hemisphere and Caribbean Basin. References: (1) J. C. Comstock et al. Plant Dis. 92:175, 2008. (2) W. Ovalle et al. Plant Dis. 92:973, 2008.

scholarly journals First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica

Plant Disease ◽  
2005 ◽  
Vol 89 (10) ◽  
pp. 1130-1130 ◽  
Author(s):  
R. W. Hammond ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez
Keyword(s):  
Costa Rica ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Nucleotide Sequence Analysis ◽  
Cucurbita Moschata ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Two Samples

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5′ GAGCGCCGCACAAGTCATC 3′ and CYHSPR 5′ TACCGCCACCAAAGTCATACATTA 3′) of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5′ GGCTGGCAACATGGAAACTGA 3′ and MYVR 5′ CTGAAAAGGCGATGAACTA TTGTG 3′) were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

scholarly journals Evaluación de arvenses como hospedantes alternos de nematodos fitoparásitos en cafetales en Costa Rica

2018 ◽  
Vol 29 (1) ◽  
pp. 193
Author(s):  
Walter Peraza-Padilla ◽  
Martha Orozco-Aceves
Keyword(s):  
Costa Rica ◽  
Risk Index ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
San Jose ◽  
Trap Crop ◽  
Coffee Plantations ◽  
Alternative Hosts ◽  
Maximum Value ◽  
Coffee Plants

There is potential for weeds to be alternative hosts of plant-parasitic nematodes (PPN), but a methodology that assesses the phytosanitary risk derived from the presence of weeds in plantations is not available. This research was conducted in order to determine if the presence of weeds in coffee plantations (organic and conventional) represented a phytosanitary risk due to their role as alternative hosts of PPN. The research was developed into two plantation located in Aserrí, San José, Costa Rica during August, 2010. The most important weeds were identified in the plantations, also nematodes of the genera Meloidogyne, Pratylenchus and Helicotylenchus were quantified in soil and roots from selected weeds and coffee plants. A permutational analysis of variance was executed in order to determine the genera of PPN that significantly differed from the ones found in weeds to the ones found in coffee plants. Based on these results, the weeds were classified as: reservoir, trap crop, or weak host of PPN. This classification criterion, in addition to life cycle and type of parasitism of the PPN were used to assign numerical values to the weeds. The values were used to calculate the Phytosanitary Risk Index (PRI) that acquired a maximum value of 10 for the weed Piper umbellatum in the organic plantation, and a maximum value of 24 for Commelina diffusa, Emilia fosbergii, Spananthe paniculata, Delilia biflora, and Spermacoce hirta in the conventional plantation. The results indicated that from a nematological perspective the presence of these weeds in coffee plantation could be a potential risk for coffee plants

scholarly journals Charles H. Lankester (1879-1969): his life and legacy

Lankesteriana ◽  
2014 ◽  
Vol 13 (3) ◽  
Author(s):  
Carlos Ossenbach
Keyword(s):  
New Species ◽  
Costa Rica ◽  
Botanical Garden ◽  
Central American ◽  
San Jose ◽  
Coffee Plantations ◽  
Assistant Director ◽  
Royal Botanic Gardens ◽  
The University ◽  
Don Carlos

Charles Herbert Lankester (1879-1969) was without a doubt the most dominant figure of Central American orchidology during his time. Better known as ‘Don Carlos’, Lankester was born in Southampton, England, on June 14 1879. It was in London that he read an announcement offering a position to work as an assistant to the recently founded Sarapiquí Coffee Estates Company in Costa Rica, he applied and was hired. Surely influenced by his uncle’s zoological background, Lankester was at first interested in birds and butterflies. However, living in Cachí, at that time one of the regions with the greatest botanical diversity, he must have fallen under the spell of the plant world as he soon began collecting orchids in the nearby woods. Many of the plants he collected at this time proved to be new species. With no literature at his hand to determine the plants he collected, Lankester started corresponding with the assistant director of the Royal Botanic Gardens at Kew, Arthur Hill in 1910, and somewhat later with Robert Allen Rolfe, Kew’s most eminent authority on orchids. At the same time, Lankester began his collection of living plants that would become so famous years later. He returned to England in 1920 to enroll his five children in English schools. Lankester traveled to Africa from 1920 to 1922, hired by the British Government to do research on coffee plantations in Uganda. When returning to England, he found that Rolfe had died the year before. Many orchids that he had brought to Kew were left without identification. Lankester was back in Costa Rica in 1922, the year that was a turning point in his career as an orchidologist: it brought the first correspondence with Oakes Ames. Over the next fifteen years, Ames would discover more than 100 new species among the specimens he received from Costa Rica. In 1922, Ames began a series of publications on orchids, which he named Schedulae Orchidianae. In its third fascicle, in January 1923, Ames started to describe many of the Lankester orchids, which were deposited at Kew and had been left unidentified. Ames kept asking Lankester to send more and more specimens. After 1930, Lankester and Ames seem to drift slowly apart. Ames was taken in more by administrative work at Harvard, and Lankester traveled abroad more frequently. In 1955, after his wife’s death and already 76 years old, Lankester decided to sell his farm but retained the small part which contained his garden, a piece of land called “El Silvestre”. Lankester moved to a house he had bought in Moravia, one of the suburbs of the capital, San José. On a section of this farm called “El Silvestre”, Lankester began his wonderful collections of orchids and plants of other families, which formed the basis of the Charles H. Lankester Botanical Garden of the University of Costa Rica.

scholarly journals Gliricidia Little Leaf Disease in Costa Rica

Plant Disease ◽  
1999 ◽  
Vol 83 (1) ◽  
pp. 77-77
Author(s):  
L. Kenyon ◽  
N. A. Harrison ◽  
P. A. Richardson
Keyword(s):  
Costa Rica ◽  
Shoot Proliferation ◽  
Gliricidia Sepium ◽  
Pigeon Pea ◽  
Positive Control ◽  
Rrna Gene ◽  
San Jose ◽  
Leaf Disease ◽  
Pcr Products ◽  
Natural Stands

Gliricidia sepium is a multipurpose, legume tree species native to Central America and Mexico with wide social and economic importance. Gliricidia little leaf disease (GLLD) is associated with infection by a phytoplasma and is manifested by one or more symptoms, including leaflet yellowing, leaflet size reduction, shortened internodes, and shoot proliferation, often leading to branch die-back or death of young trees. Trees with symptoms were seen in fences and natural stands in the Nicoya Peninsular and on road sides west of San Jose, Costa Rica. Shoot samples were collected from eight symptom-bearing trees in different locations and from two healthy-looking trees in the southeast where no GLLD symptoms were observed. DNA from each sample was used as template in polymerase chain reaction (PCR) with universal phytoplasma rRNA gene primers P1 and P7 (1). DNA from a GLLD-infected tree from Honduras, and a pigeon pea witches'-broom infected Cajanus cajan from Florida, served as positive controls, while DNA from healthy G. sepium and C. cajan seedlings were used as negative controls. A 1.8-kb PCR product, indicative of presence of phytoplasma DNA, was amplified from all symptom-bearing tree samples and positive control DNAs, but not from DNA from the apparently healthy trees or seedlings. Restriction fragment length pattern analysis of PCR products with a range of endonucleases showed no difference between the Honduran and Costa Rican phytoplasma isolates. The distribution and symptom types observed in Costa Rica suggest that GLLD has recently arrived from Nicaragua and is spreading southeast. Reference: (1) L. Kenyon et al. Plant Pathol. 47:671, 1998.

scholarly journals First Report of Xylella fastidiosa in Avocado in Costa Rica

Plant Disease ◽  
2008 ◽  
Vol 92 (1) ◽  
pp. 175-175 ◽  
Author(s):  
M. Montero-Astúa ◽  
G. Saborío-R. ◽  
C. Chacón-Díaz ◽  
L. Garita ◽  
W. Villalobos ◽  
...  
Keyword(s):  
Costa Rica ◽  
Xylella Fastidiosa ◽  
Persea Americana ◽  
San Jose ◽  
First Report ◽  
Negative Results ◽  
Pcr Products ◽  
Chlorotic Mottling ◽  
Branch Dieback ◽  
Individual Trees

Since the late 1990s, chlorotic mottling, marginal scorch, deformation of leaves, defoliation, shortening of internodes, and branch dieback have been observed in avocado trees (Persea americana Mill.) in Costa Rica. The symptoms are not uniformly distributed in the tree, so some branches are symptomatic while others are not. These symptoms are similar to several leaf scorch diseases caused by the bacterium Xylella fastidiosa Wells (2,4). This bacterium has been detected in coffee and citrus plants in Costa Rica. Of 227 avocado trees tested by double-antibody sandwich (DAS)-ELISA with X. fastidiosa specific antiserum (Agdia Inc., Elkhart, IN) from 2000–2004, 188 were positive. Results of ELISA tests of individual trees varied with the season and branches tested. Fifteen greenhouse-grown, ELISA-negative avocado seedlings were grafted with budwood from an ELISA-positive tree. Eight of these developed scorch symptoms and one also showed chlorotic mottling and deformation, showing that the disease is graft transmitted. All of these features are characteristic of diseases caused by X. fastidiosa (2,4). Transmission electron microscopy of leaf petioles from three field trees positive by ELISA, revealed rod-shaped bacilli approximately 1.6 to 2.0 μm long and 0.3 μm in diameter with a rippled cell wall inside xylem vessels and embedded in a matrix; morphology and measurements that are consistent with those reported for X. fastidiosa (2). DNA extraction and PCR attempts have been limited by mucilaginous sap from avocado. Positive PCR results (approximately 472-bp band) were obtained from two of the grafted seedlings and seven field trees from two distinct geographical locations (Alajuela and San José provinces) with DNA extractions from the plant sap using DNeasy Plant Mini Kit (Qiagen GmbH, Hilden, Germany) following a modified protocol (1) and nested PCR (3). Four of the PCR products, including one from the grafted seedlings, were cloned and sequenced in duplicate. GenBank sequences EU021997 to EU022000 present 99 to 100% sequence identity to a Pierce's disease strain from California (Temecula1) and 94 to 95% to a citrus variegated chlorosis strain from Brazil (Found-5). Several attempts have been made to isolate the bacterium in ‘periwinkle wilt’ and buffered cysteine-yeast extract media with negative results, probably because of the rapid production of mucilaginous sap when the avocado tissues were sampled. To our knowledge, this is the first report of X. fastidiosa in avocado trees. References: (1) M. J. Green et al. Plant Dis. 83:482, 1999. (2) S. S. Hearon et al. Can. J. Bot. 58:1986, 1980. (3) M. R. Pooler and J. S. Hartung. Curr. Microbiol. 31:377, 1995. (4) A. H. Purcell et al. Phytopathology 89:53, 1999.

El abuso de la libertad de expresión y sus responsabilidades

2017 ◽  
Vol 1 (1) ◽  
pp. 109-117
Author(s):  
Emma Nogales de Santivañez
Keyword(s):  
Costa Rica ◽  
San Jose ◽  
Derechos Humanos

La libertad de expresión es un derecho humano que está reconoci-do en la Constitución Política del Estado, en su Art. 21 inc. 3, y se halla también en tratados y convenios internacionales, de los cua-les el más importante a juicio de la autora, por ser a nivel inter-americano, es la Convención Americana de Derechos Humanos o Pacto de San José de Costa Rica de 22 de noviembre de 1969. Esta convención ha sido ratificada por Bolivia, por tanto está en la obligación de cumplirla y establecer los mecanismos necesarios para exigir, a su vez, su cumplimiento.

Factores socioeconómicos y educativos que influyen en el rendimiento escolar en Español y Matemáticas en una muestra de sexto año de Costa Rica

2001 ◽  
Vol 1 (2) ◽  
pp. 73-98
Author(s):  
Rosa Herminia Perla Perla
Keyword(s):  
Costa Rica ◽  
San Jose ◽  
Para Determinar

Con el propósito de aportar elementos a una discusión sobre el mejoramiento de la calidad de la educación y sobre los esfuerzos orientados en tal dirección, se estudió el rendimiento escolar de 1,320 estudiantes matriculados en 1999 en el sexto año en escuelas de la Dirección Regional de Enseñanza de San José, Costa Rica. Mediante análisis correlacionales, de varianza simples y multivariados y de regresión múltiple, se procuró determinar en qué medida los factores socioeconómicos y educativos relacionados con el proceso educativo escolar inciden en el rendimiento académico de los estudiantes. Se analizaron datos (a) proporcionados por los padres para determinar la ocupación del padre y de la madre, el nivel educativo del padre y de la madre, el nivel de ingreso económico del hogar y el tamaño de la biblioteca del hogar; (b) aportados por los maestros, con el fin de indagar su grado académico, su antigüedad docente, su salario, el tamaño de la clase, el número de horas lectivas y el número de libros de texto utilizados por cada estudiante en la escuela; (c) proporcionados por los directores de la escuela respecto del presupuesto escolar para materiales didácticos y al tamaño de la biblioteca de la institución; y (d) resultantes de la administración de pruebas comprensivas en las disciplinas de Español y Matemáticas. Los resultados muestran que, a excepción del tamaño de la matrícula escolar, todas las variables independientes involucradas en el estudio están asociadas significativamente con el rendimiento académico. Se propone el mejor modelo predictor del rendimiento académico en la población del estudio.

Sign in / Sign up

Export Citation Format

Share Document