Homeostatic responses regulate selfish mitochondrial genome dynamics in C. elegans

SummarySelfish genetic elements have profound biological and evolutionary consequences. Mutant mitochondrial genomes (mtDNA) can be viewed as selfish genetic elements that persist in a state of heteroplasmy despite having potentially deleterious consequences to the organism. We sought to investigate mechanisms that allow selfish mtDNA to achieve and sustain high levels. Here, we establish a large 3.1kb deletion bearing mtDNA variant uaDf5 as a bona fide selfish genome in the nematode Caenorhabditis elegans. Next, using droplet digital PCR to quantify mtDNA copy number, we show that uaDf5 mutant mtDNA replicates in addition to, not at the expense of, wildtype mtDNA. These data suggest existence of homeostatic copy number control for wildtype mtDNA that is exploited by uaDf5 to ‘hitchhike’ to high frequency. We also observe activation of the mitochondrial unfolded protein response (UPRmt) in animals with uaDf5. Loss of UPRmt results in a decrease in uaDf5 frequency whereas constitutive activation of UPRmt increases uaDf5 levels. These data suggest that UPRmt allows uaDf5 levels to increase. Interestingly, the decreased uaDf5 levels in absence of UPRmt recover in parkin mutants lacking mitophagy, suggesting that UPRmt protects uaDf5 from mitophagy. We propose that cells activate two homeostatic responses, mtDNA copy number control and UPRmt, in uaDf5 heteroplasmic animals. Inadvertently, these homeostatic responses allow uaDf5 levels to be higher than they would be otherwise. In conclusion, our data suggest that homeostatic stress response mechanisms play an important role in regulating selfish mitochondrial genome dynamics.

Download Full-text

Variability in mitochondrial import, mitochondrial health and mtDNA copy number using Type II and Type V CRISPR effectors

10.1101/2020.03.10.985606 ◽

2020 ◽

Author(s):

Zuriñe Antón ◽

Grace Mullally ◽

Holly Ford ◽

Marc W. van der Kamp ◽

Mark D. Szczelkun ◽

...

Keyword(s):

Mitochondrial Genome ◽

Copy Number ◽

Protein Targeting ◽

Mitochondrial Dynamics ◽

Mitochondrial Protein ◽

Mitochondrial Diseases ◽

Basic Research ◽

Strategy Development ◽

Mtdna Copy Number ◽

Mitochondrial Import

ABSTRACTCurrent methodologies for targeting the mitochondrial genome for basic research and/or therapeutic strategy development in mitochondrial diseases are restricted by practical limitations and technical inflexibility. The development of a functional molecular toolbox for CRISPR-mediated mitochondrial genome editing is therefore desirable, as this could enable precise targeting of mtDNA haplotypes using the precision and tuneability of CRISPR enzymes; however, published reports of “MitoCRISPR” systems have, to date, lacked reproducibility and independent corroboration. Here, we have explored the requirements for a functional MitoCRISPR system in human cells by engineering several versions of CRISPR nucleases, including the use of alternative mitochondrial protein targeting sequences and smaller paralogues, and the application of gRNA modifications that reportedly induce mitochondrial import. We demonstrate varied mitochondrial targeting efficiencies and influences on mitochondrial dynamics/function of different CRISPR nucleases, with Lachnospiraceae bacterium ND2006 (Lb) Cas12a being better targeted and tolerated than Cas9 variants. We also provide evidence of Cas9 gRNA association with mitochondria in HeLa cells and isolated yeast mitochondria, even in the absence of a targeting RNA aptamer. Finally, we present evidence linking mitochondrial-targeted LbCas12a/crRNA with increased mtDNA copy number dependent upon DNA binding and cleavage activity. We discuss reproducibility issues and the future steps necessary if MitoCRISPR is to be realised.

Download Full-text

Mitochondrial import, health and mtDNA copy number variability seen when using type II and type V CRISPR effectors

Journal of Cell Science ◽

10.1242/jcs.248468 ◽

2020 ◽

Vol 133 (18) ◽

pp. jcs248468 ◽

Cited By ~ 2

Author(s):

Zuriñe Antón ◽

Grace Mullally ◽

Holly C. Ford ◽

Marc W. van der Kamp ◽

Mark D. Szczelkun ◽

...

Keyword(s):

Mitochondrial Genome ◽

Copy Number ◽

Protein Targeting ◽

Mitochondrial Dynamics ◽

Mitochondrial Protein ◽

Mitochondrial Diseases ◽

Mtdna Copy Number ◽

Data Link ◽

Mitochondrial Import ◽

Type V

ABSTRACTCurrent methodologies for targeting the mitochondrial genome for research and/or therapy development in mitochondrial diseases are restricted by practical limitations and technical inflexibility. A molecular toolbox for CRISPR-mediated mitochondrial genome editing is desirable, as this could enable targeting of mtDNA haplotypes using the precision and tuneability of CRISPR enzymes. Such ‘MitoCRISPR’ systems described to date lack reproducibility and independent corroboration. We have explored the requirements for MitoCRISPR in human cells by CRISPR nuclease engineering, including the use of alternative mitochondrial protein targeting sequences and smaller paralogues, and the application of guide (g)RNA modifications for mitochondrial import. We demonstrate varied mitochondrial targeting efficiencies and effects on mitochondrial dynamics/function of different CRISPR nucleases, with Lachnospiraceae bacterium ND2006 (Lb) Cas12a being better targeted and tolerated than Cas9 variants. We also provide evidence of Cas9 gRNA association with mitochondria in HeLa cells and isolated yeast mitochondria, even in the absence of a targeting RNA aptamer. Our data link mitochondrial-targeted LbCas12a/crRNA with increased mtDNA copy number dependent upon DNA binding and cleavage activity. We discuss reproducibility issues and the future steps necessary for MitoCRISPR.

Download Full-text

Mitochondrial Genome Instability in AML Is Associated with Reduction in the Mitochondrial Replication.

Blood ◽

10.1182/blood.v106.11.2754.2754 ◽

2005 ◽

Vol 106 (11) ◽

pp. 2754-2754

Author(s):

Myung-Geun Shin ◽

Hyeoung-Joon Kim ◽

Hye-Ran Kim ◽

Il-Kwon Lee ◽

Duck Cho ◽

...

Keyword(s):

Mitochondrial Genome ◽

Control Region ◽

Buccal Mucosa ◽

Copy Number ◽

Genome Instability ◽

Point Mutations ◽

Mtdna Copy Number ◽

Control Subjects ◽

Length Changes ◽

Mtdna Variants

Abstract Genetic changes in mitochondrial DNA (mtDNA) have been hypothesized more widely to play important roles in senescence, autoimmune disease and malignancy because of a paucity of introns and limited repair mechanisms. Malfunction of mismatch repair genes produces genome instability which plays an important role in the development of human cancers. The mtDNA markers for mitochondrial genome instability (mtGI) were point mutations, insertions, deletions and length changes in homopolymeric nucleotide tracts. We investigated the mtGI in AML cells and its effect to alteration in mtDNA copy number. Forty-eight matched AML bone marrow and buccal mucosa samples, and blood samples from 57 control subjects were collected after receiving Institutional Review Board approval and informed consent. We directly sequenced the control region, the tRNA leucine 1 gene plus a part of NADH dehydrogenase (ND)1 and cytochrome b (CYTB) of mtDNA. In an attempt to investigate mtGI, we carried out a qualitative and quantitative profiling mtDNA length heteroplasmies of six mtGIs (np 303–315 poly C, np 16184–16193 poly C, np 514–511 CA repeats, np 3566–3572 poly C, np 12385–12391 poly C and np 12418–12426 poly A) using a size-based PCR product separation by capillary electrophoresis (ABI Prism Genotyper version 3.1). Length heteroplasmy was further confirmed by cloning and sequencing. Quantitative analysis of mtDNA molecules was performed using the QuantiTect SYBR Green PCR kit (Qiagen). In the current study, we detected a large number of polymorphisms as well as new mtDNA variants. A total of 606 mtDNA sequence variants were identified. Among these, 15 mtDNA variants were identified as novel mutations that were absent from corresponding buccal mucosa, control subjects and established mtDNA polymorphism databases. In the control region, we found two types of mtDNA alterations - base substitutions and small deletions/insertions as well as the length heteroplasmies in the np 303 to 315 poly-C, np 16184 to 16193 poly-C and 514–515 CA repeats. Seven patients (15%) had leukemia cell-specific mtDNA substitution mutations in the ND1 and CYTB genes. Somatic mtDNA control region mutations found in this study preferentially altered known mtDNA regulatory elements. AML cells had about a two-fold decrease in mtDNA copy number compared with the results from control subjects (63 x 106 molecules/ul ± 23 x 106 vs 122 x 106 molecules/ul ± 73 x 106). Our results are consistent with a recent observation that carcinogenesis in the liver, kidney and lung involves a decrease of the cellular mitochondrial content and decreased mtDNA copy number (Mutat Res2004;547:71–78). In conclusion, mtGI including point mutations, length changes (insertions or deletions) in homopolymeric tracts commonly occurred in AML cells and reduction in mtDNA copy number may result from either mtDNA control region mutations or impairment of mitochondrial biogenesis. These findings suggest that biogenesis of mitochondria is repressed in the leukemogenesis process of the human hematopoietic tissue.

Download Full-text

Homeostatic Responses Regulate Selfish Mitochondrial Genome Dynamics in C. elegans

Cell Metabolism ◽

10.1016/j.cmet.2016.06.008 ◽

2016 ◽

Vol 24 (1) ◽

pp. 91-103 ◽

Cited By ~ 57

Author(s):

Bryan L. Gitschlag ◽

Cait S. Kirby ◽

David C. Samuels ◽

Rama D. Gangula ◽

Simon A. Mallal ◽

...

Keyword(s):

Mitochondrial Genome ◽

C Elegans ◽

Genome Dynamics

Download Full-text

Functional Conservation of Mitochondrial RNA Levels Despite Divergent mtDNA Organization

10.21203/rs.3.rs-32589/v1 ◽

2020 ◽

Author(s):

James P Held ◽

Maulik R Patel

Keyword(s):

Mitochondrial Genome ◽

Digital Pcr ◽

Rrna Genes ◽

Mitochondrial Rna ◽

Protein Coding ◽

Promoter Sequences ◽

C Elegans ◽

Functional Conservation ◽

Mitochondrial Rrna ◽

Mrna Ratio

Abstract Objective: Mitochondria-encoded ribosomal RNA (rRNA) genes in humans are expressed at a higher rate than protein coding genes of the mitochondria. The organization of the human mitochondrial genome (mtDNA) is amenable to differential expression of rRNAs as it contains a promoter specific to the transcription of the two rRNAs. However, mtDNA is not organized in the same way as humans in all metazoans. In the nematode, Caenorhabditis elegans, the rRNA genes are on opposite sides of the mtDNA molecule and there are no obvious promoter sequences specific to the rRNA genes. Thus, we asked whether rRNA levels are higher relative to mRNAs in mitochondria of C. elegans as they are in humans.Results: Using droplet digital PCR, we discovered that steady-state mitochondrial rRNA transcript levels are approximately 120 times higher than the levels of mitochondrial mRNAs. These data demonstrate that despite the lack of conservation in mitochondrial genome organization, a high mitochondrial rRNA-to-mRNA ratio is a conserved feature of metazoans.

Download Full-text

Role of the mitochondrial genome in preimplantation development and assisted reproductive technologies

Reproduction Fertility and Development ◽

10.1071/rd04084 ◽

2005 ◽

Vol 17 (2) ◽

pp. 15 ◽

Cited By ~ 48

Author(s):

Lawrence C. Smith ◽

Jacob Thundathil ◽

France Filion

Keyword(s):

Mitochondrial Genome ◽

Copy Number ◽

Cell Function ◽

Assisted Reproductive Technologies ◽

Reproductive Technologies ◽

Domestic Animals ◽

Preimplantation Development ◽

Mtdna Copy Number ◽

Transcription And Replication

Our fascination for mitochondria relates to their origin as symbiotic, semi-independent organisms on which we, as eukaryotic beings, rely nearly exclusively to produce energy for every cell function. Therefore, it is not surprising that these organelles play an essential role in many events during early development and in artificial reproductive technologies (ARTs) applied to humans and domestic animals. However, much needs to be learned about the interactions between the nucleus and the mitochondrial genome (mtDNA), particularly with respect to the control of transcription, replication and segregation during preimplantation. Nuclear-encoded factors that control transcription and replication are expressed during preimplantation development in mice and are followed by mtDNA transcription, but these result in no change in mtDNA copy number. However, in cattle, mtDNA copy number increases during blastocyst expansion and hatching. Nuclear genes influence the mtDNA segregation patterns in heteroplasmic animals. Because many ARTs markedly modify the mtDNA content in embryos, it is essential that their application is preceded by careful experimental scrutiny, using suitable animal models.

Download Full-text

Metformin Preserves Mitochondrial Integrity at Old Age in Male Rats

Innovation in Aging ◽

10.1093/geroni/igab046.2571 ◽

2021 ◽

Vol 5 (Supplement_1) ◽

pp. 690-690

Author(s):

Jonathan Wanagat ◽

Allen Herbst ◽

Austin Hoang ◽

Chiye Kim ◽

Judd Aiken ◽

...

Keyword(s):

Skeletal Muscle ◽

Copy Number ◽

Male Rats ◽

Metformin Treatment ◽

Mtdna Copy Number ◽

C Elegans ◽

Mitochondrial Integrity ◽

Mitochondrial Dna Copy Number ◽

And Function ◽

Deletion Frequency

Abstract Metformin is being deployed in clinical trials to ameliorate aging in older humans who do not have diabetes. In C. elegans, metformin treatment at old ages exacerbated mitochondrial dysfunction, led to respiratory failure, and shortened lifespan. Metformin is a commonly used, well-tolerated treatment for diabetes in older adults. Mitochondrial effects of metformin treatment in aged mammals has not been sufficiently investigated. We hypothesized that metformin treatment would not be toxic to older mammals. To define a therapeutic dose in aged hybrid rats, we evaluated two doses of metformin (0.1%, 0.75% of the diet) at 30-months of age. Body mass decreased at the 0.75% dose. Neither dose affected mortality between 30- and 34-months of age. We assessed mitochondrial quality, quantity, and function in aged rats treated with metformin at the 0.75% dose by measuring mitochondrial DNA copy number, deletion mutation frequency, and respirometry in skeletal muscle and heart. In skeletal muscle, we observed no effect of metformin on quadriceps mass, mtDNA copy number or deletion frequency. In the heart, metformin treated rats had higher mtDNA copy number, lower cardiac mass and no effect on deletion frequency. Metformin treatment resulted in lower mitochondrial complex I activity in both heart and quadriceps. Metformin did not compromise mitochondrial integrity, was well tolerated, and may have cardiac benefits to rats at old ages.

Download Full-text

Quantitative mitochondrial DNA copy number determination using droplet digital PCR with single cell resolution: a focus on aging and cancer

10.1101/579789 ◽

2019 ◽

Cited By ~ 1

Author(s):

Ryan O’Hara ◽

Enzo Tedone ◽

Andrew Ludlow ◽

Ejun Huang ◽

Beatrice Arosio ◽

...

Keyword(s):

Mitochondrial Dna ◽

T Cell Activation ◽

Copy Number ◽

Metabolic Regulation ◽

Single Cells ◽

Digital Pcr ◽

Droplet Digital Pcr ◽

Mtdna Copy Number ◽

Mitochondrial Dna Copy Number ◽

Human T Cell

ABSTRACTMitochondria are involved in a number of diverse cellular functions, including energy production, metabolic regulation, apoptosis, calcium homeostasis, cell proliferation and motility as well as free radical generation. Mitochondrial DNA (mtDNA) is present at hundreds to thousands of copies per cell in a tissue-specific manner. Importantly, mtDNA copy number also varies during aging and disease progression and therefore might be considered as a biomarker that mirrors alterations within the human body. Here we present a new quantitative, highly sensitive droplet digital PCR (ddPCR) method (ddMDM; droplet digital mitochondrial DNA measurement) to measure mtDNA copy number not only from cell populations but also from single cells. Our developed assay can generate data in as little as 3 hours, is optimized for 96-well plates and also allows the direct use of cell lysates without the need for DNA purification or nuclear reference genes. Importantly, we show that ddMDM is able to detect differences between samples whose mtDNA copy number was close enough as to be indistinguishable by other commonly used mtDNA quantitation methods. By utilizing ddMDM, we show quantitative changes in mtDNA content per cell across a wide variety of physiological contexts including cancer progression, cell cycle progression, human T cell activation, and human aging.

Download Full-text

Tissue-specific heteroplasmy dynamics is accompanied by a sharp drop in mtDNA copy number during development

10.1101/2021.07.30.454495 ◽

2021 ◽

Author(s):

Nikita Tsyba ◽

Maulik R Patel

Keyword(s):

Copy Number ◽

Mitochondrial Genomes ◽

Mtdna Copy Number ◽

Sharp Drop ◽

Mitochondrial Mutation ◽

Neuron System ◽

Tissue Specific ◽

C Elegans ◽

Somatic Tissues ◽

Amp Activated Protein Kinase

Mitochondrial mutation phenotypes are highly unpredictable as they depend on 3 variables; mutant-to-wildtype ratio (heteroplasmy level), total number of mitochondrial genomes (mtDNA), and the tissue affected. The exact phenotype experienced is governed by the combination of these variables, but current models lack the capability to examine the three variables simultaneously. We have established a C. elegans muscle and neuron system to overcome this challenge. Using this system, we measure heteroplasmy level and mtDNA copy number throughout development. Our results show that neurons accumulate significantly higher heteroplasmy level than muscles. These tissue-specific differences arise late in development, and are dependent on AMP-activated protein kinase (AMPK). Importantly, we find that somatic tissues lose more than half of their mtDNA content during development. These findings show that heteroplasmy levels can remain stable, or even increase, despite acute mtDNA losses.

Download Full-text

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

Reproduction Fertility and Development ◽

10.1071/rdv33n2ab31 ◽

2021 ◽

Vol 33 (2) ◽

pp. 123

Author(s):

E. J. Gutierrez ◽

F. B. Diaz ◽

K. R. Bondioli

Keyword(s):

Mitochondrial Dna ◽

Copy Number ◽

Pure Water ◽

Digital Pcr ◽

Control Group ◽

Atp Content ◽

Mtdna Copy Number ◽

Atp Production ◽

Mitochondrial Dna Copy Number ◽

Mitochondrial Number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P<0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

Download Full-text