Confirmation of First Report of Orchid fleck virus in Phalaenopsis Hybrid Orchids in the USA

2015 ◽  
Vol 16 (4) ◽  
pp. 146-148 ◽  
Author(s):  
S. A. Bratsch ◽  
B. E. Lockhart ◽  
C. Ishimaru
Keyword(s):  
United States ◽  
The United States ◽  
Detection Methods ◽  
Rt Pcr ◽  
False Negatives ◽  
Orchid Fleck Virus ◽  
First Report ◽  
The Usa ◽  
One Step

The results also suggest one-step RT-PCR from Phalaenopsis plants and Orchid fleck virus (OFV) isolates can give false negatives for asymptomatic plants. Further work on detection methods for OFV is under way. This is the first confirmation of OFV infecting orchids in the United States. Accepted for publication 24 September 2015. Published 30 September 2015.

scholarly journals First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Gardenia Orellana ◽  
Alexander V Karasev
Keyword(s):  
United States ◽  
Leaf Tissue ◽  
The United States ◽  
Universal Primers ◽  
Rt Pcr ◽  
Universal Primer ◽  
Tissue Samples ◽  
First Report ◽  
Specific Pcr ◽  
Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

scholarly journals Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 292-297 ◽  
Author(s):  
Mohamad Chikh-Ali ◽  
Hayam Alruwaili ◽  
Dalton Vander Pol ◽  
Alexander V. Karasev
Keyword(s):  
United States ◽  
Saudi Arabia ◽  
Seed Potato ◽  
Potato Virus ◽  
Potato Virus Y ◽  
The United States ◽  
Tuber Quality ◽  
Rt Pcr ◽  
First Report ◽  
Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

scholarly journals First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 463-463 ◽  
Author(s):  
I. E. Tzanetakis ◽  
J. D. Postman ◽  
R. R. Martin
Keyword(s):  
United States ◽  
The United States ◽  
Ringspot Virus ◽  
Tobacco Streak Virus ◽  
Rapid Decline ◽  
Streak Virus ◽  
Black Raspberry ◽  
Rt Pcr ◽  
Indicator Plants ◽  
First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

scholarly journals First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 113-113 ◽  
Author(s):  
H. F. Schwartz ◽  
K. Otto ◽  
H. R. Pappu
Keyword(s):  
United States ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Allium Porrum ◽  
Rt Pcr ◽  
Spot Virus ◽  
Disease Symptoms ◽  
First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

scholarly journals First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 633-633 ◽  
Author(s):  
H.-Y. Liu ◽  
J. L. Sears
Keyword(s):  
United States ◽  
The United States ◽  
Rt Pcr ◽  
Spot Virus ◽  
Chenopodium Amaranticolor ◽  
Tomato Plants ◽  
First Report ◽  
Chenopodium Murale ◽  
Tomato Field ◽  
Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

scholarly journals First Report of Barley virus G in the United States and California

Plant Disease ◽  
2021 ◽  
Author(s):  
Anna Christine Erickson ◽  
Bryce Falk
Keyword(s):  
United States ◽  
Viral Genome ◽  
The United States ◽  
Full Length ◽  
Yellow Dwarf ◽  
Rt Pcr ◽  
First Report ◽  
Query Coverage ◽  
Full Length Sequence ◽  
The U.S

Barley (Hordeum vulgare) is a valuable annual cereal crop grown widely throughout the United States and the world. The majority of barley grown commercially in California and throughout the U.S. is used for livestock feed, with the remainder being used by the malting industry and, to a lesser extent, direct food consumption; it is also often employed as a cover crop (Lazicki et al. 2016). Yellow dwarf viruses (YDVs), in the family Luteoviridae, that infect barley and other cereal crops are common and widely distributed throughout California and the U.S. (Griesbach et al. 1989; Seabloom et al. 2009). In April 2018, five barley samples exhibiting typical symptoms of YDV infection (primarily yellowing of leaf margins and tips) collected from fields in Yolo county planted with cultivar Butta 12 , were tested for viruses. Total RNA was extracted from leaf tissue using Trizol reagent, according to the manufacturer’s protocol. RNA was used as template in a multiplexed RT-PCR assay designed for the generic detection of barley and cereal infecting YDVs, using the protocol established by Malmstrom and Shu (2004). A 372 basepair amplicon indicative of Polerovirus infection was amplified from two of the samples and sequenced (Quintara Biosciences), and the resulting data analyzed via a BLASTn search. No further testing or work was done with the three samples that tested negative. Not unexpectedly, the top result returned for one of the positive samples was Cereal yellow dwarf virus-RPV (CYDV-RPV; 98% identity), a virus common to cereals in California and the U.S.. Unexpectedly, however, the top result returned for the other sample was Barley virus G (BVG), sharing 98.43% identity with the Uiseong BVG isolate (GenBank accession LC259081). To further confirm the presence of BVG in the sample, the full-length viral genome was amplified using two-step RT-PCR with primers targeting the extreme 5’ and 3’ ends of the viral genome, using the PrimeScript RT and PrimeSTAR GXL DNA Polymerase kits (Takara Bio), cloned into the binary vector pJL89 and a BLAST search of the resulting 5621 nucleotide full-length sequence (100% query coverage) once again returned results showing the YDV to be BVG. The full-length sequence was deposited into GenBank (MW853785). Nucleotide sequence comparisons showed that the CA BVG isolate shares 96.62%, 96.57%, and 96.02% identity with the sequences of the BVG-Gimje (KT962089), BVG-Uiseong (LC259081), and BVG-Aus8 (LC500836) isolates, respectively. To our knowledge, this is the first report of barley virus G in California and in the United states. Currently the prevalence, host range and mode and timing of introduction of BVG in California and the U.S. are unknown; its impact on cereal production and yield in any location in which it has been identified thus far is also unknown and may warrant further investigation.

scholarly journals First Report of Cucumber green mottle mosaic virus on Melon in the United States

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1163-1163 ◽  
Author(s):  
T. Tian ◽  
K. Posis ◽  
C. J. Maroon-Lango ◽  
V. Mavrodieva ◽  
S. Haymes ◽  
...  
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
Seed Production ◽  
Citrullus Lanatus ◽  
The United States ◽  
Rt Pcr ◽  
First Report ◽  
Rigid Rod ◽  
Yolo County ◽  
Das Elisa

In July 2013, a melon (Cucumis melo var. Saski) field in Yolo County, California, was inspected as part of a phytosanitary inspection for seed production. The leaves of the plants showed mosaic, green mottle, and blotches. When plant sap was examined using a transmission electron microscope, rigid rod-shaped particles were observed. Melon plant samples were analyzed by both CDFA and USDA APHIS PPQ laboratories and tested positive using DAS-ELISA against Cucumber green mottle mosaic virus (CGMMV) (Agdia, Elkhart, IN). To confirm the presence of CGMMV, total RNA was analyzed by RT-PCR using primers CGMMV-F5370 5′-CTAATTATTCTGTCGTGGCTGCGGATGC-3′ and CGMMV-R6390 5′-CTTGCAGAATTACTGCCCATA-3′ designed by PPQ based on 21 genomic sequences of CGMMV found worldwide. The 976-bp amplicon was sequenced (GenBank Accession No. KJ453559) and BLAST analysis showed the sequence was 95% identical to MP and CP region of CGMMV isolates reported from Russia (GQ495274, FJ848666), Spain (GQ411361), and Israel (KF155231), and 92% to the isolates from China (KC852074), Korea (AF417243), India (DQ767631), and Japan (D12505). These analyses confirm the virus was CGMMV. To our knowledge, this is the first report of CGMMV in the United States. Based on our sequence data, a second set of primers (CGMMV-F5796 5′-TTGCGTTTAGTGCTTCTTATGT-3′ and CGMMV-R6237 5′-GAGGTGGTAGCCTCTGACCAGA-3′), which amplified a 440-bp amplicon from CGMMV CP region, was designed and used for testing all the subsequent field and seed samples. Thirty-seven out of 40 randomly collected Saski melon samples tested positive for CGMMV, suggesting the virus was widespread in the field. All the melon samples also tested positive for Squash mosaic virus (SqMV) using DAS-ELISA (Agdia). Therefore, the symptoms observed likely resulted from a mixed infection. The melon field affected by CGMMV was immediately adjacent to fields of cucumber (Cucumis sativus var. Marketmore 76) and watermelon (Citrullus lanatus var. Sugar Baby) crops, both for seed production with no barrier between the crops. CGMMV was also detected from symptomatic plants from both fields. Seed lots used for planting all three crops were tested and only the melon seed was positive for CGMMV, suggesting the seed as the source of infection. The sequenced 440-bp RT-PCR amplicons from CGMMV-infected cucumber and watermelon plants and melon seeds were 99% identical to the CGMMV from the field melon. A cucumber plant infected with CGMMV but not SqMV was used for mechanical inoculation at the Contained Research Facility at University of California, Davis. Inoculated cucumber, melon, and watermelon plants showed green mottle and mosaic similar to that observed in the field. CGMMV is a highly contagious virus and damage by this virus on cucurbit crops has been reported in regions where CGMMV is present (2). CGMMV was detected on cucumber grown in greenhouses in Canada with 10 to 15% yield losses reported due to this virus (1). The three cucurbit crops in Yolo County were planted in an isolated area with no other cucurbits nearby. Measures, including destroying all the cucurbit plant material, have been taken to eradicate the virus. Use of CGMMV free cucurbit seed is necessary for prevention of this disease. References: (1) K.-S. Ling et al. Plant Dis. 98:701, 2014. (2) J. Y. Yoon et al. J. Phytopathol. 156:408, 2008.

scholarly journals First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1664-1664 ◽  
Author(s):  
B. Babu ◽  
H. Dankers ◽  
S. George ◽  
D. Wright ◽  
J. Marois ◽  
...  
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
The United States ◽  
Turnip Mosaic Virus ◽  
Brassica Carinata ◽  
Rt Pcr ◽  
First Report ◽  
Ethiopian Mustard ◽  
Plant Pathol ◽  
Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

scholarly journals First Report of Grapevine leafroll-associated virus 5 in Spain

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1507-1507 ◽  
Author(s):  
C. V. Padilla ◽  
E. Cretazzo ◽  
I. Hita ◽  
N. López ◽  
V. Padilla ◽  
...  
Keyword(s):  
United States ◽  
Amino Acid ◽  
The United States ◽  
Amino Acid Identity ◽  
Wine Industry ◽  
Rt Pcr ◽  
Acid Identity ◽  
First Report ◽  
Virus Indexing ◽  
Homologous Genes

Grapevine leafroll-associated viruses (GLRaVs) cause significant reductions in yield and quality in the wine industry worldwide. At least nine different GLRaVs have been found in different regions of the world. In the process of virus indexing of candidate grapevine clones for certification, which includes grafting of scions onto rootstocks, we observed strong leafroll symptoms 1 year after grafting with one vine of cv. Estaladina in Castilla y León, Spain and one vine of cv. Tempranillo in La Rioja, Spain, collected in 2008 and 2007, respectively. Both vines tested positive by real-time reverse transcription (RT)-PCR with TaqMan probes specific for Grapevine leafroll-associated virus 5 and double-antibody sandwich (DAS)-ELISA with a mix of monoclonal antibodies that recognizes GLRaV-4, 5, 6, 7, and 9 (Bioreba, Reinach, Switzerland). RNA extracts of both GLRaV-5 positive vines were analyzed by conventional RT-PCR with a pair of consensus degenerated primers derived from GLRaV-5 hsp70 sequences available in GenBank: LR5HYF (5′-TGGGATGAAYAARTTCAATGC-3′) and LR5HYR (5′-TGAAATTCCTCATRTARGAGC-3′) that amplified a 250-bp fragment. Amplicons were cloned and the comparison of the amino acid sequences (Estaladina isolate, Est110: Accession No. HM208622; Tempranillo isolate, Tem020: Accession No. HM208618) showed in the case of the Est110 isolate, 100 and 82.6% identity, respectively, with the homologous genes of one GLRaV-5 isolate from the United States (AF233934 [3]) and Argentina (EU815935 [2]). For isolate Tem020, the hsp70 gene showed 97.1 and 81.2% amino acid identity with the homologous hsp70 genes of the United States and Argentina isolates. The coat protein (cp) genes of both isolates were also amplified and cloned using the specific GLRaV-5 primers, LR53413 (5′-CGTGATACAAGGTAGGACAACCGT-3′) and LR53843 (5′-CTTGCACTATCGCTGCCGTGAAT-3′), designed according to the sequence of AF233934. Fragments were of the expected size (430 bp) and the nucleotide sequences were obtained (Est110: Accession No. HM363522; Tem020: Accession No. HM363523) and used for pairwise nucleotide comparisons. The Est110 isolate showed 96.7 and 97.5% amino acid identity with the isolates from the United States and Argentina, respectively, while the Tem020 isolate showed 94.8 and 95.6% identity, respectively. Amino acid identity of Est110 and Tem020 cp genes was 100% when compared with the homologous genes of isolates AF233934 and EU815935. To our knowledge this is the first report of GRLaV-5 in Spain. Since 2008, we have detected eight additional vines positive for this virus in 200 clones analyzed for certification, suggesting that the incidence of GLRaV-5 in Spain could be widespread. This research indicates that virus indexing for GLRaV should be included in certification schemes for grapevine candidate clones (1) in Spain. References: (1) Anonymous. OEPP/EPPO Bull. 38:422, 2008. (2) S. Gomez Talquenca et al. Virus Genes 38:184, 2009. (3) F. Osman et al. J. Virol. Methods 141:22, 2007.

scholarly journals First Report of Beet pseudo yellows virus in Blackberry in the United States

Plant Disease ◽  
2004 ◽  
Vol 88 (2) ◽  
pp. 223-223 ◽  
Author(s):  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
South Carolina ◽  
The United States ◽  
Cdna Clones ◽  
Broad Host Range ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Beet Pseudo Yellows Virus ◽  
Symptomatic Plant

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAGATGTCCRCTAATGATA 3′) that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. References: (1) I. E. Tzanetakis et al. (Abstr.) Phytopathology 93:S85, 2003. (2) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (3) W. M. Wintermantel. Plant Dis. 88:82, 2004.

Sign in / Sign up

Export Citation Format

Share Document