scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

Frequent cultivation prior to planting to prevent weed competition results in an opportunity for the use of arbuscular mycorrhizal fungus inoculum

2011 ◽  
Vol 27 (4) ◽  
pp. 251-255 ◽  
Author(s):  
David D. Douds ◽  
Gerald Nagahashi ◽  
John E. Shenk
Keyword(s):  
Management Practices ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Indigenous Populations ◽  
Paspalum Notatum ◽  
Allium Porrum ◽  
Potential Yield ◽  
Greenhouse Production ◽  
Synthetic Chemicals

AbstractInoculation with arbuscular mycorrhizal (AM) fungi is a potentially useful tool in agricultural systems with limited options regarding use of synthetic chemicals for fertility and pest control. We tested the response ofAllium porrumcv. Lancelot to inoculation with AM fungi in a field high in available P (169 μg g−1soil) that had been repeatedly cultivated to control weeds. Seedlings were inoculated during the greenhouse production period with a mixed species inoculum produced on-farm in a compost and vermiculite medium withPaspalum notatumFlugge as a nurse host. Inoculated and uninoculated seedlings were the same size at outplanting. Inoculated seedlings were over 2.5-fold greater in shoot weight and shoot P content than uninoculated seedlings at harvest. These results demonstrate the potential yield benefits from inoculation with AM fungi in situations where farm management practices may negatively impact on indigenous populations of AM fungi.

scholarly journals Salmonella and Escherichia coli O157:H7 Survival in Soil and Translocation into Leeks (Allium porrum) as Influenced by an Arbuscular Mycorrhizal Fungus (Glomus intraradices)

2013 ◽  
Vol 79 (6) ◽  
pp. 1813-1820 ◽  
Author(s):  
Joshua B. Gurtler ◽  
David D. Douds ◽  
Brian P. Dirks ◽  
Jennifer J. Quinlan ◽  
April M. Nicholson ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Glomus Intraradices ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Allium Porrum ◽  
Escherichia Coli O157 ◽  
Content Type ◽  
E Coli ◽  
The Mean

ABSTRACTA study was conducted to determine the influence of arbuscular mycorrhizal (AM) fungi onSalmonellaand enterohemorrhagicEscherichia coliO157:H7 (EHEC) in autoclaved soil and translocation into leek plants. Six-week-old leek plants (with [Myc+] or without [Myc−] AM fungi) were inoculated with composite suspensions ofSalmonellaor EHEC at ca. 8.2 log CFU/plant into soil. Soil, root, and shoot samples were analyzed for pathogens on days 1, 8, 15, and 22 postinoculation. Initial populations (day 1) were ca. 3.1 and 2.1 log CFU/root, ca. 2.0 and 1.5 log CFU/shoot, and ca. 5.5 and 5.1 CFU/g of soil forSalmonellaand EHEC, respectively. Enrichments indicated that at days 8 and 22, only 31% of root samples were positive for EHEC, versus 73% positive forSalmonella. The meanSalmonellalevel in soil was 3.4 log CFU/g at day 22, while EHEC populations dropped to ≤0.75 log CFU/g by day 15. Overall,Salmonellasurvived in a greater number of shoot, root, and soil samples, compared with the survival of EHEC. EHEC was not present in Myc− shoots after day 8 (0/16 samples positive); however, EHEC persisted in higher numbers (P= 0.05) in Myc+ shoots (4/16 positive) at days 15 and 22.Salmonella, likewise, survived in statistically higher numbers of Myc+ shoot samples (8/8) at day 8, compared with survival in Myc− shoots (i.e., only 4/8). These results suggest that AM fungi may potentially enhance the survival ofE. coliO157:H7 andSalmonellain the stems of growing leek plants.

scholarly journals Response of Arbuscular Mycorrhizal Fungi to Hydrologic Gradients in the Rhizosphere ofPhragmites australis(Cav.) Trin ex. Steudel Growing in the Sun Island Wetland

2015 ◽  
Vol 2015 ◽  
pp. 1-9 ◽  
Author(s):  
Li Wang ◽  
Jieting Wu ◽  
Fang Ma ◽  
Jixian Yang ◽  
Shiyang Li ◽  
...  
Keyword(s):  
Host Plant ◽  
Mycorrhizal Fungi ◽  
Plant Biomass ◽  
Growth Parameters ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
The Sun ◽  
Vegetative Period ◽  
Hydrologic Gradients ◽  
Mycorrhizal Association

Within the rhizosphere, AM fungi are a sensitive variable to changes of botanic and environmental conditions, and they may interact with the biomass of plant and other microbes. During the vegetative period of thePhragmites australisgrowing in the Sun Island Wetland (SIW), the variations of AM fungi colonization were studied. Root samples of three hydrologic gradients generally showed AM fungi colonization, suggesting that AM fungi have the ability for adaptation to flooded habitats. There were direct and indirect hydrological related effects with respect to AM fungi biomass, which interacted simultaneously in the rhizosphere. Though water content in soil and reed growth parameters were both positively associated with AM fungi colonization, only the positive correlations between reed biomass parameters and the colonization could be expected, or both the host plant biomass and the AM fungi could be beneficial. The variations in response of host plant to the edaphic and hydrologic conditions may influence the effectiveness of the plant-mycorrhizal association. This study included a hydrologic component to better assess the role and distribution of AM fungi in wetland ecosystems. And because of that, the range of AM fungi was extended, since they actually showed a notable adaptability to hydrologic gradients.

scholarly journals Shelf Life Studies of Seed Coat Formulation of Rhizobium and Arbuscular Mycorrhizal Fungus (AMF) for Pulses - A New Perspective in Biofertilizer Technology

2021 ◽  
Author(s):  
K. Kumutha ◽  
R. Parimala Devi ◽  
P. Marimuthu ◽  
R. Krishnamoorthy
Keyword(s):  
Shelf Life ◽  
Seed Coat ◽  
Mycorrhizal Fungi ◽  
Room Temperature ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Viable Count ◽  
Spore Count ◽  
One Year

Background: Arbuscular Mycorrhizal Fungi (AMF) and Rhizobium are beneficial plant partners exhibiting mutual association with crop plants. Conventional carrier based formulation has lesser population and limited shelf life. Present study was aimed to evaluate and to assess the shelf life in new formulation as well as in coated seeds under storage.Methods: Three experiments are conducted in this study. Population of Rhizobium and AM fungi spore count were assessed in newer seed coat formulation under room temperature storage. Secondly survival of these organisms on the coated seeds of blackgram and greengram were evaluated. In third experiment the coated seeds stored for different duration were evaluated for germination, growth and vigour index.Result: Rhizobial population was maintained at 1011 g-1 and AM spore load was 900-1000 spores g-1 up to one year of storage. AM spore count was also found sufficient up to 9 months of storage in coated seeds of both crops. Growth and vigour index were significantly enhanced in inoculated plants over uninoculated control. From the study, it was evident that these formulations can be stored upto one year at room temperature without any loss in viable count and can be used for seed coating.

scholarly journals Response of the Leek (Allium porrum)-Mycorrhizal Fungus Symbiosis to Cutting Levels, Light Exposure and Seedling Density

2021 ◽  
Vol 2 (3) ◽  
pp. 1-6
Author(s):  
G. Nowo Nekou ◽  
A.-M. Sontsa-Donhoung ◽  
. Hawaou ◽  
M. Bahdjolbe ◽  
R. Tobolbaï ◽  
...  
Keyword(s):  
Mycorrhizal Fungi ◽  
Light Exposure ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
The Other ◽  
Allium Porrum ◽  
Seedling Density ◽  
Positive Effects ◽  
Other Hand ◽  
The Impact

This work aims to assess the leek-arbuscular fungus symbiosis response to the effect of cutting and light exposure on the one hand, and the impact of seedling density on this symbiosis on the other hand. Allium Porrum was grown in a container in two different trials. Four species of arbuscular mycorrhizal fungi, Glomus hoi, Scutellospora gregaria, Rhizophagus intraradices and Gigaspora margarita were used to constitute the mycorrhizal inoculum. After 150 days of growth and inoculation, a series of cuts were made on the aerial part (0% = zero cut, 50% = half cut, 100% = whole cut). Plants that had undergone these treatments were placed in shade and sun for 30 days. The leek density per bag was varied by the order of 1, 2, 3 and 4 plant (s) by the pocket density test. Results showed that for 0% of cut in the shade, the vesicle occurrence decreases from 83.33% to 52.22%, and from 90% to 25.5% for 50% of cut in the shade. On the other hand, there is a significant increase in intra-root spores for a complete cut compared to other levels of cuts. For extra-root sporulation, under light, cuts have a negative and weak effect (from -11 to -3%) while in the absence of light, cuts have significant positive effects (from +16 to +61%). Regarding seedling density, the best root colonization (90%) and biomass production (14 g) are obtained with three plants per pot, but it is rather with a density of two plants per pot that extra-root sporulation is higher (153 spores/g). Variation in light, cut level and density significantly affects the development of mycorrhizal fungi.

Colonisation by arbuscular mycorrhizal fungi changes the relationship between phosphorus uptake and membrane potential in leek (Allium porrum) seedlings

2001 ◽  
Vol 28 (5) ◽  
pp. 391 ◽  
Author(s):  
Sarah M. Ayling ◽  
Sally E. Smith ◽  
F. Andrew Smith
Keyword(s):  
Mycorrhizal Fungi ◽  
Phosphorus Uptake ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Uptake ◽  
Allium Porrum ◽  
Soil P ◽  
Mycorrhizal Roots ◽  
Am Fungus ◽  
The Relationship

The effect of colonisation by arbuscular mycorrhizal (AM) fungi on the relationship between phosphorus (P) uptake and root membrane electric potential difference (p.d.) was investigated in leek (Allium porrum L.). Plants were grown, with or without the AM fungus Scutellospora calospora (Nicolson and Gerdemann) Walker and Sanders, in soil. P uptake and root p.d. were correlated; plants with the highest P concentration in the shoot had the most negative p.d. This relationship was strong in non-mycorrhizal leeks (r2 = 84–98%), but weaker in mycorrhizal leeks (r2 = 55–64%), consistent with the idea that in mycorrhizal roots the fungal hyphae are the principal site of P uptake.

Regulatory mechanisms during the plant – arbuscular mycorrhizal fungus interaction

2004 ◽  
Vol 82 (8) ◽  
pp. 1166-1176 ◽  
Author(s):  
Horst Vierheilig
Keyword(s):  
Mycorrhizal Fungi ◽  
Root Colonization ◽  
Arbuscular Mycorrhizal Fungus ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Physical Contact ◽  
Mycorrhizal Symbiosis ◽  
Plant Responses ◽  
Regulatory Processes ◽  
Mycorrhizal Association

Abundant data are available on some aspects of the arbuscular mycorrhizal symbiosis, for example, plant nutrition, but because of difficulties immanent to arbuscular mycorrhizal fungi, such as the inability to culture them axenically, the relatively long time it takes to achieve root colonization, and the simultaneous presence of different morphologic stages of the fungus in the root, less information is accumulated on other aspects such as the regulation of mycorrhization. Regulatory processes in the plant – arbuscular mycorrhizal fungus interaction start before root colonization by the fungus and even before a direct physical contact between the host and the fungal symbiont. Some of the signals exchanged are still a matter of debate and will be discussed further on. After the penetration of the root by the fungus, depending on the developmental stage of the arbuscular mycorrhizal association (e.g., early or mature), a range of plant responses is activated. The possible function of several plant responses in the regulation of mycorrhization is discussed.Key words: arbuscular mycorrhiza, Glomales, autoregulation, flavonoid, recognition, root exudates.

scholarly journals A Phosphate Transporter Gene from the Extra-Radical Mycelium of an Arbuscular Mycorrhizal Fungus Glomus intraradices Is Regulated in Response to Phosphate in the Environment

2001 ◽  
Vol 14 (10) ◽  
pp. 1140-1148 ◽  
Author(s):  
Ignacio E. Maldonado-Mendoza ◽  
Gary R. Dewbre ◽  
Maria J. Harrison
Keyword(s):  
Mycorrhizal Fungi ◽  
Glomus Intraradices ◽  
Arbuscular Mycorrhizal Fungus ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Arbuscular Mycorrhizas ◽  
Phosphate Transporter ◽  
Transporter Gene ◽  
Symbiotic Associations ◽  
Mycorrhizal Association

The majority of vascular flowering plants are able to form symbiotic associations with arbuscular mycorrhizal fungi. These symbioses, termed arbuscular mycorrhizas, are mutually beneficial, and the fungus delivers phosphate to the plant while receiving carbon. In these symbioses, phosphate uptake by the arbuscular mycorrhizal fungus is the first step in the process of phosphate transport to the plant. Previously, we cloned a phosphate transporter gene involved in this process. Here, we analyze the expression and regulation of a phosphate transporter gene (GiPT) in the extra-radical mycelium of the arbuscular mycorrhizal fungus Glomus intraradices during mycorrhizal association with carrot or Medicago truncatula roots. These analyses reveal that GiPT expression is regulated in response to phosphate concentrations in the environment surrounding the extra-radical hyphae and modulated by the overall phosphate status of the mycorrhiza. Phosphate concentrations, typical of those found in the soil solution, result in expression of GiPT. These data imply that G. intraradices can perceive phosphate levels in the external environment but also suggest the presence of an internal phosphate sensing mechanism.

scholarly journals Glomus intraradices and Funneliformis mosseae am Strains Influence on Soil Physical, Biological and Chemical Characteristics in Tea Plantations in Kenya

2021 ◽  
pp. 13-18
Author(s):  
Awa Chelangat ◽  
Joseph P Gweyi-Onyango ◽  
Nicholas K Korir ◽  
Maina Mwangi
Keyword(s):  
Mycorrhizal Fungi ◽  
Glomus Intraradices ◽  
Block Design ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Climatic Conditions ◽  
Soil Microbiology ◽  
Funneliformis Mosseae ◽  
Wide Range ◽  
Tea Production

Arbuscular mycorrhizal (AM) fungi occur over a wide range of agro climatic conditions and are geographically ubiquitous. Arbuscular mycorrhizal fungi are the medium of soil structure, they determine the flow of water, nutrients, and air, directs the pathways of root growth, and opens channels for the movement of soil animals. As the moderator of the microbial community, they also determine the metabolic processes of the soil. In other words, the mycorrhizal network is practically synonymous with ecosystem function. The tremendous advances in research on mycorrhizal physiology and ecology over the past 40 years have led to a greater understanding of the multiple roles of AMF in the ecosystem. The current study was informed due to the depletion of nutrients and poor soil microbiology in tea production whose production has declined in the recent years. The trial was conducted in the research and development greenhouse at the James Finlays Farm in Kericho County, Kenya. The experiment was laid out in a Randomized Complete Block Design (RCBD) with factorial arrangements of tea clones and mycorrhizae levels. The phosphorus treatments consisted of a standard rate of 107.66kg ha -1, two clones of the tea (S15/10 and SC 12/28) and two mycorrhizal strains (Funneliformis mosseae and Glomus intraradices) at two rates (50 kg ha-1 and 70 kg ha-1) and an untreated control without mycorrhizae. The soil pH was positively influenced by reducing the acidity content significantly where mycorrhizae strains were introduced with the highest unit change (1.3) was recorded on clone SC 12/28 at the 50 kg Mycorrhizae ha-1 rate. The same treatment also significantly increased the soil total phosphorus level (2.3 g/kg) compared to all other treatments with the least change observed on the control. Application of AMF strains Glomus intraradices and Funneliformis mosseae is recommended in tea production at the rate of 50 kg ha-1 which improves and enhances the general positive characteristics of soil health.

Microkamienskia gen. nov. and Microkamienskia peruviana, a new arbuscular mycorrhizal fungus from Western Amazonia

Nova Hedwigia ◽  
2019 ◽  
Vol 109 (3) ◽  
pp. 355-368 ◽  
Author(s):  
Mike Anderson Corazon-Guivin ◽  
Agustin Cerna-Mendoza ◽  
Juan Carlos Guerrero-Abad ◽  
Adela Vallejos-Tapullima ◽  
Santos Carballar-Hernández ◽  
...  
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Single Species ◽  
Spore Wall ◽  
Wall Layer ◽  
Am Fungus ◽  
Small Spore ◽  
Plukenetia Volubilis

A new arbuscular mycorrhizal (AM) fungus, Microkamienskia peruviana, was detected in bait cultures for arbuscular mycorrhizal fungi established with rhizospheric soil substrates of the inka nut (Plukenetia volubilis). The field soil derived from three agricultural plantations in the Amazonia lowlands of the province Lamas, San Martin State, in Peru. The fungus was subsequently propagated in single species cultures on Sorghum sp., Brachiaria sp.,Medicago sativa and P. volubilis as host plants. The new species differentiates hyaline spores regularly in spore clusters, up to 500–800×400–600 μm. The spores are 16–31(–36)×13–29(–35) μm in diam, formed on cylindrical or slightly funnel-shaped hyphae, without a septum at or close to the spore base. Phylogenetically, the new fungus belongs to a new genus, named Microkamienskia, which has as type species M. perpusilla comb. nov. and to which also M. divaricata comb. nov. belongs. Both are transferred from Kamienskia to Microkamienskia in the present study. The new fungus can be identified by the ballooning semi-persistent to evanescent outer spore wall layer in PVLG-based mountants that is not known for the other species of these two genera, nor for any other glomeromycotan species of similar small spore sizes. Kamienskia and Microkamienskia species can be distinguished by their position in the phylogenetic tree and by hyaline spores, open pores at the spore bases and in the subtending hyphae, and by their spore sizes that are for Microkamienskia among the smallest spore sizes so far detected for AM fungi (15–35 μm).

Sign in / Sign up

Export Citation Format

Share Document