scholarly journals First Report of Turnip mosaic virus in Pisum sativum in Spain

Plant Disease ◽  
2003 ◽  
Vol 87 (1) ◽  
pp. 103-103 ◽  
Author(s):  
E. Segundo ◽  
G. Martín-Bretones ◽  
L. Ruiz ◽  
L. Velasco ◽  
D. Janssen ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Pisum Sativum ◽  
Mosaic Virus ◽  
Chenopodium Quinoa ◽  
The United States ◽  
Amino Acid Identity ◽  
Turnip Mosaic Virus ◽  
First Report ◽  
Flower Abortion ◽  
Chlorotic Mottle

During 2001 and 2002, Pisum sativum var. vulgare plants grown as commercial crops in Almeria (southeast Spain) showed vein clearing and chlorotic mottle of leaves, leaf deformation, flower abortion, necrotic mottle and deformation of pods, and stunted plant growth. Crude sap of collected plants was mechanically inoculated on healthy pea plants which reproduced symptoms observed in the field; local necrotic lesions were produced on mechanically infected Chenopodium quinoa, C. amaranticolor, and Gomphrena globosa, systemic mosaic symptoms on Brassica napus and Nicotiana benthamiana, and local lesions plus systemic mosaic symptoms on N. clevelandii, which are all characteristic of Turnip mosaic virus (TuMV) (1). A reverse transcription-polymerase chain reaction assay using general primers for the extreme 3′ end of the potyvirus genome amplified products of 750 and 1,700 bp in nucleic acid extracts from naturally infected pea plants as well as from the mechanically infected test plants. The overlapping nucleotide sequences of the products (GenBank Accession No. AJ489259) had a nucleotide sequence identity of 86.5% and a derived amino acid identity of 95.0% with several published sequences of TuMV (1). This report cites the first partial nucleotide sequence of TuMV infecting pea crops, and although natural infections of this virus in pea have been reported in Morocco (1976) and in the United States (2), to our knowledge, this is the first report of TuMV in Spain. References: (1) P. Lehmann et al. Physiol. Mol. Plant Pathol. 51:195, 1997. (2) R. Provvidenti. Plant Dis. Rep. 62:482, 1978.

scholarly journals First Report of Maize chlorotic mottle virus Infecting Maize in the Democratic Republic of the Congo

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1448-1448 ◽  
Author(s):  
M. Lukanda ◽  
A. Owati ◽  
P. Ogunsanya ◽  
K. Valimunzigha ◽  
K. Katsongo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Democratic Republic ◽  
The United States ◽  
Mottle Virus ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Republic Of The Congo

Maize (Zea mays L.) is a major food and fodder crop cultivated on 1.54 million ha in the Democratic Republic of the Congo (DRC). In December 2013, unusually severe chlorotic mottle symptoms and pale green streaks were observed in local varieties (Mudishi 1 and 2, Bambou, Kasayi, H614, H613, and Mugamba) and exotic varieties (H520, H624, H403, HDK8031, and ZM607) in Beni, Lubero, and Rutshuru territories at 1,015 to 1,748 m elevation in North Kivu Province. Symptoms were prominent on newly emerging leaves that later developed marginal necrosis resembling the symptoms of maize lethal necrosis (MLN), caused by a dual infection of Maize chlorotic mottle virus (MCMV, genus Machlomovirus) and Sugarcane mosaic virus (SCMV, genus Potyvirus). Each of these viruses, but particularly MCMV, is also known to cause severe mosaic and mottling symptoms in maize (4). In January 2014, symptomatic and asymptomatic samples (n = 20) from disease-affected fields in Beni and Lubero provinces were collected for virus testing using Whatman FTA Classic Cards (1) and analyzed for MCMV (2681F: 5′-ATGAGAGCAGTTGGGGAATGCG and 3226R: 5′-CGAATCTACACACACACACTCCAGC) and SCMV (8679F: 5′-GCAATGTCGAAGAAAATGCG and 9595R: 5′-GTCTCTCACCAAGAGACTCGCAGC) by reverse transcription (RT)-PCR (4). Samples were also analyzed for Maize streak virus (MSV, genus Mastrevirus), an endemic virus in DRC, by PCR using MSV specific primers (MSV215-234: CCAAAKDTCAGCTCCTCCG and MSV1770-1792: TTGGVCCGMVGATGTASAG) (3). A DNA product of expected size (~520 bp) resulted only for MCMV in all the symptomatic plant samples. None of the samples tested positive for SCMV or MSV. RT-PCR analyses were performed to ascertain the absence of potyviruses using the degenerate potyvirus primers (CIFor: 5′GGIVVIGTIGGIWSIGGIAARTCIAC and CIRev: 5′ACICCRTTYTCDATDATRTTIGTIGC3′) (2) were also negative. Occurrence of MCMV in symptomatic samples was further confirmed by antigen-coated plate (ACP)-ELISA using anti-MCMV rabbit polyclonal antibodies produced at the Virology Unit, IITA, Ibadan, Nigeria. The RT-PCR product of MCMV was purified and sequenced in both directions (GenBank Accession No. KJ699379). Pairwise comparison of 518 bp nucleotide sequence corresponding to p32 and p37 open reading frames of MCMV by BLASTn search revealed 99.8% nucleotide sequence identity with an MCMV isolate from Kenya (JX286709), 98 to 99% identity with the isolates from China (JQ982468 and KF010583), and 96% identity with the isolates from the United States (X14736 and EU358605). MCMV is a newly emerging virus in Africa, first detected during a severe MLND outbreak in 2011 in Kenya (4). This disease has since become a serious threat to maize production in East Africa. MCMV has been reported in maize from Kenya, Rwanda, Tanzania, and Uganda. To our knowledge, this is the first report of MCMV occurrence in DRC. This finding confirms the further geographic expansion of MCMV and illustrates the need for further studies to identify vectors and also create awareness about the disease and to strengthen surveillance to prevent its further spread in the continent. References: (1) O. J. Alabi et al. J. Virol. Met. 154:111, 2008. (2) C. Ha et al. Arch. Virol. 153:25, 2008. (3) K. E. Palmer and E. P. Rybicki. Arch. Virol. 146:1089, 2001. (4) A. Wangai et al. Plant Dis. 96:1582, 2012.

scholarly journals First Report of Alternanthera mosaic virus Infection in Angelonia in the United States

Plant Disease ◽  
2008 ◽  
Vol 92 (10) ◽  
pp. 1473-1473 ◽  
Author(s):  
B. E. Lockhart ◽  
M. L. Daughtrey
Keyword(s):  
United States ◽  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Genomic Sequence ◽  
Nutrient Deficiency ◽  
Leaf Tissue ◽  
The United States ◽  
Nucleotide Sequence Analysis ◽  
Degenerate Primers ◽  
First Report

Stunting, chlorosis, and light yellow mottling resembling symptoms of nutrient deficiency were observed in angelonia (Angelonia angustifolia) in commercial production in New York. Numerous, filamentous particles 520 to 540 nm long and spherical virus particles 30 nm in diameter were observed by transmission electron microscopy (TEM) in negatively stained partially purified extracts of symptomatic Angelonia leaf tissue. Two viruses, the filamentous potexvirus Alternanthera mosaic virus (AltMV) and the spherical carmovirus Angelonia flower break virus (AnFBV) were subsequently identified on the basis of nucleotide sequence analysis of amplicons generated by reverse transcription (RT)-PCR using total RNA isolated from infected leaf tissue. A 584-bp portion of the replicase-encoding region of the AltMV genome was obtained with the degenerate primers Potex 2RC (5′-AGC ATR GNN SCR TCY TG-3′) and Potex 5 (5′-CAY CAR CAR GCM AAR GAT GA-3′) (3). Forward (AnFBV CP 1F-5′-AGC CTG GCA ATC TGC GTA CTG ATA-3′) and reverse (AnFBV CP 1R-5′-AAT ACC GCC CTC CTG TTT GGA AGT-3′) primers based on the published AnFBV genomic sequence (GenBank Accession No. NC_007733) were used to amplify a portion of the viral coat protein (CP) gene. The nucleotide sequence of the amplicon generated using the potexvirus-specific primers (GenBank Accession No. EU679362) was 99% identical to the published AltMV (GenBank Accession No. NC_007731) sequence and the nucleotide sequence of the amplicon obtained using the AnFBV CP primers was 99% identical to the published AnFBV genomic sequence (GenBank Accession No. EU679363). AnFBV occurs widely in angelonia (1) and AltMV has been identified in phlox (2). These data confirm the presence of AltMV and AnFBV in diseased angelonia plants showing stunting and nutrient deficiency-like symptoms and substantiates, to our knowledge, this first report of AltMV in angelonia in the United States. References: (1) S. Adkins et al. Phytopathology 96:460, 2006. (2) J. Hammond et al. Arch. Virol. 151:477, 2006. (3) R. A. A. van der Vlugt and M. Berendeson. Eur. J. Plant Pathol. 108:367, 2002.

scholarly journals First Report of Cowpea Aphid-Borne Mosaic Potyvirus from Cowpeas Grown Commercially in the U.S.

Plant Disease ◽  
1997 ◽  
Vol 81 (8) ◽  
pp. 959-959 ◽  
Author(s):  
A. S. Kline ◽  
E. J. Anderson
Keyword(s):  
Chenopodium Quinoa ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
First Report ◽  
Chlorotic Mottle ◽  
Cowpea Aphid ◽  
Healthy Control ◽  
Systemic Infections ◽  
The U.S

Cowpea aphid-borne mosaic potyvirus (CABMV) is one of several seed-borne viruses known to limit cowpea (Vigna unguiculata (L.) Walp. subsp. unguiculata) production in Africa, Europe, and Asia, but CABMV has not been reported on commercially grown cowpeas in the United States (1). However, a sesame (Sesamum indicum L.)-infecting isolate of CABMV was recently characterized from plants growing near cowpea introduction plots in Georgia (2). In February 1997, we received samples of three seed lots of cowpea cv. Chinese Red that had been harvested in southern Texas during 1996. Approximately 28% of the plants grown from these seed lots expressed strong mosaic symptoms on primary and trifoliate leaves. Viruslike symptoms were reproduced following mechanical transmission to plants of Chinese Red cowpea, Nicotiana benthamiana, and soybean (Glycine max L.) cv. Lee. When Coronet and Pinkeye Purple Hull-BVR cowpeas were inoculated with sap extracts from symptomatic Chinese Red plants, chlorotic lesions developed on inoculated leaves, but only Coronet plants supported symptomless systemic infections. Similarly inoculated plants of Chenopodium quinoa (L.) and common bean (Phaseolus vulgaris L.) cvs. Pinto and Black Valentine developed localized chlorotic lesions. In Ouchterlony gel diffusion assays, extracts from symptomatic cowpea plants did not react with antisera to blackeye cowpea mosaic potyvirus (BlCMV), cucumber mosaic cucu-movirus (CMV), southern bean mosaic sobemovirus, cowpea mosaic comovirus, cowpea severe mosaic comovirus, or cowpea chlorotic mottle bromovirus. In the indirect enzyme-linked immunosorbent assay, sap extracts from symptomatic plants reacted with antiserum to CABMV, giving OD values at A405 of 0.10 to 0.25, and reacted weakly with antiserum to BlCMV, with OD values at A405 less than 0.035. Extracts from healthy control plants gave OD values at A405 less than 0.010. No positive reactions were obtained with antisera to bean yellow mosaic potyvirus, peanut mottle potyvirus, soybean mosaic potyvirus, or CMV. To our knowledge, this is the first report of CABMV in commercially grown cowpea from the U.S. References: (1) A. G. Gillaspie et al. Plant Dis. 79:388, 1995. (2) H. R. Pappu et al. Arch. Virol. 142:1, 1997.

scholarly journals First Report of Turnip mosaic virus in Tomatillo (Physalis philadelphica) in California

Plant Disease ◽  
2012 ◽  
Vol 96 (2) ◽  
pp. 296-296 ◽  
Author(s):  
H.-Y. Liu ◽  
S. T. Koike ◽  
D. Xu ◽  
R. Li
Keyword(s):  
Mosaic Virus ◽  
Green Peach Aphid ◽  
Chenopodium Quinoa ◽  
Turnip Mosaic Virus ◽  
Causal Agent ◽  
Western Hemisphere ◽  
Degenerate Primers ◽  
First Report ◽  
Severe Stunting ◽  
Access Period

Tomatillo is an important vegetable in Mexican cuisine. It is of Mesoamerica origin and now is grown widely in the Western Hemisphere. In 2011, 2% of commercially grown tomatillo plants in San Benito County, California exhibited severe stunting with foliage showing mosaic symptoms and leaf distortion. The fruits on infected plants were mottled and unmarketable. Flexuous filamentous-shaped virus particles of 800 to 850 nm long and 11 to 12 nm wide were observed from sap of the symptomatic plants with a transmission electron microscope. Sap from the diseased tomatillo plants reacted positively in an immunostrip assay for potyvirus (Agdia Inc., Elkhart, IN), indicating a potyvirus was associated with the disease. The causal agent was mechanically transmitted from the diseased field plants to six virus-free greenhouse tomatillo plants and all inoculated plants induced identical symptoms. The causal agent was also transmitted to Chenopodium quinoa and C. murale (chlorotic local lesions) and Nicotiana clevelandii, N. tabacum, and Physalis wrightii (systemic symptoms). The disease was also transmitted to tomatillo plants by the green peach aphid (Myzus persicae) in a nonpersistent manner (1-min acquisition access period and 1-min transmission access period with no latent period). To further identify the causal agent, total nucleic acids were extracted by a cetyltrimethylammoniumbromide (CTAB) method (2) and tested by reverse transcription-PCR using potyvirus degenerate primers CIFor and CIRev (1). An amplicon of approximately 700 bp from the diseased tomatillo was cloned and sequenced. Analysis of the 631-bp partial CI sequence (GenBank Accession No. JN601884) showed that the virus had 93.6% nucleotide identity and 100% amino acid identity with cognate regions of Turnip mosaic virus (TuMV) (GenBank Accession No. D10927). Our results indicated that the disease was caused by TuMV. To our knowledge, this is the first report of TuMV in tomatillo. Since TuMV has a wide host range and is readily transmitted by green peach aphids, TuMV could be a new threat to tomatillo production in California. References: (1) C. Ha et al. Arch. Virol. 153:25, 2008. (2) R. Li et al. J. Virol. Methods 154:48, 2008.

scholarly journals First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1664-1664 ◽  
Author(s):  
B. Babu ◽  
H. Dankers ◽  
S. George ◽  
D. Wright ◽  
J. Marois ◽  
...  
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
The United States ◽  
Turnip Mosaic Virus ◽  
Brassica Carinata ◽  
Rt Pcr ◽  
First Report ◽  
Ethiopian Mustard ◽  
Plant Pathol ◽  
Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

scholarly journals First Report of Maize chlorotic mottle virus on Sweet Corn in Taiwan

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1748-1748 ◽  
Author(s):  
T.-C. Deng ◽  
C.-M. Chou ◽  
C.-T. Chen ◽  
C.-H. Tsai ◽  
F.-C. Lin
Keyword(s):  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Sweet Corn ◽  
Mottle Virus ◽  
Rt Pcr ◽  
First Report ◽  
Cp Gene ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

In February 2014, a severe disease on maize (Zea mays L.) broke out in the fields of central and southwestern Taiwan and caused yield losses in sweet corn production. Chlorotic spots first appeared at the base of infected leaves and later developed into systemic mottling. Diffused necrotic patches were also found on leaves or husks of the diseased plants. Moreover, severe rosetting and stunting accompanied by abnormalities in ear production were observed on mature plants. Eighteen leaf samples from symptomatic plants were collected and submitted to our Plant Diagnostic Clinic for virus diagnosis. All of the samples were first tested by reverse transcriptase (RT)-PCR to detect Maize stripe virus (MSpV) and by indirect ELISA to detect Maize dwarf mosaic virus (MDMV) or Sugarcane mosaic virus (SCMV), which were endemic to this area (1). Only 2 out of 18 samples were positive for MDMV, SCMV, or mixed infection of both viruses. Sap inoculation tests conducted on seedlings of sweet corn cv. Honey 236 indicated that the MDMV- and SCMV-negative samples still had an unknown pathogen causing original symptoms in the receptor plants. The isolate from Yunlin county reacted only with the antibody to Maize chlorotic mottle virus (MCMV) (AC Diagnostics, Fayetteville, AR) in ELISA. For further identification, the MCMV-specific primers (forward: MCMVg3514F-GGGAACAACCTGCTCCA; reverse MCMVg4014R-GGACACGGAGTACGAGA) were designed from the nucleotide sequence of MCMV coat protein (CP) gene. In RT-PCR using the AccuPower RT/PCR PreMix kit (Bioneer, Daejeon, Korea), an expected 500-bp DNA fragment was observed. This PCR product was cloned and its nucleotide sequence was determined by Mission Biotech Co., Taipei, Taiwan. BLAST analysis of the CP gene of the MCMV-Yunlin revealed the maximum nucleotide identities (99%) with Chinese Sichuan isolates (GenBank Accession No. JQ984270) and 98% identities to four Chinese Yunnan isolates (GU138674, JQ982468, JQ982469, and KF010583) and one Kenya isolate (JX286709), compared with 97% to Kansas isolate (X14736) and 96% to Nebraska isolate (EU358605). Subsequently, the complete nucleotide sequence of the viral genome (KJ782300) was determined from five overlapping DNA fragments obtained from independent RT-PCR amplification. The virus isolate was infectious to sweet corn cultivars Bai-long-wang, Devotion, SC-34, SC2015, and Zheng-zi-mi, on which similar symptoms were developed after mechanical inoculation. During the spring of 2014, a total of 224 sweet corn samples were collected from the epidemic areas of Taichung, Yunlin, Chiayi, and Kaohsiung counties. Samples (n= 161) reacted positive for MCMV in ELISA and/or RT-PCR. In the field survey, more than 20 adult thrips might be observed on an MCMV-infected plant. Two species of Frankliniella were found on maize plants: F. williamsi Hood and F. intonsa Trybom. Maize thrips (F. williamsi), an occasional pest of maize occurring during winter and spring in Taiwan, was characterized by its abdominal sternite II on which 1 or 2 discal setae of equal length with posteromarginal setae were borne (2). Samples with 1, 5, 10, and 30 F. williamsi collected in the field were tested by RT-PCR; MCMV was detectable not only in the pooled crushed bodies but also in a single maize thrips. This is the first report of MCMV occurrence on maize in Taiwan and of the virus transmitted by maize thrips. References: (1) C. T. Chen et al. Taiwan Sugar 37(4):9, 1990. (2) C.-L. Wang et al. Zool. Stud. 49:824, 2010.

scholarly journals First Report of Cowpea aphid-borne mosaic virus on Sesame in Paraguay

Plant Disease ◽  
2011 ◽  
Vol 95 (5) ◽  
pp. 613-613 ◽  
Author(s):  
L. Gonzalez Segnana ◽  
M. Ramirez de Lopez ◽  
A. P. O. A. Mello ◽  
J. A. M. Rezende ◽  
E. W. Kitajima
Keyword(s):  
Electron Microscopy ◽  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
The United States ◽  
Causal Agent ◽  
Nucleotide Sequence Analysis ◽  
Type I ◽  
First Report ◽  
San Pedro ◽  
Cowpea Aphid

Sesame (Sesamum indicum L.) is cultivated mainly in the central region of the Departamento de San Pedro in Paraguay from October to February and the seed are exported to Asia. The crop is grown on 100,000 ha annually and Escoba blanca is the most common cultivar. The crop plays an important socioeconomical role since it is cultivated mostly by small growers. A disease characterized by yellowing and curling down leaves and shortening of the internodes has been observed in almost all sesame-growing areas. It is referred to locally as “ka'are” because the affected sesame plant resembles Chenopodium ambrosioides L. This disease occurred occasionally and was of marginal importance prior to 2005, but during the last five growing seasons the disease incidence has increased substantially, with some growers losing the entire crop. To determine the causal agent, symptomatic leaf samples were collected from five commercial fields near Colonia San Pedro and Choré, Departamento San Pedro in December 2009. Preliminary transmission electron microscopy (TEM; Zeiss EM900) of extracts from symptomatic leaves revealed the presence of elongated flexible particles resembling a potyvirus. Mechanical transmission assays resulted in chlorotic local lesions on C. quinoa and C. amaranticolor, mosaic on Vigna unguiculata and Nicotiana benthamiana, and symptoms on sesame that are similar to those observed in the field. The disease could also be reproduced in sesame by aphid (Myzus persicae) transmission in a nonpersistent manner. TEM examination of leaf sections of these naturally or experimentally infected plants showed the presence of the type I cylindrical inclusions and masses of filamentous particles. Leaf extracts of naturally or experimentally infected sesame and test plants were positive for Cowpea aphid-borne mosaic virus (CABMV) on the basis of plate-trapped antigen (PTA)-ELISA. CABMV as the causal agent of “ka'are” disease of sesame in Paraguay was further confirmed by analyzing part of the nucleotide sequence of CABMV coat protein and 3′ nontranslated region that were obtained directly from reverse transcription-PCR product amplified with PV1-antisense primer (5′-gatttaggtgacactatagt17-3′) and WCIEN-sense primer (5′-atggtttggtgyatygaraat-3′) (1,2). Comparisons of the 676-bp nucleotide sequence of two sesame virus isolates (GenBank Accession Nos. HQ336402 and HQ336403) revealed 92% identity with the corresponding nucleotide sequence of CABMV available in the GenBank (Accession No. AF348210). Thus, all the assays indicated that the “ka'are” disease of sesame in Paraguay is caused by an isolate of CABMV. Several cowpea fields, nearby sesame diseased crops, also contained plants exhibiting mosaic symptoms. Transmission assays, electron microscopy, PTA-ELISA, and nucleotide sequence analysis indicated that they were also infected by CABMV and may play an important role in the epidemiology of this disease on sesame. CABMV isolates from passion fruit and cowpea from Brazil were mechanically transmitted to sesame but induced milder symptoms. CABMV-infected sesame was described in the United States (3), but to our knowledge, this is the first report of a severe disease on sesame caused by this virus in Paraguay. References: (1) A. Gibbs and A. Mackenzie. J. Virol. Methods 63:9, 1997. (2) L. D. C. Mota et al. Plant Pathol. 53:368, 2004. (3) H. R. Pappu et al. Arch. Virol. 142:1919, 1997.

scholarly journals First Report of Bidens mottle virus Causing Mosaic and Leaf Deformation in Garland Chrysanthemum and Lettuce in Taiwan

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 464-464 ◽  
Author(s):  
Y. K. Chen ◽  
J. Y. Lee
Keyword(s):  
Mosaic Virus ◽  
Zucchini Yellow Mosaic Virus ◽  
Chenopodium Quinoa ◽  
The United States ◽  
Mottle Virus ◽  
Yellow Mosaic Virus ◽  
Degenerate Primers ◽  
First Report ◽  
Cdna Sequences ◽  
Original Host

Garland chrysanthemum (Chrysanthemum coronarium) and lettuce (Lactuca sativa) are winter vegetables in Taiwan. Turnip mosaic virus (TuMV) and Lettuce mosaic virus (LMV) were potyviruses commonly isolated from garland chrysanthemum and lettuce, respectively (1). Symptoms of mosaic and deformation in leaves and stunting of plants have been observed in both Compositae crops in the fields since 2007 in the Chiayi area and with an increasing incidence in recent years (26 and 33% in garland chrysanthemum and lettuce, respectively). Filamentous virus particles (approximately 780 × 13 nm) in the crude sap and pinwheel inclusions in infected cells can be observed in the preparations of both diseased hosts with electron microscopy. However, TuMV, LMV, and other potyviruses (Bean yellow mosaic virus, Papaya ringspot virus, and Zucchini yellow mosaic virus) were not detectable in diseased samples by ELISA and western blotting tests, indicating a new potyvirus infection. Virus cultures were isolated from infected garland chrysanthemum and lettuce separately via mechanical inoculations in Chenopodium quinoa. Each isolate was mechanically inoculated to their original host individually and all caused symptoms similar to that observed in the field, indicating their pathogenicity to their original host. A cDNA fragment consisting of partial nuclear inclusion (NIb) and coat protein (CP) genes were amplified with potyvirus degenerate primers (forward: 5′-GGBAAYAATAGTGGNCAACC and reverse: 5′-GGGGAGGTGCCGTTCTCDATRCACCA) and was found to share 90% nucleotide sequence identity to that of Bidens mottle virus (BiMoV; GenBank Accession No. AF538686). The sequences of the CP gene and 3′ untranslated region (3′-UTR) of tested viruses were further amplified with a specific primer of BiMoV CP and oligo-dT in reverse transcription-PCR. The amplified fragments were cloned, sequenced, and the combined cDNA sequences were deposited in GenBank (Accession No. AB491763 for isolate garland chrysanthemum and Accession No. AB491764 for isolate lettuce). Sequence analysis showed that both cloned sequences shared more than 97% nucleotide similarity to that of BiMoV. The amino acid sequence of the CP of both isolates shared a 99.3% identity and a 98.9 to 99.3% identity to that of other BiMoV isolates deposited in GenBank. BiMoV was first described to be infecting lettuce and Cichorium endivia in the United States (4) and was first reported in sunflower and calendula in Taiwan recently (2,3). To our knowledge, this is the first report of the occurrence of BiMoV in garland chrysanthemum and lettuce in Taiwan. References: (1) Y. K. Chen et al. Plant Pathol. Bull. 5:55,1996. (2) C.-H. Huang and F.-J. Jan. Plant Dis. 95:362, 2011. (3) J. Y. Liao et al. Arch. Virol. 154:723, 2009. (4) F. Youssef et al. Arch. Virol 153:227, 2008.

scholarly journals First Report of Rose yellow vein virus in Rosa sp. in New Zealand

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1122-1122 ◽  
Author(s):  
Z. Perez-Egusquiza ◽  
L. W. Liefting ◽  
L. I. Ward
Keyword(s):  
New Zealand ◽  
Mosaic Virus ◽  
The United States ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Yellow Mosaic Virus ◽  
First Report ◽  
Chlorotic Mottle ◽  
Cherry Leaf Roll Virus ◽  
Two Samples

Rose is the top selling cut flower in New Zealand and is the most popular garden plant in the world. Several virus-like diseases have been described in roses, but the causal agents for many remain unknown. Most of the described viruses infecting rose belong to the genera Ilarvirus and Nepovirus. Only recently, a number of new viruses have been or are in the process of being characterized (1,2,3,4). In January 2011, 10 rose samples showing virus-like symptoms were collected from the Wanganui region on the North Island of New Zealand. Total nucleic acid was extracted from these samples using an InviMag Plant DNA Mini Kit (Invitek GmbH, Berlin, Germany) and a KingFisher mL workstation (Thermo Scientific, Waltham, MA). PCR and reverse transcription (RT)-PCR was conducted using specific primers for Arabis mosaic virus (ArMV), Cherry leaf roll virus, Prunus necrotic ringspot virus (PNRSV), Rosa rugosa leaf distortion virus, Rose spring dwarf associated virus, Rose yellow leaf virus, Rose yellow mosaic virus, Rose yellow vein virus (RYVV), and Strawberry latent ringspot virus. Samples were also tested using generic primers for carlavirus, potexvirus, potyvirus, tombusvirus, and phytoplasmas. Two samples (cvs. Pauls Himalayan Musk and Bloomfield) were positive for ArMV, four samples (cvs. Leda, Rosa Mundi, Charles de Mills, and Indica Major) were positive for PNRSV, and two samples (cvs. Leda and Zephirine Drouhin) were positive for RYVV. Samples were negative for all other tested viruses and phytoplasmas. RYVV was detected using two sets of primers (D. Mollov, personal communication) designed to amplify fragments of estimated sizes of 797 bp and 684 bp of the movement protein (MP) and coat protein (CP) genes of RYVV, respectively. RYVV amplicons were sequenced directly (GenBank Accession Nos. JX887423 to JX887426). A BLASTn search of the MP and CP fragments showed the highest nucleotide identity of 98% and 96 to 97%, respectively, with the type isolate of RYVV (JX028536). RYVV has been reported as the causal agent of a vein yellowing disease in rose (2). Symptoms observed in the ‘Leda’ sample infected with PNRSV and RYVV (vein yellowing and chlorotic mottle in the apex of leaves) were not typical of PNRSV, so they may be caused by RYVV. Symptoms in samples of cv. Zephirine Drouhin (curling of leaves and mottle), observed in both RYVV-positive and -negative samples, may not be associated with RYVV infection. This suggests that vein yellowing may be influenced by cultivar. RYVV has been reported in several rose cultivars, but only in the United States (2). To the best of our knowledge, this is the first report of RYVV infecting rose in New Zealand, where it is likely that the virus has been present for some time. The virus may have a much wider geographical distribution than that reported as the virus was only recently characterized (3). References: (1) B. Lockhart et al. Page 31 in: Program and Abstracts of The 12th International Symposium on Virus Diseases of Ornamental Plants, 2008. (2) D. Mollov et al. Phytopathology 99:S87, 2009. (3) D. Mollov et al. Arch Virol. 158:877, 2012. (4) N. Salem et al. Plant Dis. 92:508, 2008.

scholarly journals First Report of Pepino mosaic virus Infecting Tomato in Mexico

Plant Disease ◽  
2011 ◽  
Vol 95 (8) ◽  
pp. 1035-1035 ◽  
Author(s):  
K.-S. Ling ◽  
W. Zhang
Keyword(s):  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Nucleotide Sequence Identity ◽  
The United States ◽  
Rt Pcr ◽  
Pepino Mosaic Virus ◽  
First Report ◽  
Sequence Identity ◽  
Pcr Product ◽  
Greenhouse Tomatoes

Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5′CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5′TCTTTGTATATGGTCGCAGC) targeting the 5′ portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5′AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5′CAGAAATGTGTTCAGAGGGG) targeting the 3′ portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.

Sign in / Sign up

Export Citation Format

Share Document