First report of a geminivirus causing leaf curl disease on Trigonella corniculata evidenced by PCR using degenerate primers

EPPO Bulletin ◽  
2001 ◽  
Vol 31 (1) ◽  
pp. 115-117
Author(s):  
S. K. Raj ◽  
S. K. Pandey ◽  
G. Chandra ◽  
B. P. Singh ◽  
R. K. Gupta
Keyword(s):  
Degenerate Primers ◽  
First Report ◽  
Leaf Curl Disease ◽  
Leaf Curl

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals MOLECULAR IDENTIFICATION OF Pepper yellow leaf curl Indonesia virus ON CHILI PEPPER IN NUSA PENIDA ISLAND

2021 ◽  
Vol 21 (2) ◽  
pp. 97-102
Author(s):  
Dewa Gede Wiryangga Selangga ◽  
Listihani Listihani
Keyword(s):  
Sequence Analysis ◽  
Molecular Identification ◽  
Disease Incidence ◽  
Analysis Data ◽  
Chili Pepper ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Disease Symptoms ◽  
Leaf Curl Disease ◽  
Leaf Curl

Molecular identification of Pepper yellow leaf curl Indonesia virus on chili pepper in Nusa Penida Island. Pepper yellow leaf curl Indonesia virus (PYLCV) has been reported as caused yellow leaf curl disease in Bali Island since early 2012. Dominant symptoms of PYLCV infection in chili pepper were yellowing, leaf curl, yellow mosaic, and mottle. Bemisia tabaci, has been known to vector on the case yellow leaf curl disease. Observations on the Nusa Penida Island in 2020 showed symptoms such as yellow leaf curl disease, however, identification of PYLCV in Nusa Penida Island has not been studied. Molecular identification was conducted using polymerase chain reaction and sequence analysis. Data collected in this study was disease symptoms and disease incidence. The results showed that dominant disease symptoms caused by virus from Nusa Penida were yellow mosaic, yellowing, and mottle. Universal DNA fragments of 912 bp were successfully amplified from 50 leaf samples using Begomovirus degenerate primers SPG 1 (5’-CCCCKGTGCGWRAATCCAT-3’) and SPG 2 (5’ATCCVAA YWTYCAGGGAGCT-3’). Sequence analysis showed that the isolate from Nusa Penida was a Pepper yellow leaf curl Indonesia virus with a 98–100% homology with several reference isolates.

scholarly journals First Report of Papaya leaf curl virus Associated with Leaf Curl Disease in Cestrum nocturnum in Pakistan

Plant Disease ◽  
2020 ◽  
Vol 104 (11) ◽  
pp. 3089
Author(s):  
Aamir Lal ◽  
Eui-Joon Kil ◽  
Kainat Rauf ◽  
Muhammad Ali ◽  
Sukchan Lee
Keyword(s):  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Papaya Leaf Curl Virus ◽  
Leaf Curl

scholarly journals A New Begomovirus Species Causing Tomato Leaf Curl Disease in Varanasi, India

Plant Disease ◽  
2003 ◽  
Vol 87 (3) ◽  
pp. 313-313 ◽  
Author(s):  
S. Chakraborty ◽  
P. K. Pandey ◽  
M. K. Banerjee ◽  
G. Kalloo ◽  
C. M. Fauquet
Keyword(s):  
Infectious Clone ◽  
Uttar Pradesh ◽  
Tomato Leaf ◽  
Full Length ◽  
Degenerate Primers ◽  
Tomato Leaf Curl Disease ◽  
Leaf Curling ◽  
Tomato Leaf Curl ◽  
Leaf Curl Disease ◽  
Leaf Curl

In November 2001, a leaf curl disease of tomato, manifested by yellowing of leaf lamina, upward leaf curling, leaf distortion, shrinking of leaf surface, and stunted plant growth was observed in tomato-growing areas in the Varanasi and Mirzapur districts of eastern Uttar Pradesh, India, which caused yield losses up to 100%. The causal agent was infective to tomato cv. Punjab Chuhara by whiteflies and grafting. Inoculated plants developed symptoms observed in naturally infected tomatoes. Viral DNA was isolated from artificially inoculated tomato plants using 1% CTAB (2) followed by a concentration of supercoiled DNA by alkaline denaturation (1). A geminivirus was confirmed by polymerase chain reaction using DNA-A degenerate primers (3), and a 550-bp amplified product was obtained from artificially and naturally infected plants. Full-length viral genomes of DNA-A and DNA-B were cloned in plasmid pUC18 at HindIII and XbaI sites, respectively. Partial tandem dimers of the viral clones were infective to Nicotiana benthamiana and tomato cv. Organ Spring through particle bombardment. Infected N. benthamiana plants exhibited downward and upward leaf curling, big veins, leaf puckering with interveinal chlorosis, and stunting. On tomato, symptoms were the same as those seen on naturally infected plants. Cloned DNA also infected Capsicum annuum cv. California Wonder (upward leaf curling and stunting) and tobacco cv. Xanthi (leaf curling and crinkling) but failed to infect Phaseolus vulgaris, okra, cotton, and N. glutinosa. The Varanasi isolate was sap transmissible (0.1 M potassium phosphate buffer, pH 7.0) from the bombarded plants to N. benthamiana and tomato cv. Organ Spring. DNA-A alone infected N. benthamiana (upward leaf curling and big veins) and tomato cv. Organ Spring (mild leaf curl), but symptoms were delayed and milder. Full-length genome sequencing revealed DNA-A (AY190290) contained 2,757 nt and DNA-B (AY190291) contained 2,688 nt. DNA-A of the Varanasi isolate shares 98.4% identity with a DNA-A sequence (AF449999) obtained from a tomato showing leaf curl symptoms from the same region and 97.1% identity with an isolate from Gujarat (900 km from Varanasi). All three sequences represent isolates of the same species, herein called Tomato leaf curl Gujarat virus, based on the priority of submission of the DNA sequence for the Gujarat region (ToLCGV; AF 413671). All isolates noted were obtained from GenBank. However, except for the DNA-A sequence, no other information is available for these ToLCGV isolates. DNA-A of the ToLCGV-Varanasi isolate shares 66.8% identity with Tomato leaf curl New Delhi virus, severe strain (ToLCNdV-Svr) (U15015), and 84.1% with Tomato leaf curl Karnataka virus (U38239). No DNA-B has been reported for these two ToLCGV isolates, and no infectious clone proving the etiology of the disease has been constructed, except for ToLCGV-Varanasi. DNA-B of ToLCGV-Varanasi shares 79.2% homology with ToLCNdV-Svr and 84.1% with ToLCNdV-Luc (X89653). These results suggest that the isolate from Varanasi belongs to ToLCGV, a previously undescribed geminivirus species causing a devastating tomato leaf curl disease in Gujarat and Uttar Pradesh. References: (1) H. C. Birnboim and J. Doly. Nucleic Acids Res. 7:1513, 1979. (2) K. M. Srivastava et al. J. Virol. Methods 51:297, 1995. (3) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽  
2001 ◽  
Vol 85 (6) ◽  
pp. 678-678 ◽  
Author(s):  
A. D. Avgelis ◽  
N. Roditakis ◽  
C. I. Dovas ◽  
N. I. Katis ◽  
C. Varveri ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Rflp Analysis ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Comparisons ◽  
Tomato Plants ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

scholarly journals First Report of a Begomovirus Associated with Tomato Yellow Leaf Curl Disease in Ethiopia

Plant Disease ◽  
2006 ◽  
Vol 90 (7) ◽  
pp. 974-974 ◽  
Author(s):  
S. L. Shih ◽  
S. K. Green ◽  
W. S. Tsai ◽  
L. M. Lee ◽  
J. T. Wang ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Tomato Yellow Leaf ◽  
Tomato Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yellow Leaf ◽  
First Report ◽  
Sequence Identity ◽  
Pcr Product ◽  
Leaf Curl Disease ◽  
Leaf Curl

During December 2003, severe leaf yellowing, leaf curling, and stunting symptoms were observed in tomato (Lycopersicon esculentum) plantings in Melkassa (1,550 m above sea level), Ethiopia. Eleven symptomatic samples were collected and tested for the presence of a begomovirus using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (3). Samples were also tested for Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tobacco etch virus (TEV), Pepper veinal mottle virus (PVMV), and Tomato mosaic virus (ToMV) using enzyme-linked immunosorbent assay (ELISA). All samples were negative for CMV, PVY, TEV, PVMV, and ToMV. However, the expected 1.4-kb PCR product for begomoviruses was obtained from all samples. DNA-B and DNA-beta were not detectable using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/ DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. The 1.4-kb PCR product of one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,785 nucleotides (GenBank Accession No. DQ358913) and was found to contain the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The DNA-A sequence of the virus associated with yellow leaf curl disease of tomato from Ethiopia showed highest sequence identity (92%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accession No. AY502934). On the basis of the DNA-A sequence comparison and the ICTV demarcation of species at 89% sequence identity, the Ethiopian virus is a provisional strain of TYLCMLV described from Mali. To our knowledge, this is the first report of a begomovirus associated with tomato yellow leaf curl disease in Ethiopia. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report of Tomato severe leaf curl virus in México

Plant Disease ◽  
2006 ◽  
Vol 90 (8) ◽  
pp. 1116-1116 ◽  
Author(s):  
J. A. Mauricio-Castillo ◽  
G. R. Argüello-Astorga ◽  
A. G. Alpuche-Solís ◽  
C. T. Monreal-Vargas ◽  
O. Díaz-Gómez ◽  
...  
Keyword(s):  
Restriction Fragment ◽  
Alignment Method ◽  
Degenerate Primers ◽  
First Report ◽  
Leaf Curling ◽  
San Luis ◽  
San Luis Potosi ◽  
Leaf Curl Virus ◽  
Severe Leaf ◽  
Leaf Curl

San Luis Potosí and Morelos are states situated in the north-central and south-central regions of Mexico, respectively, where a considerable area of agricultural land is occupied by tomato crops. In the summer of 2005, stunting and leaf curling/crumpling symptoms were observed in several tomato (Lycopersicon esculentum L.) fields in Rioverde, San Luis Potosí (Rioverde-SLP). These symptoms and the existence of large populations of whiteflies (Bemisia tabaci Gennadius) in the affected fields suggested a viral etiology. Symptomatic tomato leaves collected during July and September of 2005 from several locations throughout the Rioverde area were assessed for begomovirus presence using polymerase chain reaction (PCR) with three sets of degenerate primers: PAL1v1978/PAR1c496 (3), pCP70for/pCP70rev (1), and two new primers that specifically amplify DNA from viruses of the Squash leaf curl virus (SLCV) lineage, prSL060-for (CGGCGTTRTRRTARACGTCGTC) and prSL150-rev (GCWGCC-AAAGACACCAAYGCCGT). These primers amplify overlapping DNA segments encompassing the complete begomovirus genome A. Amplicons were cloned into pGEM-T easy vector (Promega, Madison, WI) and sequenced. The complete sequence for component A of isolates from two different fields in the Rioverde Valley were assembled and compared with sequences available in the GenBank database using BlastN and the Clustal alignment method (MegAlign, DNASTAR, Madison, WI). The 2588-bp sequence of the Rioverde-SLP1 isolate (Accession No. DQ347946) and the 2594-bp sequence of Rioverde-SLP2 isolate (Accession No. DQ347947) were 97.2% identical. Both field isolates displayed the highest similarity (97.1 and 97.3% nt identity, respectively) with Tomato severe leaf curl virus from Guatemala (ToSLCV-GT96; Accession No. AF130415). Similarity of SLP isolates with Tomato severe leaf curl virus from Nicaragua (Accession Nos. AJ508784 and AJ508785) was significantly lower, 89.9 and 89.7%, respectively. A parallel survey of tomato fields in Xochitepec, Morelos, located 550 km southeast of Rioverde-SLP, was performed during September, 2005. Leaf samples from six plants displaying leaf curling/crumpling symptoms were collected and assessed for begomovirus presence using PCR with the degenerate primers, prC889 (4) and prSL060-for. The 1.4-kb PCR fragments obtained were subsequently analyzed by restriction fragment length polymorphism using MspI and HhaI. Restriction fragment patterns were the same for all amplicons. The 1435-bp DNA A sequence of one isolate from Morelos was determined (Accession No. DQ267157) and compared with sequences available for other begomoviruses using Clustal alignment method. The highest identity (98%) was with ToSLCV-SLP and ToSLCV-GT96 isolates. These data confirm that ToSLCV is infecting tomato in different horticultural regions of Mexico. The presence of this begomovirus has been previously reported in Honduras, Guatemala, and Nicaragua (2). To our knowledge, this is the first report of ToSLCV in Mexico. References: (1) R. De La Torre-Almaraz et al. Plant Dis. 90:378, 2006. (2) M. K. Nakhla et al. Acta Hort. (ISHS) 695:277. Proc. First Int. Symp. on Tomato Diseases. M. T. Momol et al., eds., 2005. (3) M. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of a Begomovirus Infecting Sweetpotato in Kenya

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 832-832 ◽  
Author(s):  
D. W. Miano ◽  
D. R. LaBonte ◽  
C. A. Clark ◽  
R. A. Valverde ◽  
M. W. Hoy ◽  
...  
Keyword(s):  
Sweet Potato ◽  
Germplasm Collection ◽  
Degenerate Primers ◽  
Potato Leaf ◽  
First Report ◽  
Two Samples ◽  
Total Dna ◽  
Dna Fragment ◽  
Pcr Assays ◽  
Leaf Curl

Previous surveys for viruses in sweetpotatoes (Ipomoea batatas) in Africa did not assay for the presence of begomoviruses such as Sweet potato leaf curl virus (SPLCV), which have been found recently in the Americas and Asia. Symptomatic sweetpotato plants, including some with leaf curling symptoms similar to those observed in SPLCV-infected sweet-potato plants (2), were collected from a germplasm collection plot at Kakamega Research Station in Western Kenya during February 2005. Whiteflies, the vectors for begomoviruses, were observed in the same plots. Ipomoea setosa plants graft-inoculated with scions from the symptomatic sweetpotato developed leaf curl, leaf roll, interveinal chlorosis, and stunting symptoms similar to those caused by infection with SPLCV alone or in combination with Sweet potato feathery mottle virus. Total DNA was isolated from 10 I. setosa plants using the GenElute Plant Genomic DNA Kit (Sigma-Aldrich Inc., St. Louis, MO). Sweetpotato cuttings from 39 clones, selected from the Kenyan germplasm collection for their resistance or susceptibility to sweetpotato virus disease (SPVD), were sent to the Plant Germplasm Quarantine Office of USDA-ARS. The cuttings were planted in a greenhouse. Total DNA was extracted from sweetpotato leaves 1 month later using a cetyltrimethylammoniumbromide (CTAB) extraction method (1). Degenerate primers SPG1/SPG2, developed for PCR detection of begomoviruses (1), amplified a 912-bp DNA fragment from 3 of 10 DNA extracts from I. setosa and 5 of 39 sweetpotato plants held in quarantine. The primers anneal to regions of open reading frame (ORF) AC2 and ORF AC1 that are highly conserved in begomoviruses infecting sweetpotato. SPLCV-specific primers PW285-1/PW285-2 (2) amplified a 512-bp DNA fragment of ORF AC1 from seven samples (two from I. setosa and five from I. batatas). Amplicons from three independent PCR assays of two samples and single PCR assays of four additional samples were cloned into the pGEM-T Easy vector. Clone inserts were sequenced, and compared with sequences deposited in GenBank using the basic local alignment search tool (BLAST). Sequences were closely related to SPLCV (GenBank Accession No. AF104036) with nucleotide sequence identities varying from 93% (GenBank Accession No. DQ361004) to 97% (GenBank Accession No. DQ361005). The presence of the virus poses a challenge to the dissemination of planting materials in the region because begomovirus-infected plants often do not show symptoms. To our knowledge, this is the first report of a begomovirus infecting sweetpotato in Kenya or the East African Region. References: (1) R. Li et al. Plant Dis. 88:1347, 2004. (2) P. Lotrakul et al. Plant Dis. 82:1253, 1998.

Sign in / Sign up

Export Citation Format

Share Document