Microkamienskia gen. nov. and Microkamienskia peruviana, a new arbuscular mycorrhizal fungus from Western Amazonia

Nova Hedwigia ◽  
2019 ◽  
Vol 109 (3) ◽  
pp. 355-368 ◽  
Author(s):  
Mike Anderson Corazon-Guivin ◽  
Agustin Cerna-Mendoza ◽  
Juan Carlos Guerrero-Abad ◽  
Adela Vallejos-Tapullima ◽  
Santos Carballar-Hernández ◽  
...  
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Single Species ◽  
Spore Wall ◽  
Wall Layer ◽  
Am Fungus ◽  
Small Spore ◽  
Plukenetia Volubilis

A new arbuscular mycorrhizal (AM) fungus, Microkamienskia peruviana, was detected in bait cultures for arbuscular mycorrhizal fungi established with rhizospheric soil substrates of the inka nut (Plukenetia volubilis). The field soil derived from three agricultural plantations in the Amazonia lowlands of the province Lamas, San Martin State, in Peru. The fungus was subsequently propagated in single species cultures on Sorghum sp., Brachiaria sp.,Medicago sativa and P. volubilis as host plants. The new species differentiates hyaline spores regularly in spore clusters, up to 500–800×400–600 μm. The spores are 16–31(–36)×13–29(–35) μm in diam, formed on cylindrical or slightly funnel-shaped hyphae, without a septum at or close to the spore base. Phylogenetically, the new fungus belongs to a new genus, named Microkamienskia, which has as type species M. perpusilla comb. nov. and to which also M. divaricata comb. nov. belongs. Both are transferred from Kamienskia to Microkamienskia in the present study. The new fungus can be identified by the ballooning semi-persistent to evanescent outer spore wall layer in PVLG-based mountants that is not known for the other species of these two genera, nor for any other glomeromycotan species of similar small spore sizes. Kamienskia and Microkamienskia species can be distinguished by their position in the phylogenetic tree and by hyaline spores, open pores at the spore bases and in the subtending hyphae, and by their spore sizes that are for Microkamienskia among the smallest spore sizes so far detected for AM fungi (15–35 μm).

Acaulospora papillosa, a new mycorrhizal fungus from NE Brazil, and Acaulospora rugosa from Norway

Phytotaxa ◽  
2016 ◽  
Vol 260 (1) ◽  
pp. 14 ◽  
Author(s):  
CAMILLA M.R. PEREIRA ◽  
LEONOR C. MAIA ◽  
IVÁN SÁNCHEZ-CASTRO ◽  
JAVIER PALENZUELA ◽  
DANIELLE K.A. SILVA ◽  
...  
Keyword(s):  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Single Species ◽  
Spore Wall ◽  
Wall Layer ◽  
Northeastern Brazil ◽  
Tropical Atlantic ◽  
Spore Surface ◽  
Phylogenetic Placement ◽  
Light Yellow

A new arbuscular mycorrhizal species, Acaulospora papillosa, was isolated from the biological reserve ‘Saltinho’ within a coastal tropical Atlantic forest of the ‘Mata Atlântica’ biome in Pernambuco State of Northeastern Brazil. It was trapped and propagated as single species cultures on Zea mays. The spores are yellow white to light yellow to creamy, globose to subglobose, 69–100(–110) × 65–93(–101) µm. The spore surface is roughened as crowded with fine papillae, which are formed on the outermost, evanescent to semi-persistent spore wall layer. These papillae may disintegrate or completely disappear as the spores age and the layer becomes completely evanescent. Phylogenetically, the fungus clusters together with several small-spored Acaulospora species having smooth spore surfaces, such as A. delicata, A. longula, A. morrowiae and A. mellea. In the Acaulospora clade, A. papillosa is the third taxon known to have a roughened spore surface, in addition to A. dilatata and A. rugosa. The phylogenetic placement of A. rugosa is provided, together with colored illustrations of the spore morphology. The isolation of A. papillosa from such protected nature reserves as ‘Saltinho’ further supports the need to protect these areas and determine the biodiversity of beneficial microorganisms.

scholarly journals Bacteria Associated with Spores of the Arbuscular Mycorrhizal Fungi Glomus geosporum and Glomus constrictum

2005 ◽  
Vol 71 (11) ◽  
pp. 6673-6679 ◽  
Author(s):  
David Roesti ◽  
Kurt Ineichen ◽  
Olivier Braissant ◽  
Dirk Redecker ◽  
Andres Wiemken ◽  
...  
Keyword(s):  
Arbuscular Mycorrhizal Fungi ◽  
Mycorrhizal Fungi ◽  
Denaturing Gradient Gel Electrophoresis ◽  
Plantago Lanceolata ◽  
Arbuscular Mycorrhizal ◽  
Spore Wall ◽  
Wall Layer ◽  
Single Spore ◽  
Bacterial Populations ◽  
Glomus Geosporum

ABSTRACT Spores of the arbuscular mycorrhizal fungi (AMF) Glomus geosporum and Glomus constrictum were harvested from single-spore-derived pot cultures with either Plantago lanceolata or Hieracium pilosella as host plants. PCR-denaturing gradient gel electrophoresis analysis revealed that the bacterial communities associated with the spores depended more on AMF than host plant identity. The composition of the bacterial populations linked to the spores could be predominantly influenced by a specific spore wall composition or AMF exudate rather than by specific root exudates. The majority of the bacterial sequences that were common to both G. geosporum and G. constrictum spores were affiliated with taxonomic groups known to degrade biopolymers (Cellvibrio, Chondromyces, Flexibacter, Lysobacter, and Pseudomonas). Scanning electron microscopy of G. geosporum spores revealed that these bacteria are possibly feeding on the outer hyaline spore layer. The process of maturation and eventual germination of AMF spores might then benefit from the activity of the surface microorganisms degrading the outer hyaline wall layer.

scholarly journals Stable C and N isotope natural abundances of intraradical hyphae of arbuscular mycorrhizal fungi

Mycorrhiza ◽  
2020 ◽  
Vol 30 (6) ◽  
pp. 773-780
Author(s):  
Saskia Klink ◽  
Philipp Giesemann ◽  
Timo Hubmann ◽  
Johanna Pausch
Keyword(s):  
Mycorrhizal Fungi ◽  
Isotope Composition ◽  
Fungal Spores ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Mineral Nutrient ◽  
Carbohydrate Source ◽  
Lipid Source ◽  
Am Fungus ◽  
C And N

Abstract Data for stable C and N isotope natural abundances of arbuscular mycorrhizal (AM) fungi are currently sparse, as fungal material is difficult to access for analysis. So far, isotope analyses have been limited to lipid compounds associated with fungal membranes or storage structures (biomarkers), fungal spores and soil hyphae. However, it remains unclear whether any of these components are an ideal substitute for intraradical AM hyphae as the functional nutrient trading organ. Thus, we isolated intraradical hyphae of the AM fungus Rhizophagus irregularis from roots of the grass Festuca ovina and the legume Medicago sativa via an enzymatic and a mechanical approach. In addition, extraradical hyphae were isolated from a sand-soil mix associated with each plant. All three approaches revealed comparable isotope signatures of R. irregularis hyphae. The hyphae were 13C- and 15N-enriched relative to leaves and roots irrespective of the plant partner, while they were enriched only in 15N compared with soil. The 13C enrichment of AM hyphae implies a plant carbohydrate source, whereby the enrichment was likely reduced by an additional plant lipid source. The 15N enrichment indicates the potential of AM fungi to gain nitrogen from an organic source. Our isotope signatures of the investigated AM fungus support recent findings for mycoheterotrophic plants which are suggested to mirror the associated AM fungi isotope composition. Stable isotope natural abundances of intraradical AM hyphae as the functional trading organ for bi-directional carbon-for-mineral nutrient exchanges complement data on spores and membrane biomarkers.

Glomus indicum, a new arbuscular mycorrhizal fungus

Botany ◽  
2010 ◽  
Vol 88 (2) ◽  
pp. 132-143 ◽  
Author(s):  
Janusz Błaszkowski ◽  
Tesfaye Wubet ◽  
Variampally Sankar Harikumar ◽  
Przemysław Ryszka ◽  
François Buscot
Keyword(s):  
Plantago Lanceolata ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Single Species ◽  
Spore Wall ◽  
Fungal Species ◽  
Phylogenetic Position ◽  
Single Spore ◽  
North East ◽  
Rdna Sequences

A new arbuscular mycorrhizal fungal species of the genus Glomus , Glomus indicum (Glomeromycota), forming small, hyaline spores in hypogeous aggregates is described and illustrated. The spores are globose to subglobose, (17–)32(–52) µm in diameter, rarely egg-shaped, oblong to irregular, 17–38 µm × 19–43 µm. The single spore wall of G. indicum consists of two hyaline layers: a mucilaginous, short-lived, thin outer layer staining pinkish to pink in Melzer's reagent and a laminate, smooth, permanent, thicker inner layer. Glomus indicum was found in the rhizosphere of Euphorbia heterophylla  L. naturally growing in coastal sands of Alappuzha in Kerala State of South India and Lactuca sativa  L. cultivated in Asmara, Eritrea, North East Africa. In single-species cultures with Plantago lanceolata  L. as the host plant, G. indicum formed vesicular-arbuscular mycorrhiza. Molecular analysis of the phylogenetic position of G. indicum based on both SSU and ITS rDNA sequences showed the fungus to be a new species with its own cluster. Besides the sites where the spores were observed, sequence types belonging to the G. indicum cluster were documented from environmental samples mainly in the USA, Estonia, and Australia, suggesting the wide occurrence of the species. A key to all known species of the Glomeromycota producing hyaline to light-coloured glomoid spores is provided.

scholarly journals Arbuscular Mycorrhizal Fungus Improves Rhizobium–Glycyrrhiza Seedling Symbiosis under Drought Stress

Agronomy ◽  
2019 ◽  
Vol 9 (10) ◽  
pp. 572 ◽  
Author(s):  
Zhipeng Hao ◽  
Wei Xie ◽  
Xuelian Jiang ◽  
Zhaoxiang Wu ◽  
Xin Zhang ◽  
...  
Keyword(s):  
Drought Stress ◽  
Nitrogen Concentration ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Tolerance Index ◽  
Mycorrhizal Dependency ◽  
Plant Nitrogen ◽  
Water Regimes ◽  
Am Fungus

Rhizobia and arbuscular mycorrhizal (AM) fungi can potentially alleviate the abiotic stress on the legume Glycyrrhiza (licorice), while the potential benefits these symbiotic microbes offer to their host plant are strongly influenced by environmental factors. A greenhouse pot experiment was conducted to investigate the effects of single and combined inoculation with a rhizobium Mesorhizobium tianshanense Chen and an AM fungus Rhizophagus irregularis Walker & Schuessler on Glycyrrhiza uralensis Fisch. seedling performance under different water regimes. Drought stress inhibited rhizobium nodulation but increased mycorrhizal colonization. Furthermore, co-inoculation of rhizobium and AM fungus favored nodulation under both well-watered and drought stress conditions. Glycyrrhiza seedling growth showed a high mycorrhizal dependency. The seedlings showed a negative growth dependency to rhizobium under well-watered conditions but showed a positive response under drought stress. R. irregularis-inoculated plants showed a much higher stress tolerance index (STI) value than M. tianshanense-inoculated plants. STI value was more pronounced when plants were co-inoculated with R. irregularis and M. tianshanense compared with single-inoculated plants. Plant nitrogen concentration and contents were significantly influenced by inoculation treatments and water regimes. R. irregularis inoculation significantly increased plant shoot and root phosphorus contents. AM fungus inoculation could improve Glycyrrhiza plant–rhizobium symbiosis under drought stress, thereby suggesting that tripartite symbiotic relationships were more effective for promoting plant growth and enhancing drought tolerance.

scholarly journals Shelf Life Studies of Seed Coat Formulation of Rhizobium and Arbuscular Mycorrhizal Fungus (AMF) for Pulses - A New Perspective in Biofertilizer Technology

2021 ◽  
Author(s):  
K. Kumutha ◽  
R. Parimala Devi ◽  
P. Marimuthu ◽  
R. Krishnamoorthy
Keyword(s):  
Shelf Life ◽  
Seed Coat ◽  
Mycorrhizal Fungi ◽  
Room Temperature ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Viable Count ◽  
Spore Count ◽  
One Year

Background: Arbuscular Mycorrhizal Fungi (AMF) and Rhizobium are beneficial plant partners exhibiting mutual association with crop plants. Conventional carrier based formulation has lesser population and limited shelf life. Present study was aimed to evaluate and to assess the shelf life in new formulation as well as in coated seeds under storage.Methods: Three experiments are conducted in this study. Population of Rhizobium and AM fungi spore count were assessed in newer seed coat formulation under room temperature storage. Secondly survival of these organisms on the coated seeds of blackgram and greengram were evaluated. In third experiment the coated seeds stored for different duration were evaluated for germination, growth and vigour index.Result: Rhizobial population was maintained at 1011 g-1 and AM spore load was 900-1000 spores g-1 up to one year of storage. AM spore count was also found sufficient up to 9 months of storage in coated seeds of both crops. Growth and vigour index were significantly enhanced in inoculated plants over uninoculated control. From the study, it was evident that these formulations can be stored upto one year at room temperature without any loss in viable count and can be used for seed coating.

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals Arbuscular Mycorrhizal Fungi in Agriculture

Encyclopedia ◽  
2021 ◽  
Vol 1 (4) ◽  
pp. 1132-1154
Author(s):  
Thomas I. Wilkes
Keyword(s):  
Mycorrhizal Fungi ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Soil Disturbance ◽  
Terrestrial Plants ◽  
Fungal Host ◽  
Tillage Practices ◽  
Plant Growth Promoting ◽  
Am Fungus ◽  
Growth Promoting

Arbuscular mycorrhizal (AM) fungi are biotrophic symbionts forming close relationships with an estimated 80% of terrestrial plants suitable as their host. Via an established AM fungal–host relationship, soil-bound nutrients are made available to the host plant through root cortical arbuscules as the site of exchange. At these sites, photosynthetic carbohydrates are provided to the AM fungus—carbohydrates that cannot be produced by the fungus. AM fungal–host symbiosis is very sensitive to soil disturbance, for example, agricultural tillage practices can damage and reduce AM fungal abilities to interact with a host and provide plant growth-promoting properties.

Colonisation by arbuscular mycorrhizal fungi changes the relationship between phosphorus uptake and membrane potential in leek (Allium porrum) seedlings

2001 ◽  
Vol 28 (5) ◽  
pp. 391 ◽  
Author(s):  
Sarah M. Ayling ◽  
Sally E. Smith ◽  
F. Andrew Smith
Keyword(s):  
Mycorrhizal Fungi ◽  
Phosphorus Uptake ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Uptake ◽  
Allium Porrum ◽  
Soil P ◽  
Mycorrhizal Roots ◽  
Am Fungus ◽  
The Relationship

The effect of colonisation by arbuscular mycorrhizal (AM) fungi on the relationship between phosphorus (P) uptake and root membrane electric potential difference (p.d.) was investigated in leek (Allium porrum L.). Plants were grown, with or without the AM fungus Scutellospora calospora (Nicolson and Gerdemann) Walker and Sanders, in soil. P uptake and root p.d. were correlated; plants with the highest P concentration in the shoot had the most negative p.d. This relationship was strong in non-mycorrhizal leeks (r2 = 84–98%), but weaker in mycorrhizal leeks (r2 = 55–64%), consistent with the idea that in mycorrhizal roots the fungal hyphae are the principal site of P uptake.

scholarly journals Transgenic Bt cotton inhibited arbuscular mycorrhizal fungus differentiation and colonization  

2017 ◽  
Vol 63 (No. 2) ◽  
pp. 62-69 ◽  
Author(s):  
Chen Xiuhua ◽  
Zhang Rui ◽  
Wang Fengling
Keyword(s):  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Hyphal Growth ◽  
Bt Cotton ◽  
Signal Perception ◽  
Bt Toxins ◽  
Am Fungus ◽  
The Impact ◽  
Direct Toxicity

The present study investigated the impact of transgenic Bacillus thuringiensis (Bt) cotton on several aspects of arbuscular mycorrhizal (AM) fungus Funneliformis mosseae. The results showed that Bt cotton significantly inhibited spore germination and pre-symbiotic hyphal growth. The appressorium density, arbuscule frequency and colonization intensity in Bt roots were also decreased. The statistical analysis demonstrated that the transformation event resulted in the inhibition of hyphal development and colonization. The reduced interaction between AM fungi and plants could affect nutrient uptake and transportation in plant-fungus symbiosis. The mechanism might involve the direct toxicity of Bt toxins or the interference of signal perception between AM fungus and Bt cotton.  

Sign in / Sign up

Export Citation Format

Share Document