Colonisation by arbuscular mycorrhizal fungi changes the relationship between phosphorus uptake and membrane potential in leek (Allium porrum) seedlings

2001 ◽  
Vol 28 (5) ◽  
pp. 391 ◽  
Author(s):  
Sarah M. Ayling ◽  
Sally E. Smith ◽  
F. Andrew Smith
Keyword(s):  
Mycorrhizal Fungi ◽  
Phosphorus Uptake ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Uptake ◽  
Allium Porrum ◽  
Soil P ◽  
Mycorrhizal Roots ◽  
Am Fungus ◽  
The Relationship

The effect of colonisation by arbuscular mycorrhizal (AM) fungi on the relationship between phosphorus (P) uptake and root membrane electric potential difference (p.d.) was investigated in leek (Allium porrum L.). Plants were grown, with or without the AM fungus Scutellospora calospora (Nicolson and Gerdemann) Walker and Sanders, in soil. P uptake and root p.d. were correlated; plants with the highest P concentration in the shoot had the most negative p.d. This relationship was strong in non-mycorrhizal leeks (r2 = 84–98%), but weaker in mycorrhizal leeks (r2 = 55–64%), consistent with the idea that in mycorrhizal roots the fungal hyphae are the principal site of P uptake.

Influence of arbuscular mycorrhizae on soil P dynamics, corn P-nutrition and growth in a ridge-tilled commercial field

2008 ◽  
Vol 88 (3) ◽  
pp. 283-294 ◽  
Author(s):  
Christine P Landry ◽  
Chantal Hamel ◽  
Anne Vanasse
Keyword(s):  
Arbuscular Mycorrhizae ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Dry Mass ◽  
Soil Disturbance ◽  
P Uptake ◽  
P Nutrition ◽  
Soil P ◽  
High Yields ◽  
Ridge Tillage

Ridge-tilled corn (Zea mays L.) could benefit from arbuscular mycorrhizal (AM) fungi. Under low soil disturbance, AM hyphal networks are preserved and can contribute to corn nutrition. A 2-yr study was conducted in the St. Lawrence Lowlands (Quebec, Canada) to test the effects of indigenous AM fungi on corn P nutrition, growth, and soil P in field cropped for 8 yr under ridge-tillage. Phosphorus treatments (0, 17, 35 kg P ha-1) were applied to AM-inhibited (AMI) (fungicide treated) and AM non-inhibited (AMNI) plots. Plant tissue and soil were sampled 22, 48 and 72 days after seeding (DAS). P dynamics was monitored in situ with anionic exchange membranes (PAEM) from seeding to the end of July. AMNI plants showed extensive AM colonization at all P rates. At 22 DAS, AMI plants had decreased growth in the absence of P inputs, while AMNI plants had higher dry mass (DM) and P uptake in unfertilized plots. The PAEM was lower in the AMNI unfertilized soils in 1998 and at all P rates in 1999, indicating an inverse relationship between P uptake and PAEM. At harvest, grain P content of AMNI plants was greater than that of AMI plants. In 1998, only AMI plants had decreased yield in the absence of P fertilization. In 1999, AMNI plants produced greater grain yield than AMI plants at all P rates. AM fungi improve the exploitation of soil P by corn thereby maintaining high yields while reducing crop reliance on P inputs in RT. Key words: Arbuscular mycorrhizae, ridge-tillage, soil P dynamics, corn, P nutrition

Soil phosphorus depletion capacity of arbuscular mycorrhizae formed by maize hybrids

2003 ◽  
Vol 83 (4) ◽  
pp. 337-342 ◽  
Author(s):  
A. Liu ◽  
C. Hamel ◽  
S. H. Begna ◽  
B. L. Ma ◽  
D. L. Smith
Keyword(s):  
Plant Biomass ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Uptake ◽  
Maize Hybrids ◽  
Soil P ◽  
Extractable P ◽  
P Content ◽  
Total P ◽  
Extractable Soil

The ability of arbuscular mycorrhizal (AM) fungi to help their host plant absorb soil P is well known, but little attention has been paid to the effect of AM fungi on soil P depletion capacity. A greenhouse experiment was conducted to assess, under different P levels, the effects of mycorrhizae on extractable soil P and P uptake by maize hybrids with contrasting phenotypes. The experiment had three factors, including two mycorrhizal treatments (mycorrhizal and non-mycorrhizal), three P fertilizer rates (0, 40, and 80 mg kg-1) and three maize hybrids [leafy normal stature (LNS), leafy reduced stature (LRS) and a conventional hybrid, Pioneer 3979 (P3979)]. Extractable soil P was determined after 3, 6 and 9 wk of maize growth. Plant biomass, P concentration and total P content were also determined after 9 wk of growth. Fertilization increased soil extractable P, plant biomass, P concentration in plants and total P uptake. In contrast to P3979, the LNS and LRS hybrids had higher biomass and total P content when mycorrhizal. Mycorrhizae had less influence on soil extractable P than on total P uptake by plants. The absence of P fertilization increased the importance of AM fungi for P uptake, which markedly reduced soil extractable P under AM plants during growth. This effect was strongest for LNS, the most mycorrhizae-dependent hybrid, intermediate for LRS, and not significant for the commercial hybrid P3979, which did not respond to AM inoculation. Key words: Arbuscular mycorrhizal fungi, extraradical hyphae, maize hybrid,plant biomass, P uptake, soil extractable P

scholarly journals Stable C and N isotope natural abundances of intraradical hyphae of arbuscular mycorrhizal fungi

Mycorrhiza ◽  
2020 ◽  
Vol 30 (6) ◽  
pp. 773-780
Author(s):  
Saskia Klink ◽  
Philipp Giesemann ◽  
Timo Hubmann ◽  
Johanna Pausch
Keyword(s):  
Mycorrhizal Fungi ◽  
Isotope Composition ◽  
Fungal Spores ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Mineral Nutrient ◽  
Carbohydrate Source ◽  
Lipid Source ◽  
Am Fungus ◽  
C And N

Abstract Data for stable C and N isotope natural abundances of arbuscular mycorrhizal (AM) fungi are currently sparse, as fungal material is difficult to access for analysis. So far, isotope analyses have been limited to lipid compounds associated with fungal membranes or storage structures (biomarkers), fungal spores and soil hyphae. However, it remains unclear whether any of these components are an ideal substitute for intraradical AM hyphae as the functional nutrient trading organ. Thus, we isolated intraradical hyphae of the AM fungus Rhizophagus irregularis from roots of the grass Festuca ovina and the legume Medicago sativa via an enzymatic and a mechanical approach. In addition, extraradical hyphae were isolated from a sand-soil mix associated with each plant. All three approaches revealed comparable isotope signatures of R. irregularis hyphae. The hyphae were 13C- and 15N-enriched relative to leaves and roots irrespective of the plant partner, while they were enriched only in 15N compared with soil. The 13C enrichment of AM hyphae implies a plant carbohydrate source, whereby the enrichment was likely reduced by an additional plant lipid source. The 15N enrichment indicates the potential of AM fungi to gain nitrogen from an organic source. Our isotope signatures of the investigated AM fungus support recent findings for mycoheterotrophic plants which are suggested to mirror the associated AM fungi isotope composition. Stable isotope natural abundances of intraradical AM hyphae as the functional trading organ for bi-directional carbon-for-mineral nutrient exchanges complement data on spores and membrane biomarkers.

Vesicular-Arbuscular Mycorrhiza and Phosphorus Uptake of Chickpea Grown in Northern Syria

1992 ◽  
Vol 28 (4) ◽  
pp. 433-442 ◽  
Author(s):  
Edwin Weber ◽  
Eckhard George ◽  
Douglas P. Beck ◽  
Mohan C. Saxena ◽  
Horst Marschner
Keyword(s):  
Mycorrhizal Fungi ◽  
Field Experiments ◽  
Phosphorus Uptake ◽  
Arbuscular Mycorrhizal ◽  
P Uptake ◽  
Mycorrhizal Infection ◽  
P Fertilization ◽  
Flowering Stage ◽  
P Concentration ◽  
Vesicular Arbuscular

SUMMARYInoculation with vesicular-arbuscular mycorrhizal fungi (VAMF) improved growth of chick-pea (Cicer arielinum L.) and doubled phosphorus (P) uptake at low and intermediate levels of P fertilization in a pot experiment on sterilized low-P calcareous soil. In field experiments at Tel Hadya, northern Syria, growth, shoot P concentration and seed yield of spring-sown chickpea remained unaffected by inoculation with VAMF or by P fertilization. The mycorrhizal infection of chickpea was high (approximately 75% of root length mycorrhizal at the flowering stage) irrespective of inoculation with VAMF or P fertilization and may ensure efficient P uptake under field conditions.

Concentrations of K, Ca and Mg in maize colonized by arbuscular mycorrhizal fungi under field conditions

2002 ◽  
Vol 82 (3) ◽  
pp. 272-278 ◽  
Author(s):  
A. Liu ◽  
C. Hamel ◽  
A. Elmi ◽  
C. Costa ◽  
B. Ma ◽  
...  
Keyword(s):  
Arbuscular Mycorrhizal Fungi ◽  
Mycorrhizal Fungi ◽  
Sandy Loam ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Dry Weight ◽  
Soil Fumigation ◽  
Soil P ◽  
Shoot Dry Weight ◽  
Loamy Sand Soil

Little attention has been paid to the effect of arbuscular mycorrhizal (AM) fungi on the uptake of nutrients that move mainly by mass flow. The objective of this study was to assess the possible contribution of indigenous AM fungi to the K, Ca and Mg nutrition of maize (Zea mays L.) as influenced by soil P levels and its impact on plant dry mass. The field experiment had a split plot design with four replicates. Treatments included soil fumigation status (fumigation and non-fumigation) and three levels of P fertilization (0, 60 and 120 kg P2O5 ha-1) in a loamy sand soil in 1997 and a fine sandy loam soil in 1998. Soil fumigati on with Basamid® was used to suppress indigenous AM fungi. Plants were sampled at four different growth stages (6-leaf stage, 10-leaf stage, tasseling and silking). Soil fumigation decreased shoot dry weight, but P fertilization increased shoot dry weight at most sampling times. When no P fertilizer was added, fumigation in the loamy sand soil reduced shoot K and Ca concentrations while, in contrast, in the fine sandy loam soil only Mg concentration was reduced by soil fumigation. The concentration of K in maize shoots was positively correlated (P < 0.05) with extraradicular hyphal length in both soils. The correlation between the abundance of extraradicular hyphae and the concentrations of Ca and Mg in maize shoots was significant only for soils where available Ca or Mg was relatively low. Arbuscular mycorrhizal fungi could increase corn biomass production and K, Ca and Mg uptake in soil low in these elements and low in P. These results indicate that the contribution of mycorrhizae to maize K, Ca and Mg nutrition can be significant in a field situation and that the extent of this contribution depends on the availability of these nutrients and of P in soils. Key words: Arbuscular mycorrhizal fungi, soil fumigation, extraradicular hyphae, uptake of K, Ca, and Mg, soil P levels, maize

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals Optimasi simbiosis cendawan mikoriza arbuskula Acaulospora tuberculata dan Gigaspora margarita pada bibit kelapa sawit di tanah masam Optimizing arbuscular mycorrhizal fungi symbiosis Acaulospora tuberculata and Gigaspora margarita with oil palm seedling in acid soil)

2016 ◽  
Vol 70 (2) ◽  
Author(s):  
Happy WIDIASTUTI ◽  
Edi GUHARDJA ◽  
Nampiah SOEKARNO ◽  
L K DARUSMAN ◽  
Didiek Hadjar GOENADI ◽  
...  
Keyword(s):  
Oil Palm ◽  
Mycorrhizal Fungi ◽  
Acid Soil ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Uptake ◽  
Fungal Species ◽  
Gigaspora Margarita ◽  
Fertilizer Rate ◽  
Fungal Symbiosis

SummaryAM fungal symbiosis increase the uptake of P in oil palm seedlings. However the optimum condition of symbiosis has to be determined to get higher benefit of AM fungal symbiosis. Optimization of the symbiosis Acaulospora tuberculata and Gigaspora margarita with oil palm seedling in acid soil was determined. An experiment was conducted in polybag sized 40 x 60 cm contained sterilized Cikopomayak soil. Three factors studied were AM fungal species (A. tuberculata, G. margarita), inoculant dose (0.0; 12.5; 25.0; and 37.5% w/w), and fertilizer rate (0; 25; 50; and 100% recommended dose) and each treatment replicated three times. The result showed that optimum growth reached on the inoculant addition of 36% (w/w) in the form of infected roots, hypha, and spores and fertilizer dose of 25% for A. tuberculata, while for G. margarita was 40% (w/w) inoculant and 26% fertilizer. Efectivity of fertilizer and P uptake of oil palm seedling were significantly increased with AM fungi inoculation. P uptake of oil palm seedling inoculated with A. tuberculata increase. RingkasanSimbiosis cendawan mikoriza arbuskula (CMA) dapat meningkatkan serapan P pada pembibitan kelapa sawit. Namun, untuk mendapatkan keuntungan simbiosis yang tinggi perlu diketahui kondisi optimum simbiosis. Simbiosis CMA dengan tanaman sangat dipengaruhi tingkat hara dan dosis inokulum. Percobaan dilakukan dalam polibag berukuran 40 x 60 cm berisi tanah Cikopomayak steril. Tiga faktor yang diuji ialah spesies CMA (A. tuberculata, G. margarita), dosis inokulum campuran (0,0; 12,5; 25,0; dan 37,5% b/b), dosis pupuk (0; 25; 50; dan 100% dosis rekomendasi) dan masing masing perlakuan diulang tiga kali. Hasil percobaan menunjukkan bahwa pertumbuhan optimum dicapai pada pemberian inokulum berupa akar terinfeksi, hifa, dan spora 36% (b/b) dan pupuk 25% untuk A. tuberculata, sedangkan untuk G. margarita ialah 40% (b/b) inokulum dan pupuk 26%. Keefektifan pupuk dan serapan P meningkat secara nyata dengan inokulasi CMA

scholarly journals Effect of Arbuscular Mycorrhizal Colonization on Nitrogen and Phosphorus Uptake and Growth of Aloe vera L.

HortScience ◽  
2007 ◽  
Vol 42 (7) ◽  
pp. 1737-1739 ◽  
Author(s):  
Keitaro Tawaraya ◽  
Maman Turjaman ◽  
Hanna Artuti Ekamawanti
Keyword(s):  
Shoot Growth ◽  
Phosphorus Uptake ◽  
Aloe Vera ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
P Uptake ◽  
Fresh Weight ◽  
Nitrogen And Phosphorus ◽  
Number Of Leaves ◽  
Nitrogen And Phosphorus Uptake

The effect of arbuscular mycorrhizal (AM) colonization on nitrogen (N) and phosphorus (P) uptake and shoot growth of Aloe vera was investigated. Plants were inoculated with one of two AM fungi, Glomus clarum or Gigaspora decipiens. Control plants were not inoculated. Plants were grown under glasshouse conditions in a peat land soil without fertilizers for 12 months. Inoculated A. vera plants were colonized with AM fungi. Total length of leaves and number of leaves were higher in inoculated plants than uninoculated plants 12 months after inoculation. Shoot N and P concentrations were higher in inoculated plants than uninoculated plants. Shoot fresh weight was increased by AM colonization. This result suggests that AM colonization can increase the nutrient uptake and growth of A. vera.

Effect of phosphate solubilizing bacteria and arbuscular mycorrhizal fungi with and without rock phosphate on four forest tree seedlings

2016 ◽  
Vol 6 (01) ◽  
pp. 5204 ◽  
Author(s):  
Sharanappa Jangandi ◽  
Chaitra B. Negalur* ◽  
Mr. Narayan ◽  
H. C. Lakshman
Keyword(s):  
Plant Growth ◽  
Mycorrhizal Fungi ◽  
Rock Phosphate ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Forest Tree ◽  
P Uptake ◽  
Tree Seedlings ◽  
Phosphate Solubilizing Bacteria ◽  
Vigorous Plant

The effect of phosphorus solubilizing bacteria Bacillus polymyxa and AM-mycorrhizal fungi Rhizophagus fasciculatus with and without rock phosphate treatments on growth of Terminalia paniculata and T. tomentosa were studied in nursery. The results showed that the combined inoculation of both PSB, AM fungi and rock phosphate produced vigorous plant growth of tree seedlings for quick planting. The experiments clearly demonstrated that the combined inoculation of PSB and AM fungi brought marked increase in plant growth, dry matter, and P uptake when, compared to individual inoculants or non-inoculated plants. The increase in growth was attributed to the increase in P uptake in shoots of the seedlings. The results indicated that both organisms have synergistic effect with additional 250 mg RP/kg rock phosphate treatment for T.paniculata Roth. and 150 mgRP/kg for T.tomentosa W.& A. in green house conditions.

scholarly journals Arbuscular mycorrhizal enhancement of phosphorus uptake and yields of maize under high planting density in the black soil region of China

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Liyuan Hou ◽  
Xiaofei Zhang ◽  
Gu Feng ◽  
Zheng Li ◽  
Yubin Zhang ◽  
...  
Keyword(s):  
Soil Depth ◽  
Phosphorus Uptake ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Experimental Period ◽  
Planting Density ◽  
High Yield ◽  
Hyphal Length ◽  
Soil P ◽  
High Yields

AbstractArbuscular mycorrhizal (AM) symbioses are an attractive means of improving the efficiency of soil phosphorus (P) that difficult to be used by plants and may provide a sustainable way of maintaining high yields while reducing P applications. However, quantifying the contribution of indigenous AM fungi on phosphorus uptake and yields of maize (Zea mays L.) under field conditions is not particularly clear. Mesh-barrier compartments were applied to monitor the distribution of hyphal P uptake throughout the experimental period under different planting densities and soil depths, over two consecutive years. AM symbioses enhanced plant P-acquisition efficiency, especially during the silking stage, and hyphae of AM fungi was assessed to contribution 19.4% at most to total available P content of soil. Moreover, the pattern of AM depletion of soil P generally matched shoot nutrient demand under the high planting density, which resulted in significantly increased yield in 2014. Although the hyphal length density was significantly decreased with soil depth, AM fungi still had high potential for P supply in deeper soil. It demonstrates the great potential of indigenous AM fungi to maize productivity in the high-yield area of China, and it would further provide the possibility of elimination P fertilizer applications to maintain high yields.

Sign in / Sign up

Export Citation Format

Share Document