Occurrence of Hibiscus chlorotic ringspot virus in Hibiscus spp. in New Zealand

Hibiscus spp. are popular ornamental plants in New Zealand. The genus is susceptible to Hibiscus chlorotic ringspot virus (HCRSV), a member of the genus Carmovirus, which has been reported in Australia, El Salvador, Singapore, the South Pacific Islands, Taiwan, Thailand, and the United States (1–4). In May of 2004, chlorotic spotting and ringspots were observed on the leaves of two H. rosa-sinensis plants in a home garden in Auckland, New Zealand. When inoculated with sap from symptomatic leaves, Chenopodium quinoa and C. amaranticolor developed faint chlorotic local lesions 12 to 15 days later. Phaseolus vulgaris exhibited small necrotic local spots 10 days postinoculation. No symptoms were observed on inoculated plants of Cucumis sativus, Gomphrena globosa, Nicotiana Clevelandii, N. tabacum, or N. sylvestris. Plants of H. rosa-sinensis and the three symptomatic indicator species tested positive for HCRSV using polyclonal antiserum (Agdia Inc., Elkhart, IN) in a double antibody sandwich (DAS)-ELISA. Forward (5′-GGAACCCGTCCTGTTACTTC-3′) and reverse (5′-ATCACATCCACATCCCCTTC-3′) primers were designed on the basis of a conserved region in the coat protein gene (nt 2722–3278) of HCRSV isolates in GenBank (Accession Nos. X86448 and DQ392986). A product of the expected size (557 bp) was amplified by reverse transcription (RT)-PCR with total RNA extracted from the four infected species. Comparison of the sequence of the amplicon from H. rosa-sinensis (GenBank Accession No. EU554660) with HCRSV isolates from Singapore and Taiwan (GenBank Accession Nos. X86448 and DQ392986) showed 99 and 94% nucleotide identity, respectively. From 2006 to 2008, samples from a further 25 symptomatic hibiscus plants were collected from different locations in the Auckland region. Nineteen, including plants of H. diversifolius, H. rosa-sinensis, and H. syriacus, tested positive for HCRSV by RT-PCR. To our knowledge, this is the first report of HCRSV in New Zealand and of the virus in H. diversifolius and H. syriacus. HCRSV is considered to be widespread in New Zealand. References: (1) A. A. Brunt et al. Plant Pathol. 49:798, 2000. (2) S. C. Li et al. Plant Pathol. 51:803, 2002. (3) H. Waterworth. No.227 in: Descriptions of Plant Viruses. CMI/AAB, Surrey, UK, 1980. (4) S. M. Wong et al. Acta Hortic. 432:76, 1996.

Download Full-text

First Report of Wheat streak mosaic virus on Wheat in New Zealand

Plant Disease ◽

10.1094/pdis-93-4-0430b ◽

2009 ◽

Vol 93 (4) ◽

pp. 430-430 ◽

Cited By ~ 6

Author(s):

B. S. M. Lebas ◽

F. M. Ochoa-Corona ◽

B. J. R. Alexander ◽

R. A. Lister ◽

J. D. F. Fletcher ◽

...

Keyword(s):

New Zealand ◽

Mosaic Virus ◽

Total Yield ◽

The United States ◽

Plant Viruses ◽

Wheat Streak Mosaic Virus ◽

Rt Pcr ◽

Wheat Curl Mite ◽

Experimental Trials ◽

Das Elisa

In August of 2005, seeds of wheat (Triticum aestivum) breeding line 6065.3 tested positive for Wheat streak mosaic virus (WSMV; genus Tritimovirus) by a WSMV-specific reverse transcription (RT)-PCR assay (2). The sequence of the 200-bp amplicon (GenBank Accession No. FJ434246) was 99% identical with WSMV isolates from Turkey and the United States (GenBank Accession Nos. AF454455 and AF057533) and 96 to 97% identical to isolates from Australia (GenBank Accession Nos. DQ888801 to DQ888805 and DQ462279), which belong to the subclade D (1). As a result, an extensive survey of three cereal experimental trials and 105 commercial wheat crops grown on the South Island of New Zealand was conducted during the 2005–2006 summer to determine the distribution of WSMV. Wherever possible, only symptomatic plants were collected. Symptoms on wheat leaf samples ranged from very mild mosaic to symptomless. In total, 591 leaf samples suspected to be symptomatic were tested for WSMV by a double-antibody sandwich (DAS)-ELISA (DSMZ, Braunschweig, Germany). Of the 591 symptomatic samples, 81 tested positive. ELISA results were confirmed by RT-PCR with novel forward (WSMV-F1; 5′-TTGAGGATTTGGAGGAAGGT-3′) and reverse (WSMV-R1; 5′-GGATGTTGCCGAGTTGATTT-3′) primers designed to amplify a 391-nt fragment encoding a region of the P3 and CI proteins. Total RNA was extracted from the 81 ELISA-positive leaf samples using the Plant RNeasy Kit (Qiagen Inc., Chatsworth, CA). The expected size fragment was amplified from each of the 81 ELISA-positive samples. The positive samples represent 30 of 56 wheat cultivars (54%) collected from 28 of 108 sites (26%) sampled in the growing regions from mid-Canterbury to North Otago. These results suggest that WSMV is widespread in New Zealand both geographically and within cultivars. WSMV is transmitted by the wheat curl mite (Aceria tosichella) (3), which had not been detected in New Zealand despite repeated and targeted surveys. WSMV is of great economic importance in some countries, where the disease has been reported to cause total yield loss (3). Although WSMV is transmitted by seeds at low rates (0.1 to 0.2%) (4), it is the most likely explanation of the spread of the disease in New Zealand. References: (1) G. I. Dwyer et al. Plant Dis. 91:164, 2007. (2) R. French and N. L. Robertson. J. Virol. Methods 49:93, 1994. (3) R. French and D. C. Stenger. Descriptions of Plant Viruses. Online publication. No. 393, 2002. (4) R. A. C. Jones et al. Plant Dis. 89:1048, 2005.

Download Full-text

First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada

Plant Disease ◽

10.1094/pdis.2004.88.5.575a ◽

2004 ◽

Vol 88 (5) ◽

pp. 575-575 ◽

Cited By ~ 12

Author(s):

R. R. Martin ◽

I. E. Tzanetakis ◽

J. E. Barnes ◽

J. F. Elmhirst

Keyword(s):

British Columbia ◽

Chenopodium Quinoa ◽

The United States ◽

Ringspot Virus ◽

Broad Host Range ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

The Family ◽

Polymerase Chain

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

Download Full-text

The Decolonisation of the Pacific Islands

Itinerario ◽

10.1017/s0165115300014558 ◽

2000 ◽

Vol 24 (3-4) ◽

pp. 173-191 ◽

Cited By ~ 3

Author(s):

Robert Aldrich

Keyword(s):

New Zealand ◽

Pacific Islands ◽

New Caledonia ◽

Solomon Islands ◽

New Guinea ◽

The United States ◽

French Polynesia ◽

American Samoa ◽

Caroline Islands ◽

Foreign Control

At the end of the Second World War, the islands of Polynesia, Melanesia and Micronesia were all under foreign control. The Netherlands retained West New Guinea even while control of the rest of the Dutch East Indies slipped away, while on the other side of the South Pacific, Chile held Easter Island. Pitcairn, the Gilbert and Ellice Islands, Fiji and the Solomon Islands comprised Britain's Oceanic empire, in addition to informal overlordship of Tonga. France claimed New Caledonia, the French Establishments in Oceania (soon renamed French Polynesia) and Wallis and Futuna. The New Hebrides remained an Anglo-French condominium; Britain, Australia and New Zealand jointly administered Nauru. The United States' territories included older possessions – the Hawaiian islands, American Samoa and Guam – and the former Japanese colonies of the Northern Marianas, Mar-shall Islands and Caroline Islands administered as a United Nations trust territory. Australia controlled Papua and New Guinea (PNG), as well as islands in the Torres Strait and Norfolk Island; New Zealand had Western Samoa, the Cook Islands, Niue and Tokelau. No island group in Oceania, other than New Zealand, was independent.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽

10.1094/pdis-09-13-0992-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701

Author(s):

K.-S. Ling ◽

R. Li ◽

D. Groth-Helms ◽

F. M. Assis-Filho

Keyword(s):

United States ◽

Dominican Republic ◽

Mosaic Virus ◽

Potato Spindle Tuber Viroid ◽

The United States ◽

Disease Outbreak ◽

Ringspot Virus ◽

Rt Pcr ◽

Spot Virus ◽

Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

Download Full-text

First Report of Soilborne Rye Mosaic Virus in Rye in Denmark

Plant Disease ◽

10.1094/pdis.1999.83.11.1074a ◽

1999 ◽

Vol 83 (11) ◽

pp. 1074-1074 ◽

Cited By ~ 3

Author(s):

S. L. Nielsen ◽

M. Nicolaisen ◽

R. Koenig ◽

W. Huth

Keyword(s):

Mosaic Virus ◽

Trypan Blue ◽

Chenopodium Quinoa ◽

Average Diameter ◽

First Record ◽

Plant Viruses ◽

Polyclonal Antiserum ◽

Polymyxa Graminis ◽

Sequence Identity ◽

Rigid Rod

Soilborne wheat mosaic furovirus (SBWMV)-like particles were detected in rye (Secale cereale) grown in sandy soil in West Zealand during spring 1999. Infected plants showed yellow leaf mosaic and light stunting. Electron microscopy of negatively stained crude sap preparations revealed rigid rod-shaped particles with two average lengths, 296 and 162 nm; average diameter was 23 nm. Sap-inoculation to Chenopodium quinoa and C. amaranticolor produced local leaf lesions when grown at 17°C but none when grown at 22 to 25°C. All the features agree with the description of SBWMV (1). Immunosorbent electronmicroscopy with polyclonal antiserum produced by W. Huth to furovirus-like particles isolated from rye in Germany gave a distinct decoration to particles. Light microscopy of roots cleared with 10% KOH and stained with a 0.5% solution of trypan blue in lactoglycerol revealed resting spores with a morphology and size similar to Polymyxa graminis, a furovirus vector. This is the first record of a furovirus on cereals in Denmark. The complete nucleotide sequence of the isolate was analyzed and compared with data on isolates from wheat. Sequence identity was only 74%. Therefore, the isolate was designated as soilborne rye mosaic virus. SBRMV has been recorded previously in rye and triticale in several regions of Germany (2). References: (1) M. K. Brakke. 1971. CMI/AAB Descr. Plant Viruses No. 77. (2) W. Huth. Nachrichtenbl. Dtsch. Pflanzenschutzdienstes 50:163, 1998.

Download Full-text

Burden-sharing: the US, Australia and New Zealand alliances in the Pacific islands

International Affairs ◽

10.1093/ia/iiab081 ◽

2021 ◽

Author(s):

Joanne Wallis ◽

Anna Powles

Keyword(s):

United States ◽

New Zealand ◽

Pacific Islands ◽

Critical Role ◽

The United States ◽

Burden Sharing ◽

Military Capability ◽

The Pacific ◽

Security Challenges ◽

The Us

Abstract One of President Joseph Biden's foreign policy priorities is to ‘renew’ and ‘strengthen’ the United States' alliances, as they were perceived to have been ‘undermined’ during the Trump administration, which regularly expressed concern that allies were free-riding on the United States' military capability. Yet the broad range of threats states face in the contemporary context suggests that security assistance from allies no longer only—or even primarily—comes in the form of military capability. We consider whether there is a need to rethink understandings of how alliance relationships are managed, particularly how the goals—or strategic burdens—of alliances are understood, how allies contribute to those burdens, and how influence is exercised within alliances. We do this by analysing how the United States–Australia and Australia–New Zealand alliances operate in the Pacific islands. Our focus on the Pacific islands reflects the United States' perception that the region plays a ‘critical’ role in helping to ‘preserve a free and open Indo-Pacific region’. We conclude that these understandings need to be rethought, particularly in the Pacific islands, where meeting non-traditional security challenges such as economic, social and environmental issues, is important to advancing the United States, Australia and New Zealand's shared strategic goal of remaining the region's primary security partners and ensuring that no power hostile to their interests establishes a strategic foothold.

Download Full-text

First Report of a Carlavirus in Fuchsia spp. in New Zealand

Plant Disease ◽

10.1094/pdis-05-11-0443 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1484-1484 ◽

Cited By ~ 2

Author(s):

Z. Perez-Egusquiza ◽

L. W. Liefting ◽

S. Veerakone ◽

G. R. G. Clover ◽

M. Ciuffo

Keyword(s):

Electron Microscopy ◽

New Zealand ◽

Coat Protein ◽

Chenopodium Quinoa ◽

Plant Diseases ◽

Nucleotide Identity ◽

Impatiens Necrotic Spot Virus ◽

Rt Pcr ◽

First Report ◽

Genome Region

The genus Fuchsia has 110 known species and numerous hybrids. These ornamental plants with brightly colored flowers originate from Central and South America, New Zealand, and Tahiti, but a wider variety are now grown all over the world. Few viruses have been reported in Fuchsia spp.: a carlavirus, Fuchsia latent virus (FLV) (1–3), a cucumovirus, Cucumber mosaic virus (CMV) (3), and two tospoviruses, Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) (4). In August 2009, five plants, each representing a different cultivar of Fuchsia hybrid, from home gardens in the Auckland and Southland regions of New Zealand, displayed variable symptoms including mild chlorosis, mild mottle, or purple spots on leaves. Plants tested negative for CMV, INSV, and TSWV using commercial ImmunoStrips (Agdia Inc., Elkhart, IN); however, flexuous particles of ~650 to 700 nm were found by electron microscopy in all samples. Local lesions were also observed on Chenopodium quinoa plants 4 weeks after sap inoculation. Total RNA was extracted from all plants with a RNeasy Plant Mini Kit (Qiagen Inc., Doncaster, Australia) and tested by reverse transcription (RT)-PCR using two generic sets of primers (R. van der Vlugt, personal communication) designed to amplify fragments of ~730 and 550 bp of the replicase and coat protein genes of carlaviruses, respectively. Amplicons of the expected size were obtained for all samples, cloned, and at least three clones per sample were sequenced. No differences within clones from the same samples were observed (GenBank Accession Nos. HQ197672 to HQ197681). A BLASTn search of the viral replicase fragment showed the highest nucleotide identity (76%) to Potato rough dwarf virus (PRDV) (EU020009), whereas the coat protein fragment had maximum nucleotide identity (70 to 72%) to PRDV (EU020009 and DQ640311) and Potato virus P (DQ516055). Sequences obtained were also pairwise aligned using the MegAlign program (DNASTAR, Inc., Madison, WI) and results showed that the isolates had 83 to 97% identity to each other within each genome region. Further sequences (HQ197925 and HQ197926) were obtained from a Fuchsia plant originating from Belgium, a BLASTn analysis showed high nucleotide identity (84 to 99%) to the New Zealand isolates. The low genetic identity to other Carlavirus members suggests that these isolates belong to a different species from those previously sequenced. On the basis of electron microscopy and herbaceous indexing, the isolates had similar characteristics to a carlavirus reported from Fuchsia in Italy (1) and FLV reported in Canada (2). The Italian carlavirus isolate was obtained and tested with the same primers by RT-PCR. Pairwise analysis of the Italian sequences (HQ197927 and HQ197928) with the New Zealand and Belgian sequences showed between 84 and 95% similarity within each genome region. These results suggest that the carlavirus infecting these plants is the same virus, possibly FLV. To our knowledge, this is the first report of this carlavirus infecting Fuchsia spp. in New Zealand, but the virus has probably been present for some time in this country and is likely to be distributed worldwide. References: (1) G. Dellavalle et al. Acta Hortic. 432:332, 1996. (2) L. J. John et al. Acta Hortic. 110:195, 1980. (3) P. Roggero et al. Plant Pathol. 49:802, 2000. (4) R. Wick and B. Dicklow. Diseases in Fuchsia. Common Names of Plant Diseases. Online publication. The American Phytopathological Society, St. Paul, MN, 1999.

Download Full-text

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽

10.1094/pdis-91-4-0463c ◽

2007 ◽

Vol 91 (4) ◽

pp. 463-463 ◽

Cited By ~ 6

Author(s):

I. E. Tzanetakis ◽

J. D. Postman ◽

R. R. Martin

Keyword(s):

United States ◽

The United States ◽

Ringspot Virus ◽

Tobacco Streak Virus ◽

Rapid Decline ◽

Streak Virus ◽

Black Raspberry ◽

Rt Pcr ◽

Indicator Plants ◽

First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

Download Full-text

Development of a Molecular Tool for the Diagnosis of Leprosis, a Major Threat to Citrus Production in the Americas

Plant Disease ◽

10.1094/pdis.2003.87.11.1317 ◽

2003 ◽

Vol 87 (11) ◽

pp. 1317-1321 ◽

Cited By ~ 46

Author(s):

Eliane Cristina Locali ◽

Juliana Freitas-Astua ◽

Alessandra Alves de Souza ◽

Marco Aurélio Takita ◽

Gustavo Astua-Monge ◽

...

Keyword(s):

The United States ◽

Plant Viruses ◽

South American ◽

Rt Pcr ◽

Citrus Industry ◽

Genes Encoding ◽

Citrus Production ◽

Tentative Member ◽

Polymerase Chain ◽

Genomic Regions

Citrus leprosis virus (CiLV), a tentative member of the Rhabdoviridae family, affects citrus trees in Brazil, where it is transmitted by mites Brevipalpus spp. It also occurs in other South American countries and was recently identified in Central America. This northbound spread of CiLV is being considered a serious threat to the citrus industry of the United States. However, despite its importance, difficulties related to the biology of CiLV have hindered much of the progress regarding its accurate detection, leaving both the analyses of symptoms and electron microscopy as the only tools available. An attempt to overcome this problem was made by constructing a cDNA library from double-stranded RNA extracted from leprosis lesions of infected Citrus sinensis (sweet orange) leaves. After cloning and sequencing, specific primers were designed to amplify putative CiLV genome regions with similarity to genes encoding the movement protein and replicase of other plant viruses. RNA from infected citrus plants corresponding to different varieties and locations were amplified by reverse transcription-polymerase chain reaction (RT-PCR) using the two pairs of primers. Amplified products were purified, cloned in pGEM-T, and sequenced. The sequences confirmed the genomic regions previously associated with CiLV. The results demonstrate that RT-PCR was specific, accurate, rapid, and reliable for the detection of CiLV.

Download Full-text

Characterization of Cherry leafroll virus in Sweet Cherry in Washington State

Plant Disease ◽

10.1094/pdis-94-8-1067b ◽

2010 ◽

Vol 94 (8) ◽

pp. 1067-1067 ◽

Cited By ~ 2

Author(s):

K. C. Eastwell ◽

W. E. Howell

Keyword(s):

Mosaic Virus ◽

Sweet Cherry ◽

The United States ◽

Ringspot Virus ◽

Natural Occurrence ◽

Rt Pcr ◽

Fresh Market ◽

Arabis Mosaic Virus ◽

Leafroll Virus ◽

Cherry Trees

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Download Full-text