scholarly journals Comparative study of regulatory T cells expanded ex vivo from cord blood and adult peripheral blood

Immunology ◽  
2012 ◽  
Vol 136 (2) ◽  
pp. 218-230 ◽  
Author(s):  
Huahua Fan ◽  
Jie Yang ◽  
Jun Hao ◽  
Yana Ren ◽  
Liang Chen ◽  
...  
Keyword(s):  
T Cells ◽  
Regulatory T Cells ◽  
Comparative Study ◽  
Cord Blood ◽  
Peripheral Blood ◽  
Ex Vivo ◽  
Adult Peripheral Blood

Persistence of naive CD45RA+ regulatory T cells in adult life

Blood ◽  
2006 ◽  
Vol 107 (7) ◽  
pp. 2830-2838 ◽  
Author(s):  
Nabila Seddiki ◽  
Brigitte Santner-Nanan ◽  
Stuart G. Tangye ◽  
Stephen I. Alexander ◽  
Michael Solomon ◽  
...  
Keyword(s):  
T Cells ◽  
Lymph Node ◽  
T Cell ◽  
Regulatory T Cells ◽  
Cord Blood ◽  
Peripheral Blood ◽  
Cell Subset ◽  
Human Infant ◽  
Wide Range ◽  
Adult Peripheral Blood

AbstractRegulatory T cells (TREGs) constitutively expressing CD4, CD25, and the transcription factor Foxp3 can prevent a wide range of experimental and spontaneous autoimmune diseases in mice. In humans, CD4+CD25bright T cells, predominantly within the CD45RO+ activated/memory subset in adults and the CD45RA+ naive T-cell subset in infants, are considered to be the equivalent subset. Using novel combinations of monoclonal antibodies (mAbs), we examined expression of CD25 in human infant thymus, cord blood, adult peripheral blood, lymph node, and spleen. In addition to the CD4+CD25bright T cells, subfractionation on the basis of CD45 splice variants indicated that all samples contained a second distinct population of cells expressing a slightly lower level of CD25. In adult peripheral blood, this population expressed a naive CD45RA+ phenotype. The corresponding population in lymph node, spleen, and cord blood showed some evidence of activation, and expressed markers characteristic of TREGs, such as cytotoxic T lymphocyte-associated antigen 4 (CTLA-4). Sorted CD4+CD25+CD45RA+ T cells from both cord and adult blood expressed very high levels of mRNA for Foxp3 and manifested equivalent suppressive activity in vitro, indicating that they are bone fide members of the regulatory T-cell lineage. Targeting naive TREGs in adults may offer new means of preventing and treating autoimmune disease.

Expansion of regulatory T cells from umbilical cord blood and adult peripheral blood CD4+CD25+ T cells

2014 ◽  
Vol 60 (1) ◽  
pp. 105-111 ◽  
Author(s):  
Syh-Jae Lin ◽  
Chun-Hao Lu ◽  
Dah-Chin Yan ◽  
Pei-Tzu Lee ◽  
Hsiu-Shan Hsiao ◽  
...  
Keyword(s):  
T Cells ◽  
Regulatory T Cells ◽  
Cord Blood ◽  
Umbilical Cord ◽  
Umbilical Cord Blood ◽  
Peripheral Blood ◽  
Adult Peripheral Blood

The Significance of mTOR Inhibitor, Everolimus in TGF-β-Induced Regulatory T cells from Cord Blood

Blood ◽  
2011 ◽  
Vol 118 (21) ◽  
pp. 2180-2180
Author(s):  
Tokiko Nagamura-Inoue ◽  
Seiichiro Kobayashi ◽  
Kazuo Ogami ◽  
Yuki Yamamoto ◽  
Kiyoko Izawa ◽  
...  
Keyword(s):  
T Cells ◽  
Regulatory T Cells ◽  
Cord Blood ◽  
Cell Population ◽  
Cd4 T Cells ◽  
Mtor Inhibitor ◽  
Ex Vivo ◽  
Mtor Inhibitors ◽  
Ex Vivo Expansion ◽  
The Impact

Abstract Abstract 2180 Background: Regulatory T cells (Tregs) play an important role in immune-tolerance to allograft. Cord blood (CB) is rich in naïve T cells and is a promising source of inducible Tregs (iTregs), since it was reported that stable iTregs may be derived exclusively from naïve T cells. However, the standard method for iTregs has not yet been established. Here we studied the impact of mTOR inhibitors, rapamycin (Rap) and everolimus (Eve), on ex vivo expansion of iTregs from CB-CD4+ T cells. Methods: CB-CD4+ T cell were isolated using anti-CD4 monoclonal antibody (MAb)-conjugated magnetic beads, and cultured in a flask coated with anti-CD3/CD28 MAbs and supplemented with IL-2 and TGF-β in the presence or absence of Rap or Eve. After two weeks of culture, the total number of CD4+ T cells was calculated, and the incidence of CD25+Foxp3+ cell population among those was estimated by FACS. Results and Discussions: Both Rap and Eve significantly increased the incidence of CD25+Foxp3+ cell population in CD4+ T cells. However, Rap apparently inhibited their growth and did not increase the absolute number of CD25+Foxp3+ cells in comparison to the control. On the other hand, Eve contributed to efficient expansion of iTregs at the concentration between 1 and 50ng/ml without no significant inhibition of their growth. Expansion of CD4+ T cells with TGF-β and Eve yielded 71.5 ±23.5% purity of CD25+Foxp3+ cells which also expressed CTLA-4 as well as the memory phenotype, while the purity obtained with TGF-β only was 47.4±30.0% and that without TGF-β/Eve was 7.3±4.5%. Thus, an average of 2.95±2.8 x107 iTregs were obtained from the initial input of 5×104 CD4+ T cells. The resulting iTregs with TGF-β, TGF-β/Rap and TGF-β/Eve inhibited the proliferation of CFSE-labeled T cells stimulated with allogeneic dendritic cells. The precise mechanism for Foxp3 induction by mTOR inhibitors still remains to be elucidated. Furthermore, we found that expression of CD26 (DPP-IV) was significantly down-regulated in CD4+ T cells expanded with TGF-β and profoundly with TGF-β/Eve, while CD127 was negative after culture in all the conditions. Mean fluorescence intensity of CD26 indicated 67.5 in CD4+ T cells without TGF-β, 1.58 with TGF-β, 0.18 with TGF-β/Rap and 0.12 with TGF-β/Eve, respectively. Accordingly, CD26 negativity may be an indicator of iTregs together with Foxp3. Conclusion: mTOR inhibitor, Eve, is an efficient co-inducer of iTregs and applicable to ex vivo expansion of iTregs in a clinical setting. Disclosures: No relevant conflicts of interest to declare.

Compared to Adult Peripheral Blood T Cells, Cord Blood T Cells Show Enhanced Immunological Recognition of Chronic Lymphocytic Leukemia Tumor Cells.

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 2333-2333
Author(s):  
Alan G. Ramsay ◽  
Dong-Xia Xing ◽  
William K. Decker ◽  
Jared K. Burks ◽  
William G. Wierda ◽  
...  
Keyword(s):  
T Cells ◽  
B Cells ◽  
Chronic Lymphocytic Leukemia ◽  
Cord Blood ◽  
Peripheral Blood ◽  
Actin Polymerization ◽  
Synapse Formation ◽  
Immunological Synapse ◽  
Lymphocytic Leukemia ◽  
Adult Peripheral Blood

Abstract Following allogeneic stem cell transplantation (SCT) and donor lymphocyte infusion (DLI) from adult peripheral blood (APB), chronic lymphocytic leukemia (CLL) cells are good targets of a graft-versus-leukemia effect. However, some patients eligible for this treatment do not have a suitable allogeneic donor and CLL B cells have been shown to be dysfunctional antigen-presenting cells (APCs) for allogeneic APB T cells. As a result, allogeneic APB T cells show suppressed immunological synapse formation with CLL cells. Umbilical cord blood (CB) is a promising source of hematopoietic cells for allogeneic transplantation and can be obtained from matched unrelated donors with greater tolerance for incompletely HLA-matched recipients. Moreover, we have successfully expanded CB T cells ex vivo (anti-CD3/CD28 beads and rIL-2) using a protocol that retains a naïve and diverse immune population including central memory cells. In this present study we used confocal microscopy to visualize F-actin polymerization to assess immunological synapse formation of CB T cells compared to APB T cells with CLL B cells with and without superantigen as APCs. Our results identify the ability of unexpanded and expanded CB CD4 and CD8 T cells to form F-actin immune synapses with CLL B cells and of note, CB was more effective than unexpanded or expanded APB T cells (p<0.05). Of interest, the expansion protocol maintained immune synapse formation with a trend towards increased F-actin polymerization. As control, we examined the ability of unexpanded and expanded T cells to form F-actin synapses with allogeneic healthy B cells with or without superantigen as APCs and found no significant difference between CB and APB as a source of T cells. Our results demonstrate that CB T cells have an enhanced ability to recognize CLL B cells as allogeneic APCs compared to APB T cells and provide important and exciting pre-clinical data for the potential use of expanded CB T cells in the setting of CB transplantation in CLL.

Regulation of CD28 expression on umbilical cord blood and adult peripheral blood CD8+ T cells by interleukin(IL)-15/IL-21

Cytokine ◽  
2012 ◽  
Vol 58 (1) ◽  
pp. 40-46 ◽  
Author(s):  
Yu-Han Chen ◽  
Ming-Ling Kuo ◽  
Po-Jen Cheng ◽  
Hsiu-Shan Hsaio ◽  
Pei-Tzu Lee ◽  
...  
Keyword(s):  
T Cells ◽  
Cord Blood ◽  
Umbilical Cord ◽  
Cd8 T Cells ◽  
Umbilical Cord Blood ◽  
Peripheral Blood ◽  
Adult Peripheral Blood

scholarly journals FOXP3 Is a Direct Target Of miR15a/16 in Umbilical Cord Blood Regulatory T Cells

Blood ◽  
2013 ◽  
Vol 122 (21) ◽  
pp. 3261-3261
Author(s):  
Liu Xiaoying ◽  
Shawndeep Tung ◽  
Tetsuro Setoyama ◽  
Lucilla D’Abundo ◽  
Robinson Simon ◽  
...  
Keyword(s):  
T Cells ◽  
Regulatory T Cells ◽  
Cord Blood ◽  
Binding Site ◽  
Umbilical Cord ◽  
Umbilical Cord Blood ◽  
Ex Vivo ◽  
Site Directed Mutagenesis ◽  
Categorical Variables ◽  
Direct Target

Abstract The exact mechanism of action of Umbilical cord blood (CB) derived regulatory T cells (Tregs) in the prevention of graft versus host disease (GVHD) remains unclear. Based on the selective overexpression of peptidase inhibitor 16 in CB Tregs we explored the related p53 pathway that has been shown to negatively regulate microRNA 15a and 16 (Fabbri, JAMA, 2011). We systematically evaluated the expression of miR15a/16 in CB Tregs (CD4+25+127lo) and compared it to CB derived conventional T cells (Tcons) (CD4+25-127hi). CB Tregs and Tcons were isolated using CD25 based magnetic selection and were ex-vivo expanded for 14 days in the presence of IL-2. Total RNA was reverse transcribed with microRNA-specific primers using a TaqMan® microRNA reverse transcription kit. Differences in miRNA levels were compared with the Student’s T-test. Fisher exact and χ2 tests were applied to categorical variables. Lentivirus based transduction was performed in CB Tregs and CB Tcons for the purpose of miR15a overexpression (OE) and knockdown (KO), respectively. Firefly and Renilla dual luciferase report system were employed to investigate the interaction between miR15a/16 and FOXP3. In order to generate the 3′ UTR mutant construct (3′UTR-del), seed regions were deleted using the QuikChange site-directed mutagenesis kit according to the manufacturer’s protocols (Agilent) and designated as FOXP3 del. We found significantly lower levels of miR15a and miR16 in CB Tregs when compared to CB Tcons (p=0.002 and p<0.001, respectively). As a positive control, miR21 was overexpressed in CB Tregs when compared to CB Tcons (p=0.005). No difference was seen in the miR15a/16 expression between CB Tregs and peripheral Blood Tregs. In a xenogeneic GVHD mouse model, lower levels of miR15a/16 were also found in the circulating CD4+ cells of Treg recipients which correlated with their preservation of phenotype, better GVHD score and overall survival. OE of miR15a/16 in CB Tregs inhibited FOXP3 and CTLA4 expression and led to partial reversal of Treg mediated suppression in an allogeneic mixed lymphocyte reaction (MLR) (p=0.005 and p=0.00001, respectively). OE miR15a/16 also led to reversal of FOXP3 demethylation in CB Tregs. Furthermore, KD of miR15a/16 in CB Tcons led to increased expression of FOXP3 and CTLA4. miR15a/16 KD CB Tcons were able to suppress the proliferation reaction in an alloMLR. Using luciferase based mutagenesis assay, FOXP3 was determined to be a target of miR15a/16 at binding site 1: GTGGTTCTAGACACCCCCTCCCCCATCATA (forward) and GTGGTTCTAGAGGC TCTCTGTGTTTTGGGGT (reverse) and binding site 2: GTGGTTCTAGACCTACAC AGAAGCAGCGTCA (forward) and GTGGTTCTAGAGATCAGGGCTCAGGGAATGG (reverse). This is the first report of identification of FOXP3 as a direct target of miR15a/16 and we propose miR15a/16 as a mechanism involved in the checkpoint of CB Tregs and Tcons (Figure 1). Further study of miR15a/16 pathway can be helpful in better understanding of Treg function. Disclosures: Shah: Celgene: Membership on an entity’s Board of Directors or advisory committees, Research Funding. McNiece:Proteonomix Inc: Consultancy.

scholarly journals Adoptive Therapy with Cord Blood Regulatory T Cells Can Treat Graft Vs Host Disease

Blood ◽  
2019 ◽  
Vol 134 (Supplement_1) ◽  
pp. 1940-1940
Author(s):  
Hongbing Ma ◽  
Ke Zeng ◽  
Mitsutaka Nishimoto ◽  
Mi-Ae Lyu ◽  
Meixian Huang ◽  
...  
Keyword(s):  
Flow Cytometry ◽  
T Cells ◽  
Regulatory T Cells ◽  
Cord Blood ◽  
Peripheral Blood ◽  
Research Funding ◽  
Adoptive Therapy ◽  
Host Disease ◽  
Graft Vs Host Disease ◽  
The Impact

Background Adoptive therapy with regulatory T cells (Tregs) has already been established as a promising strategy for prevention of graft vs. host disease (GVHD) in clinical trials. Our group at MD Anderson Cancer Center has previously shown that a significantly lower dose of cord blood (CB) Tregs as compared to conventional T cells (Tcon) in the donor graft is able to prevent GVHD while preserving the graft vs. leukemia (GVL) effect. Therefore, we now examined the efficacy of using CB Tregs in the treatment of GVHD. Method: Xenogenic GVHD mouse model was established using NOD/SCID/IL2Rgnull (NSG) mice were sublethally irradiated at 300 cGy followed by injection of 1x107 peripheral blood (PB) mononuclear cells on day 0, as previously described. Ex vivo expanded CB Tregs were injected on day -1 (for prophylaxis) or at different days post PBMC injection for treatment. Mice were serially examined for appearance, weight, posture, GVHD score and survival. Serial peripheral blood sampling for flow cytometry and serum cytokine analysis. CB Tregs were also analyzed by flow cytometry. In order to understand the impact of the routine immunosuppressive agents on the function of CB Tregs, we incubated the CB Tregs in culture with cyclosporine (200ng/ml) or sirolimus (20 ng/ml) from day 8 to day 14. Cells were harvested on day 14 and analyzed by flow cytometry and CellTrace Violet suppression assay. Result: A single dose of 1x107 CB Tregs injected at day +7 did not result in a survival difference compared to the control arm (data not shown). Therefore, we froze multiple aliquots of expanded CB Tregs to be injected at different intervals post-transplant. Thawed CB Tregs showed stable phenotype of CD4+25+127lo: 94.7%; intracellular Helios+: 98.5% and intracellular FOXP3+: 99.4% and were able to suppress 87% of the proliferating conventional T-cells (Tcons). In order to compare the efficacy of the CB Tregs for GVHD treatment, we set up 3 arms: i) Control: PBMC alone; ii) Prophylaxis: 1x107 CB Tregs injected on day -1 and iii) Treatment: 1x107 CB Tregs injected on day +4, +7, +18 and +25. The mice in the prophylaxis and treatment arm retained their weight as compared to the control arm (p<0.003) (Fig 1A) and showed significantly better overall survival (P=0.01) (Fig 1B), which correlated with the decrease in circulating inflammatory cytokines including TNFa (Fig 1C). Since the standard of care for acute GVHD still remains high dose steroids, we evaluated the effect of continued exposure to steroids (prednisone-100ug/ml) for a period of 96 hours on the viability of CB Tregs. When compared to CB Tcons, 90.3% CB Tregs remained alive and viable compared to 64.7% of Tcons (Fig 1D). No differences were observed in the intracellular expression of FOXP3 or Helios in the control vs. cyclosporine or sirolimus exposed cells (Fig 1E). Similarly, no significant impact was observed on their suppressor function (Fig 1F). Conclusions: Multiple injections with CB Tregs can effectively treat GVHD. Combination therapy of CB Tregs with the commonly used GVHD treatments can be explored. Figure 1 Disclosures Iyer: Genentech/Roche: Research Funding; Incyte: Research Funding; Seattle Genetics, Inc.: Research Funding; Novartis: Research Funding; Bristol-Myers Squibb: Research Funding; Arog: Research Funding. Parmar:Cellenkos Inc.: Equity Ownership, Membership on an entity's Board of Directors or advisory committees, Research Funding.

Sign in / Sign up

Export Citation Format

Share Document