First Report of Groundnut ringspot virus Infecting Tomato in South Florida

2010 ◽  
Vol 11 (1) ◽  
pp. 49 ◽  
Author(s):  
Craig G. Webster ◽  
Keith L. Perry ◽  
Xiaoyun Lu ◽  
Loren Horsman ◽  
Galen Frantz ◽  
...  
Keyword(s):  
United States ◽  
Disease Management ◽  
Management Strategies ◽  
The United States ◽  
South Florida ◽  
Ringspot Virus ◽  
Integrated Disease Management ◽  
First Report ◽  
Close Relationship ◽  
Relationship Of

To the best of our knowledge this is the first report of GRSV in the United States in any host, although TSWV has been present in Florida for many years. Although the detection of GRSV in Florida tomatoes is cause for concern, the close relationship of GRSV and TSWV may allow successful adaptation of the integrated disease management strategies currently in use for TSWV in tomatoes for management of GRSV. Accepted for publication 17 May 2010. Published 7 July 2010.

scholarly journals First Report of Tobacco ringspot virus in Blackberry (Rubus sp.) in Alabama

Plant Disease ◽  
2008 ◽  
Vol 92 (12) ◽  
pp. 1708-1708 ◽  
Author(s):  
E. Coneva ◽  
J. F. Murphy ◽  
R. Boozer ◽  
N. Velásquez
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Virus Infection ◽  
The United States ◽  
Negative Control ◽  
Ringspot Virus ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
Control Samples

In 2006, primocane stunted growth and crumbly berry development were observed on 4-year-old Kiowa and Apache blackberry cultivars grown at the Chilton Research and Extension Center, Clanton, AL. Samples from affected plants were tested for virus infection by ELISA kits (Agdia, Inc., Elkhart, IN) specific to each of 14 different viruses. Most samples tested positive for Tobacco ringspot virus (TRSV). TRSV was detected in blackberry samples from North Carolina and South Carolina (2). Bray et al. (1) studied the incidence of viruses in blackberry nursery stock in the United States and reported that 9% of the tested samples contained TRSV. Thus, a survey was conducted for TRSV incidence among commercial blackberry stands in eight counties in Alabama during July 2007. Blackberry plants were observed to express virus-like symptoms including chlorotic spots on leaves, leaf veinal chlorosis, stunting, and combinations thereof. Fruit-bearing plants sometimes had crumbly fruit symptoms characteristic of virus infection. Leaf samples that were collected from symptomatic and nonsymptomatic plants representing 14 cultivars were tested by TRSV ELISA (Agdia, Inc.). Of 180 blackberry samples, 68 tested positive for TRSV. Positive ELISA reactions for TRSV were on average 28 times greater than the reactions of known negative control samples considered negative for TRSV. Blackberry plants shown to be infected with TRSV during the 2007 survey were tested in July 2008 in an effort to confirm the presence of TRSV. Fifty-four percent of the samples tested positive by ELISA with the average positive ELISA value being 21 times higher than the average negative ELISA value for known negative control samples. To further confirm the occurrence of TRSV in Alabama-grown blackberry plants, leaf samples were tested by reverse transcription (RT)-PCR to amplify a 329-bp fragment of the viral coat protein gene (TRSV RNA 2 sequence accession no. NC_005096; primers TRSCP-F (5′-TCTGGCACTATAAGCGGAAG-3′) and TRSCP-R (5′-GAAAACATGGGAGGATGCAC-3′). A single band of the anticipated size was amplified (analyzed by agarose gel electorphoresis and visualized by ethidium bromide staining) from RNA samples extracted with a RNeasy Mini kit (Qiagen, Valencia, CA) from blackberry samples that tested positive for TRSV by ELISA and a known positive control. No amplified product resulted from a blackberry sample that tested negative for TRSV by ELISA. These results illustrate and confirm the presence of TRSV in blackberry leaf tissues grown in Alabama. To our knowledge, this is the first report of TRSV infection of blackberry plants in Alabama. References: (1) M. M. Bray et al. HortScience 40:874, 2005. (2) T. L. Guzmán-Baeny. Incidence, distribution, and symptom description of viruses in cultivated blackberry (Rubus subgenus Eubatus) in the southeastern United States. M.S. thesis, North Carolina State University, Raleigh, 2003.

scholarly journals First Report of Dieback Caused by Verticillium dahliae on Blighia sapida in the United States

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 74-74
Author(s):  
R. T. McMillan ◽  
W. R. Graves ◽  
T. F. Wood ◽  
R. M. Leahy
Keyword(s):  
United States ◽  
Verticillium Dahliae ◽  
Vascular Tissue ◽  
The United States ◽  
South Florida ◽  
First Report ◽  
Disturbed Soil ◽  
Florida Department ◽  
Consumer Services ◽  
Blighia Sapida

Mature akee trees, Blighia sapida K. Koenig, in a local south Florida commercial orchard had wilt and dieback symptoms during spring 1999. A fungus isolated from the gray xylem root tissue on V8 agar was identified as Verticillium dahliae Klebahn at the Division of Plant Industry of the Florida Department of Agriculture and Consumer Services. Twenty akee seedlings were transplanted into 3.85-liter plastic pots and grown in a greenhouse at a daytime temperature of 28°C and nighttime temperature of 23°C. When plants were approximately 25 cm high, a 15-cm knife was used to sever roots in the four quadrants of each pot. Inoculum was made from a 2-week-old culture of V. dahliae on V8 agar and blended with 160 ml of sterile water, and 15 ml of this slurry was poured into the disturbed soil of each of 10 treated plants. A plate of uninoculated V8 agar was applied, as above, to 10 control plants. Plants were kept in the greenhouse. After 6 weeks, inoculated plants showed symptoms of leaf wilt, dieback and plant death. No symptoms were seen on control plants. V. dahliae was isolated directly from the gray vascular tissue of inoculated plants. The inoculation experiment was repeated three times, fulfilling Koch's postulates. To our knowledge, this is the first report of Verticillium dieback on B. sapida in the United States.

scholarly journals First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 463-463 ◽  
Author(s):  
I. E. Tzanetakis ◽  
J. D. Postman ◽  
R. R. Martin
Keyword(s):  
United States ◽  
The United States ◽  
Ringspot Virus ◽  
Tobacco Streak Virus ◽  
Rapid Decline ◽  
Streak Virus ◽  
Black Raspberry ◽  
Rt Pcr ◽  
Indicator Plants ◽  
First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

scholarly journals First Report of Fusarium Wilt Caused by Fusarium oxysporum on Roselle in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 639-639 ◽  
Author(s):  
R. C. Ploetz ◽  
A. J. Palmateer ◽  
D. M. Geiser ◽  
J. H. Juba
Keyword(s):  
United States ◽  
Fusarium Oxysporum ◽  
Plant Pathogens ◽  
Vascular Tissue ◽  
The United States ◽  
South Florida ◽  
Maximum Parsimony Analysis ◽  
Culture Collections ◽  
Early Date ◽  
First Report

Roselle, Hibiscus sabdariffa var. sabdariffa, is an annual that is grown primarily for its inflated calyx, which is used for drinks and jellies. It is native from India to Malaysia, but was taken at an early date to Africa and is now widely grown in the tropics and subtropics (2). In late 2005, dying plants were noted by a producer in South Florida. Plants wilted, became chlorotic, and developed generally unthrifty, sparse canopies. Internally, conspicuous vascular discoloration was evident in these plants from the roots into the canopy. After 5 days on one-half-strength potato dextrose agar (PDA), salmon-colored fungal colonies grew almost exclusively from surface-disinfested 5 mm2 pieces of vascular tissue. On banana leaf agar, single-spored strains produced the following microscopic characters of Fusarium oxysporum: copious microconidia on monophialides, infrequent falcate macroconidia, and terminal and intercalary chlamydospores. Partial, elongation factor 1-α (EF1-α) sequences were generated for two of the strains, O-2424 and O-2425, and compared with previously reported sequences for the gene (3). Maximum parsimony analysis of sequences showed that both strains fell in a large, previously described clade of the F. oxysporum complex (FOC) that contained strains from agricultural hosts, as well as human clinical specimens (2; clade 3 in Fig. 4); many of the strains in this clade have identical EF1-α sequences. Strains of F. oxysporum recovered from wilted roselle in Egypt, O-647 and O-648 in the Fusarium Research Center collection, were distantly related to the Florida strains. We are not aware of other strains of F. oxysporum from roselle in other international culture collections. Roselle seedlings were inoculated with O-2424 and O-2425 by placing a mycelial plug (5 mm2, PDA) over a small incision 5 cm above the soil line and then covering the site with Parafilm. Parafilm was removed after 1 week, and plants were incubated under ambient temperatures (20 to 32°C) in full sun for an additional 5 weeks (experiment 1) or 7 weeks (experiment 2). Compared with mock-inoculated (wound + Parafilm) control plants, both O-2424 and O-2425 caused significant (P < 0.05) vascular disease (linear extension of discolored xylem above and below wound site) and wilting (subjective 1 to 5 scale); both isolates were recovered from affected plants. F. oxysporum-induced wilt of roselle has been reported in Nigeria (1) and Malaysia (4) where the subspecific epithet f. sp. rosellae was used for the pathogen. We are not aware of reports of this disease elsewhere. To our knowledge, this is the first report of F. oxysporum-induced wilt of roselle in the United States. Research to determine whether the closely related strains in clade 3 of the FOC are generalist plant pathogens (i.e., not formae speciales) is warranted. References: (1) N. A. Amusa et al. Plant Pathol. J. 4:122, 2005. (2) J. Morton. Pages 81–286 in: Fruits of Warm Climates. Creative Resource Systems, Inc., Winterville, NC, 1987. (3) K. O'Donnell et al. J. Clin. Microbiol. 42:5109, 2004. (4) K. H. Ooi and B. Salleh. Biotropia 12:31, 1999.

scholarly journals First Report of QOI-insensitive Powdery Mildew (Erysiphe polygoni) on Sugar Beet in the United States

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1004-1004 ◽  
Author(s):  
M. D. Bolton ◽  
O. T. Neher
Keyword(s):  
United States ◽  
Disease Management ◽  
Powdery Mildew ◽  
Sugar Beet ◽  
Untreated Control ◽  
The United States ◽  
Nucleotide Position ◽  
Cytb Gene ◽  
First Report ◽  
Erysiphe Polygoni

The $2.1 billion United States sugar beet (Beta vulgaris L.) industry is the primary provider of domestic sucrose. Sugar beet powdery mildew is caused by Erysiphe polygoni DC and occurs principally in sugar beet growing regions in the western United States. In these regions, the quinone outside inhibitor (QOI) fungicides pyraclostrobin (Headline, BASF, NC) and trifloxystrobin (Gem, Bayer Crop Science, NC) have been important tools to manage powdery mildew since registration in 2002 and 2005, respectively. However, researchers in Idaho reported poor disease management despite QOI application starting in 2011. In 2013, a research plot near Parma, ID, containing natural powdery mildew infection received treatments of pyraclostrobin, trifloxystrobin, or was untreated (control). Since there was no significant reduction in disease levels between QOI-treated blocks and untreated control blocks, experiments were conducted to clone a partial fragment of the E. polygoni cytochrome b (cytb) gene to gain insight into the molecular basis of QOI resistance in this pathosystem. The primers MDB-920 (5′-CACATCGGAAGAGGTTTATA-3′) and MDB-922 (5′-GGTATAGATCTTAATATAGCATAG-3′) were designed based on consensus sequences of several fungal cytb genes obtained from GenBank (data not presented) and used to amplify a 575-bp fragment of the E. polygoni cytb gene using DNA isolated from 12 infected leaf samples collected in September 2013 from the Parma research plot. Each sample consisted of three leaves harvested from three plants (one leaf per plant) in an experimental block. All DNA extraction, PCR, and sequencing procedures were as described previously (1). PCR products derived from six QOI-treated samples and six untreated samples were sequenced directly. Without exception, all QOI-treated samples harbored a point mutation at nucleotide position 143 that encoded a G143A mutation compared with cytb sequence from untreated samples. The two identified cytb haplotypes have been deposited in GenBank under accession numbers KF925325 and KF925326. This is the first report of QOI resistance and the associated cytb G143A mutation in E. polygoni. The G143A mutation has been reported in most QOI-resistant pathogens to date (2). When the G143A mutation dominates in a pathogen population, there is a consistent association with a loss of disease management despite QOI application (3). Careful monitoring and judicious use of QOI fungicides will be necessary to ensure QOI fungicides remain efficacious for sugar beet powdery mildew management in the United States. References: (1) M. D. Bolton et al. Pest Manag. Sci. 69:35, 2013. (2) N. Fisher and B. Meunier. FEMS Yeast Res. 8:183, 2008. (3) U. Gisi et al. Pest Manag. Sci. 58:859, 2002.

NEW SPECIES OF PARASYNTORMON FROM THE UNITED STATES (DIPTERA, DOLICHOPODIDAE)

1943 ◽  
Vol 75 (4) ◽  
pp. 63-65 ◽  
Author(s):  
F. C. Harmston ◽  
G. F. Knowlton
Keyword(s):  
United States ◽  
New Species ◽  
The United States ◽  
Close Relationship ◽  
Relationship Of

The four species of flies here described as new belong in the genus Parasyntormon as established by Wheeler in 1899. Curran and Becker, among the more recent writers, have pointed out the very close relationship of Parasyntormon to Syntromon Loew, the latter writer having united the two genera under the name Syntormon.

scholarly journals First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 907-907 ◽  
Author(s):  
J. D. Postman ◽  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
North America ◽  
Consensus Sequence ◽  
The United States ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Cdna Clones ◽  
Meristem Culture ◽  
Rt Pcr ◽  
First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

scholarly journals Emergence of Groundnut ringspot virus and Tomato chlorotic spot virus in Vegetables in Florida and the Southeastern United States

2015 ◽  
Vol 105 (3) ◽  
pp. 388-398 ◽  
Author(s):  
Craig G. Webster ◽  
Galen Frantz ◽  
Stuart R. Reitz ◽  
Joseph E. Funderburk ◽  
H. Charles Mellinger ◽  
...  
Keyword(s):  
United States ◽  
New York ◽  
South Carolina ◽  
Southeastern United States ◽  
The United States ◽  
South Florida ◽  
Ringspot Virus ◽  
Spot Virus ◽  
Genomic Rnas ◽  
Chlorotic Spot

Groundnut ringspot virus (GRSV) and Tomato chlorotic spot virus (TCSV) are two emerging tospoviruses in Florida. In a survey of the southeastern United States, GRSV and TCSV were frequently detected in solanaceous crops and weeds with tospovirus-like symptoms in south Florida, and occurred sympatrically with Tomato spotted wilt virus (TSWV) in tomato and pepper in south Florida. TSWV was the only tospovirus detected in other survey locations, with the exceptions of GRSV from tomato (Solanum lycopersicum) in South Carolina and New York, both of which are first reports. Impatiens (Impatiens walleriana) and lettuce (Lactuca sativa) were the only non-solanaceous GRSV and/or TCSV hosts identified in experimental host range studies. Little genetic diversity was observed in GRSV and TCSV sequences, likely due to the recent introductions of both viruses. All GRSV isolates characterized were reassortants with the TCSV M RNA. In laboratory transmission studies, Frankliniella schultzei was a more efficient vector of GRSV than F. occidentalis. TCSV was acquired more efficiently than GRSV by F. occidentalis but upon acquisition, transmission frequencies were similar. Further spread of GRSV and TCSV in the United States is possible and detection of mixed infections highlights the opportunity for additional reassortment of tospovirus genomic RNAs.

Groundnut Ringspot Virus in Florida

EDIS ◽  
2011 ◽  
Vol 2011 (8) ◽  
Author(s):  
Eugene McAvoy ◽  
Scott Adkins ◽  
Craig Webster ◽  
Charles Mellinger ◽  
Loren Horsman ◽  
...  
Keyword(s):  
United States ◽  
Plant Pathology ◽  
Host Range ◽  
Disease Transmission ◽  
The United States ◽  
South Florida ◽  
Ringspot Virus ◽  
Tomato Plants ◽  
Fact Sheet ◽  
Stages Of Growth

Groundnut ringspot virus was recently identified in tomatoes in South Florida — the first report in the United States. It can infect tomato plants at all stages of growth and lead to unmarketable fruits or plant death. This 4-page fact sheet shares what is known about the symptoms, host range, disease transmission, and management. Written by Eugene McAvoy, Scott Adkins, Craig Webster, Charles Mellinger, Loren Horsman, Galen Frantz, Stuart Reitz, and Shouan Zhang, and published by the UF Department of Plant Pathology, July 2011.

Sign in / Sign up

Export Citation Format

Share Document