First Report of Fenhexamid Resistant Isolates of Botrytis cinerea on Grapevine in Chile

Botrytis cinerea Pers. (teleomorph Botryotinia fuckeliana (de Bary) Whetzel) is a haploid, filamentous ascomycete that causes gray mold on many economically important crops in temperate regions, especially grapevine. The management of gray mold on table grape in Chile involves cultural and chemical methods. Currently, protection programs are based on several fungicide families (dicarboximides, anilinopyrimidines, mixture of anilinopyrimidines and phenylpyrroles, and hydroxyanilides [fenhexamid]). During the last 25 years, B. cinerea developed resistance to virtually all specific fungicides used to control gray mold. Field resistance to benzimidazoles, phenylcarbamates, and dicarboximides was detected soon after their introduction. Recent studies using PCR-duplex and specific primers for the detection of transposable elements on Chilean B. cinerea isolates recovered from different table grape cultivars corroborated the presence of two sibling cryptic populations, transposa and vacuma (3). Some vacuma isolates have shown natural resistance to fenhexamide (HydR1) and it has been separated into two groups on a molecular basis using a marker gene (Bc-hch): Group I, fenhexamid-resistant vacuma isolates; Group II, vacuma and transposa isolates sensitive to this fungicide (HydS) (2). Group I and II isolates can not interbred (1,2). Other B. cinerea resistant phenotypes, HydR2 and HydR3, have been reported as belonging to Group II (1,4). Single-spore isolates of B. cinerea (472) were collected from different table grape cultivars from 13 locations in the Chilean Central Valley. The isolation was done during harvest time from rotting berries. Fenhexamid (Teldor; Bayer CropScience, Monheim, Germany) was diluted to 10 μg a.i./ml and added to the solid medium (10 g of glucose, 1.5 g of K2HPO4, 2 g of KH2PO4, 1 g of (NH4)2SO4, 0.5 g of MgSO4·H2O, 2 g of yeast extract, and 12.5 g of agar in 1 liter) to reach concentrations of 0, 0.025, 0.05, and 0.1 μg a.i./ml. A 5-mm mycelial plug from each isolate of B. cinerea was cut from the edge of 4-day-old colonies placed in the center of petri dishes with the described fungicide-amended medium and incubated at 20°C for 5 days. Two measurements, octogonal diameters, were taken from each of three replicates per treatment. Means were calculated and the diameter of the inoculated plug was subtracted from each mean. For each isolate, a linear regression of the percent inhibition of mycelial growth versus the Log10 transformation for each of the four concentrations of fenhexamid was obtained. The 50% effective concentration of fenhexamid (EC50) was calculated with the regression equation for each isolate. So, 95.3% of B. cinerea isolates were sensitive (EC50 under 0.083 μg/ml), 1.9% were less sensitive (EC50 between 0.084 and 0.1 μg/ml), and 2.8% (13 isolates) were resistant EC50 values ranging from 0.1 to 8.4 μg/ml. Through PCR-restriction fragment length polymorphism, according to the Bc-hch gene restriction pattern, all resistant isolates analyzed belong to Group II of B. cinerea (Bc-hch2) (2). To our knowledge, this is the first report of fenhexamid resistant isolates of B. cinerea on grapevine in Chile and South America. It would be necessary to study the population dynamics of these isolates, although failure of botrytis control in the field with this compound has not been reported. References: (1) C. Albertini et al. Mycol. Res. 106:1171, 2002. (2) E. Fournier et al. Mycologia 97:1251, 2005. (3) T. Giraud et al. Mol. Biol. Evol. 14:1177, 1997. (4) P. Leroux et al. Phytoma 599:31, 2006.

Download Full-text

First Report of Fenhexamid-Resistant Botrytis cinerea Causing Gray Mold on Heurchera in a North American Greenhouse

Plant Disease ◽

10.1094/pdis-08-11-0721 ◽

2012 ◽

Vol 96 (1) ◽

pp. 147-147 ◽

Cited By ~ 10

Author(s):

G. W. Moorman ◽

A.-S. Walker ◽

S. May

Keyword(s):

Botrytis Cinerea ◽

Mode Of Action ◽

Gray Mold ◽

North Central ◽

First Report ◽

Group I ◽

Central Pennsylvania ◽

Commercial Operation ◽

Penn State ◽

Botryotinia Fuckeliana

Greenhouse-grown Heuchera plants, treated with fenhexamid (Decree, SePRO, Carmel, IN; FRAC group 17 hydroxyanilide), with active gray mold were submitted to the Penn State Plant Disease Clinic in December 2010 from a commercial operation in north-central Pennsylvania. Genetic and phenotypic analyses identified the isolate as Botrytis cinerea Pers. (teleomorph Botryotinia fuckeliana (de Bary) Whetzel), HydR3 phenotype (2) and not B. pseudocinerea (previously Botrytis group I) (4), naturally resistant to fenhexamid (phenotype HydR1) (1). While 0.2 μg of fenhexamid per ml or less is required to slow mycelial growth and germ tube elongation of sensitive isolates by 50% (EC50), the radial growth EC50 of the Heuchera isolate was approximately 2,000 μg of fenhexamid per ml in culture. Five cucumber seedlings receiving 25 μl of 0.1 M dextrose containing the label rate of Decree (1,800 μg/ml) on the growing tip were inoculated with colonized agar in the drop. Five check plants received 25 μl of 0.1 M dextrose. B. cinerea from silica gel storage since 1988 was also tested. This experiment was repeated three times. The 1988 isolate killed all fungicide-free but no fenhexamid-treated plants. The Heuchera isolate killed all fungicide-free and fenhexamid-treated plants within 4 days. To our knowledge, this is the first report of B. cinerea from a greenhouse in North America with fenhexamid resistance. Resistance occurs in U.S. fields (3). The Heuchera isolate's HydR3 resistance phenotype (2) has been detected in Germany, Japan, and France and has mutations affecting the 3-keto reductase protein, encoded by the erg27 gene, the specific target of fenhexamid and involved in Botrytis sterol biosynthesis. The Decree label states that it is to be used only twice on a crop before switching to a different mode of action. Greenhouses have resident Botrytis populations that are likely to be exposed to any fungicide applied in the structure. Growers should consider using fenhexamid only twice in a particular greenhouse, rather than on a particular crop, before switching to a different mode of action. References: (1) P. Leroux et al. Crop Prot. 18:687, 1999.(2) P. Leroux et al. Pest Manag. Sci. 58:876, 2002. (3) Z. Ma and T. J. Michailides. Plant Dis. 89:1083, 2005. (4) A.-S. Walker et al. Phytopathology 101:1433, 2011.

Download Full-text

First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽

10.1094/pdis-04-21-0698-pdn ◽

2021 ◽

Author(s):

Jun Guo ◽

Jin Chen ◽

Zhao Hu ◽

Jie Zhong ◽

Jun Zi Zhu

Keyword(s):

Botrytis Cinerea ◽

Morphological Characteristics ◽

Gray Mold ◽

Hunan Province ◽

Conidial Suspension ◽

Heat Shock Protein 60 ◽

Basal Cells ◽

Single Spore ◽

Internal Transcribed Spacer Region ◽

First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

Download Full-text

First Report of Iprodione Resistance in Botrytis cinerea on Blackberry from South Carolina

Plant Disease ◽

10.1094/pdis-07-11-0543 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1481-1481

Author(s):

F. P. Chen ◽

X. L. Liu ◽

X. P. Li ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Disease Incidence ◽

Gray Mold ◽

Resistant Isolate ◽

Cross Resistance ◽

Broad Host Range ◽

Paper Strip ◽

Single Spore ◽

First Report

Botrytis cinerea Pers.:Fr., is a necrotrophic fungus with a broad host range that causes gray mold on hundreds of plant species (2). Control of gray mold mainly depends on fungicides, including the dicarboxamide iprodione. Thirty-nine diseased blackberry fruit were collected from four orchards in South Carolina and the sensitivity of single-spore isolates to iprodione was examined by Spiral Plater assays (1) on potato dextrose agar (PDA). Briefly, a 5.3 cm long paper strip containing mycelia was placed along the concentration gradient of the PDA and 50% inhibition (EC50 value) was calculated after 2 days of incubation with the Spiral Gradient Endpoint (SGE) software (Spiral Biotech, Norwood, MA). Each isolate was tested in duplicates. Sensitivity ranged from 0.043 to 2.596 μg/ml, with a maximum resistance factor of 60.4. Isolates with EC50 values greater than 2 μg/ml were found in two orchards. Those isolates represented 40 and 7.1% of the total isolates from each orchard. Two isolates with high (EC50 value of 2.596 μg/ml) and low (EC50 value of 0.062 μg/ml) values were chosen to determine the efficacy of iprodione formulated product Rovral 4 Fl (Bayer CropSciences, Research Triangle Park, NC) on detached apple fruit. Fifteen apples were used for each isolate and experiment. Each fruit was wounded on the surface in three locations with a sterile syringe and inoculated with 15 μl of a spore suspension (106 conidia/ml) at the wounded sites. Rovral was applied at the recommended label rate either 24 h before (protective treatment) or 48 h after inoculation (curative treatment). The experiment was conducted three times. Blackberry fruit were not found suitable for this assay because of persistent contamination problems likely from latent infections of a symptomatic fruit. Disease incidence and lesion diameter were recorded 7 days after incubation. Disease incidence following inoculation of the sensitive and resistant isolates on non-fungicide-treated fruit was 100 and 86.7%, respectively. Disease incidence on fungicide-treated apples was 4.4% for the sensitive isolate and 75.6% for the resistant isolate with corresponding mean lesion areas of 0.36 mm and 9.37 mm, respectively. Both isolates were controlled effectively in protective treatments, however, indicating low levels of resistance. To our knowledge, this is the first report of iprodione resistance in B. cinerea from blackberry or any other field-grown crop in South Carolina. This finding adds to a study from 1999 (3) documenting resistance to the dicarboxamide fungicide vinclozolin in B. cinerea collected from ornamentals in South Carolinian greenhouses and suggests that resistance to iprodione needs to be considered in the design of gray mold control strategies in commercial blackberry orchards. No cross resistance between the phenylpyrrole fludioxonil and iprodione was found. References: (1) H. Forster et al. Phytopathology 94:163, 2004. (2) B. Williamson et al. Mol. Plant Pathol. 8:561. 2007. (3) L. F. Yourman and S. N. Jeffers. Plant Dis. 83:569, 1999.

Download Full-text

First Report of Fenpyrazamine Resistance in Botrytis cinerea from Strawberry Fields in Spain

Plant Health Progress ◽

10.1094/php-12-17-0075-br ◽

2018 ◽

Vol 19 (1) ◽

pp. 45-45

Author(s):

Dolores Fernández-Ortuño ◽

Alejandra Vielba-Fernández ◽

Alejandro Pérez-García ◽

Juan A. Torés ◽

Antonio de Vicente

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

In Vivo Studies ◽

Cross Resistance ◽

In Vitro Tests ◽

Class Iii ◽

Single Spore ◽

First Report

Botrytis cinerea Pers. is an important fungal pathogen responsible for gray mold, one of the most economically important diseases of strawberry (Fragaria × ananassa) worldwide. The primary disease management strategy involves the application of different classes of fungicides, including the sterol biosynthesis inhibitor class III fungicide fenpyrazamine. In 2014 and 2015, strawberries affected with gray mold symptoms were collected from eight locations in Huelva, where fenhexamid had been used extensively. Twenty-five B. cinerea single-spore isolates were examined to determine EC50 values and to determine a discriminatory dose to monitor fenpyrazamine resistance in the field in future studies. The in vitro tests divided the isolates into two groups: 15 sensitive (EC50 from 0.02 to 1.3 μg/ml) and 10 resistant (EC50 from 50.1 to 172.6 μg/ml), which showed cross-resistance with fenhexamid. Performance of fenpyrazamine in in vivo studies was also carried out. Only the fenpyrazamine-resistant isolates developed gray mold on the fungicide-treated fruit. This is the first report of fenpyrazamine resistance in B. cinerea from strawberry fields in Spain and cross-resistance with fenhexamid.

Download Full-text

First Report of Fludioxonil Resistance in Botrytis cinerea from a Strawberry Field in Virginia

Plant Disease ◽

10.1094/pdis-01-13-0012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 848-848 ◽

Cited By ~ 12

Author(s):

D. Fernández-Ortuño ◽

P. K. Bryson ◽

A. Grabke ◽

G. Schnabel

Keyword(s):

South Carolina ◽

Botrytis Cinerea ◽

Disease Incidence ◽

Crop Protection ◽

Gray Mold ◽

Resistant Isolate ◽

Single Spore ◽

First Report ◽

Single Spore Isolate

Gray mold caused by Botrytis cinerea Pers.:Fr. is one of the most economically important diseases of cultivated strawberry (Fragaria × ananassa) worldwide. Control of gray mold mainly depends on fungicides, including the phenylpyrrole fludioxonil, which is currently marketed in combination with cyprodinil as Switch 62.5WG (Syngenta Crop Protection, Research Triangle Park, Raleigh, NC). In 2012, 790 strains of B. cinerea were collected from 76 strawberry fields in eight states, including Arkansas, Florida, Georgia, Kansas, Maryland, North Carolina, South Carolina, and Virginia. Strains were collected from sporulating flowers and fruit and sensitivity to fludioxonil was determined using a conidial germination assay as previously described (2). Only one isolate from a farm located in Westmoreland County, Virginia, grew on medium amended with the discriminatory dose of 0.1 μg/ml fludioxonil and was therefore considered low resistant. The isolate did not grow on 10 μg/ml. All other 789 isolates did not grow at either of the two doses. This assay was repeated twice with a single-spore culture of the same strain. In both cases, residual growth was observed on the fludioxonil-amended medium of 0.1 μg/ml. The single spore isolate was confirmed to be B. cinerea Pers. using cultural and molecular tools as described previously (1). To assess resistance in vivo, commercially grown ripe strawberry fruit were rinsed with sterile water, dried, placed into plastic boxes (eight strawberries per box for each of the three replicates per treatment), and sprayed 4 h prior to inoculation with either water or 2.5 ml/liter of fludioxonil (Scholar SC, Syngenta) to runoff using a hand mister. This dose reflects the rate recommended for gray mold control according to the Scholar label. Each fruit was stabbed at three equidistant points, each about 1 cm apart and 1 cm deep using a syringe tip. Wounds were injected with a 30-μl droplet of conidia suspension (106 spores/ml) of either 5 sensitive or the resistant isolate. Control fruit were inoculated with water. After inoculation, the fruit were kept at 22°C for 4 days. In two independent experiments, sensitive and low resistant isolates were indistinguishable in pathogenicity on detached, unsprayed fruit. The low resistant isolate developed gray mold disease on all treated and untreated fruit (100% disease incidence) as determined by the absence or presence of gray mold symptoms. The sensitive isolates only developed disease on untreated fruit. The EC50 values, determined in microtiter assays with concentrations of 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μg/ml fludioxonil, were 0.01 μg/ml for the sensitive isolates and 0.26 μg/ml for the resistant isolate. To our knowledge, this is the first report of fludioxonil resistance in B. cinerea from strawberry in North America. Our monitoring results indicate that resistance is emerging 10 years after the introduction of fludioxonil and stress the importance of chemical rotation for gray mold control. References: (1) X. P. Li et al. Plant Dis. 96:1634, 2012. (2) R. W. S. Weber and M. Hahn. J. Plant Dis. Prot. 118:17, 2011.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽

10.1094/pdis-01-21-0219-pdn ◽

2021 ◽

Author(s):

Nooreen Mamode Ally ◽

Hudaa Neetoo ◽

Mala Ranghoo-Sanmukhiya ◽

Shane Hardowar ◽

Vivian Vally ◽

...

Keyword(s):

Botrytis Cinerea ◽

Single Cells ◽

Disease Incidence ◽

Gray Mold ◽

Post Inoculation ◽

Conidial Suspension ◽

Sterile Water ◽

Susceptible Host ◽

Tomato Plants ◽

First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Download Full-text

First Report of Botrytis cinerea Causing Gray Mold Disease on Peach from Pakistan

International Journal of Phytopathology ◽

10.33687/phytopath.007.03.2668 ◽

2018 ◽

Vol 7 (3) ◽

pp. 131-131

Author(s):

Raees Ahmed ◽

Amjad S. Gondal ◽

Muhammad Tariq Khan ◽

Shazia Shahzaman ◽

Sajjad Hyder

Keyword(s):

Botrytis Cinerea ◽

Mycelial Growth ◽

Agar Medium ◽

Management Strategies ◽

Gray Mold ◽

First Report ◽

Average Production ◽

Conducive Environment ◽

Hyphal Tip ◽

Important Disease

Gray mold caused by Botrytis cinerea is an important disease that attacks fruits, leaves and twigs of peach. Peach is grown on an area of 18,008 ha with an average production of 72,085 tons per year in Pakistan (FAO, 2017). During May 2017, brown spots on 33% of the peach fruits examined were observed in Swat district of KPK province of Pakistan. Infected fruits were incubated at 25±2 °C in a humid chamber resulted in greyish mycelial growth with light brown lesions. Hyphal growths on infected fruits were cultured on PDA media and purified by hyphal tip method. Morphologically whitish grey growth was observed on PDA and later on dark sclerotia were observed after 6-7 days of incubation. Hyphae were found septate with branched hyaline conidiophores having a bunch of ovoid conidia at their tips. Further confirmations were done by amplifying internal transcribed spacer regions (Andrew et al., 2009) and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) region of the isolates (Li et al., 2012). Amplicons sequenced from Macrogen Korea were blasted and submitted in NCBI showed that ITS sequences (Accessions MH049690 and MH049691) were 99% identical with already reported (MG878388 and MG654661) sequences and the G3PDH gene sequences (Accessions MH560352 and MH560353) were 99 % identical with already reported (Accessions MG204876) sequences of B. cinerea. Pathogenicity was confirmed on healthy peach fruits disinfected with 50% ethanol, inoculated by placing a plug of about 1cm2 taken from the edge of actively growing B. cinerea isolate (BTS-16). Fruits were incubated at 25±2 °C in a humid chamber (Abata et al., 2016). A set of healthy fruits mock-inoculated with a plug of agar medium were used as control. Three days after inoculation, inoculated fruits showed sunken lesions with cottony greyish mycelial growth on their surface. Fungus isolated from these infections was re-confirmed as B. cinerea. Conducive environment for the disease progression in nearby areas can result into a huge loss in peach produce so there is a need to devise management strategies to cope with the pathogen. This is the first report of gray mold disease of peach caused by B. cinerea from Pakistan.

Download Full-text

First Report of Gray Mold on Allium victorialis var. platyphyllum Caused by Botrytis cinerea in Korea

Plant Disease ◽

10.1094/pdis-07-16-1051-pdn ◽

2017 ◽

Vol 101 (1) ◽

pp. 256-256

Author(s):

M. Aktaruzzaman ◽

Y. G. Lee ◽

T. Afroz ◽

B. S. Kim ◽

H. D. Shin

Keyword(s):

Botrytis Cinerea ◽

Gray Mold ◽

First Report

Download Full-text

First report of gray mold rot disease on tomato (Solanum lycopersicum L.) caused by Botrytis cinerea in Malaysia

Journal of Plant Pathology ◽

10.1007/s42161-018-0155-2 ◽

2018 ◽

Vol 101 (1) ◽

pp. 207-207 ◽

Cited By ~ 1

Author(s):

Ahmadu Tijjani ◽

Siti Izera Ismail ◽

Ahmad Khairulmazmi ◽

Omar Dzolkhifli

Keyword(s):

Botrytis Cinerea ◽

Solanum Lycopersicum ◽

Gray Mold ◽

First Report ◽

Solanum Lycopersicum L ◽

Rot Disease ◽

Gray Mold Rot

Download Full-text

Sexual Recombination in the Botrytis cinerea Populations in Hungarian Vineyards

Phytopathology ◽

10.1094/phyto-98-12-1312 ◽

2008 ◽

Vol 98 (12) ◽

pp. 1312-1319 ◽

Cited By ~ 28

Author(s):

Kálmán Z. Váczy ◽

Erzsébet Sándor ◽

Levente Karaffa ◽

Erzsébet Fekete ◽

Éva Fekete ◽

...

Keyword(s):

Botrytis Cinerea ◽

Geographic Origin ◽

Elongation Factor ◽

Gray Mold ◽

Fixation Index ◽

Phylogenetic Species ◽

Chi Square ◽

Phylogenetic Resolution ◽

Chi Square Test ◽

Group Ii

Botrytis cinerea (anamorph of Botryotinia fuckeliana) causes gray mold on a high number of crop plants including grapes. In this study, we investigated the genetic properties of a grape pathogenic population of B. cinerea in the area of Eger, Hungary. A total of 109 isolates from 12 areas were sampled. Based on the sequence of the β-tubulin (tub1) locus, they all belong to group II, a phylogenetic species within B. cinerea. Seventy-four isolates were classified as transposa, with both the Flipper and Boty transposons, and 10 were classified as vacuma, lacking both transposons. The remaining isolates contained either only Flipper (13) or Boty (12). Multilocus analysis of sequences from tub1 and two other loci (elongation factor 1-alpha, tef1, and a minisatellite from the intron of an ATPase, MSB1) led to poor phylogenetic resolution of strains in individual clades. Analysis of five microsatellites (Bc2, Bc3, Bc5, Bc6, and Bc10) resulted in 55 microsatellite haplotypes within the 109 strains. No correlation was detected among individual haplotypes and the presence/absence of Flipper and/or Boty, the geographic origin, or the year of isolation. Application of the index of association, the chi-square test, and the phi test consistently indicated that the population of Hungarian isolates of B. cinerea undergoes sexual reproduction. However, the index of association test suggested the presence of some clonality, and the fixation index showed a low or occasionally moderate level of fixation in the Flipper populations. We conclude that the B. cinerea populations in Hungary consist of a strongly recombining group II phylogenetic species.

Download Full-text