scholarly journals First Report ofClostridium lavalenseIsolated in Human Blood Cultures

2016 ◽  
Vol 2016 ◽  
pp. 1-3
Author(s):  
Richard Garceau ◽  
Christine Bourque ◽  
Louise Thibault ◽  
Jean-Charles Côté ◽  
Jean Longtin ◽  
...  
Keyword(s):  
Human Blood ◽  
Gene Sequence ◽  
Blood Cultures ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Oral Amoxicillin ◽  
Diagnostic Samples ◽  
Human Blood Cultures

An 88-year-old man was admitted to the hospital with worsening malaise, fever, and weakness. Anaerobic blood culture bottles revealed the presence of an anaerobic, Gram-positive sporulated bacillus. Empirical antibiotherapy with intravenous piperacillin-tazobactam was initiated. The patient defervesced after four days and was switched to oral amoxicillin on his 6th day of antibiotic therapy and later discharged from the hospital. Four months later, he had recovered. The bacterium was initially identified asClostridium butyricumusing anaerobic manual identification panel. 16S rRNA gene sequence and phylogenetic analysis showed the bacterium to beClostridium lavalense, a recently described species with no previously published case of isolation in human diagnostic samples so far. This is the first report ofClostridium lavalenseisolation from human blood cultures. Further studies are needed in order to elucidate the role ofClostridium lavalensein human disease and its virulence factors.

scholarly journals Pannonibacter phragmitetus, described from a Hungarian soda lake in 2003, had been recognized several decades earlier from human blood cultures as Achromobacter groups B and E

2006 ◽  
Vol 56 (12) ◽  
pp. 2945-2948 ◽  
Author(s):  
Barry Holmes ◽  
Paul Segers ◽  
Tom Coenye ◽  
Marc Vancanneyt ◽  
Peter Vandamme
Keyword(s):  
Human Blood ◽  
Dna Hybridization ◽  
Gene Sequence ◽  
Soda Lake ◽  
Single Species ◽  
Blood Cultures ◽  
Rrna Gene ◽  
Gene Sequence Analysis ◽  
The Uk ◽  
Human Blood Cultures

We performed a polyphasic taxonomic study on isolates previously tentatively classified as Achromobacter groups B and E in comparison with the type strain of Pannonibacter phragmitetus, LMG 22736T=NCTC 13350T. Comparative 16S rRNA gene sequence analysis suggested that strains of Achromobacter groups B and E belong to P. phragmitetus (similarity levels were higher than 99 %). DNA–DNA hybridization experiments and other genotypic and phenotypic analyses confirmed that the three taxa represent a single species. Whilst P. phragmitetus was described in 2003 from a Hungarian soda lake, it had been observed in human blood cultures in the UK since 1975. We present here the characteristics of the organism to facilitate its recognition in human clinical specimens and hence to determine its clinical significance.

scholarly journals Paenibacillus massiliensis sp. nov., Paenibacillus sanguinis sp. nov. and Paenibacillus timonensis sp. nov., isolated from blood cultures

2004 ◽  
Vol 54 (4) ◽  
pp. 1049-1054 ◽  
Author(s):  
Véronique Roux ◽  
Didier Raoult
Keyword(s):  
Gene Sequence ◽  
Sequence Similarity ◽  
Phylogenetic Analyses ◽  
Major Fatty Acid ◽  
Blood Cultures ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Phenotypic Characteristics ◽  
Phenotypic Data ◽  
Type Strains

Gram-positive, spore-forming rods were isolated from blood cultures of three different patients. Based on phylogenetic analyses, these strains were placed within the Paenibacillus cluster and specific phenotypic characteristics for each strain were described. Levels of 16S rRNA gene sequence similarity between existing Paenibacillus species and the three novel strains 2301065T, 2301032T and 2301083T were 87·6–94·4, 88·5–95·4 and 87·5–96·0 %, respectively, and anteiso-branched C15 : 0 was the major fatty acid. On the basis of phenotypic data and phylogenetic inference, it is proposed that these strains should be designated Paenibacillus massiliensis sp. nov., Paenibacillus sanguinis sp. nov. and Paenibacillus timonensis sp. nov. The type strains are respectively strain 2301065T (=CIP 107939T=CCUG 48215T), strain 2301083T (=CIP 107938T=CCUG 48214T) and strain 2301032T (=CIP 108005T=CCUG 48216T).

Role of ascorbic acid on mercuric chloride-induced genotoxicity in human blood cultures

2001 ◽  
Vol 15 (6) ◽  
pp. 649-654 ◽  
Author(s):  
M.V Rao ◽  
N.J Chinoy ◽  
M.B Suthar ◽  
M.I Rajvanshi
Keyword(s):  
Ascorbic Acid ◽  
Human Blood ◽  
Mercuric Chloride ◽  
Blood Cultures ◽  
Human Blood Cultures

scholarly journals Radioprotective role of α-tocotrienol against oxidative damage in γ-irradiated human blood cultures

2018 ◽  
pp. 1000-1009 ◽  
Author(s):  
Mahmoud Mohamed Ahmed ◽  
Sherien Abdelwahab Montaser ◽  
Manal Ramadan Mohamed ◽  
Zeinab Salem Said
Keyword(s):  
Oxidative Damage ◽  
Human Blood ◽  
Blood Cultures ◽  
Human Blood Cultures

scholarly journals First Report of a Natural Infection of Stevia rebaudiana by a Group 16SrXXIV Phytoplasma in India

Plant Disease ◽  
2011 ◽  
Vol 95 (12) ◽  
pp. 1582-1582 ◽  
Author(s):  
A. Samad ◽  
S. Dharni ◽  
M. Singh ◽  
S. Yadav ◽  
A. Khan ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Sequence ◽  
Natural Infection ◽  
Stevia Rebaudiana ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Wide Range

Stevia rebaudiana Bertoni (Asteraceae) is one of the most important commercial crops in the world (4). It is known to produce glycosides that are as much as 300 times sweeter than sucrose and do not affect blood sugar levels. Unlike artificial sweeteners like saccharin, they are noncarcinogenic and safe for diabetics. An unknown disease emerged during the summers of 2007 to 2009 in a field of S. rebaudiana at CIMAP Lucknow, India, where more than 20% of the plants exhibited symptoms typical of phytoplasma infection including leaf yellowing, reduced size of leaves, shoot proliferation, flower bud deficiency, as well as bushy and stunted growth. Some of these plants were potted and kept in a glasshouse for investigation. Affected plants in the field expressed a quick decline consisting of growth cessation, bronzing of mature leaves, wilting, and death, resulting in a significant reduction in biomass and quality. Typical phytoplasma-like (pleomorphic) bodies ranging from 450 to 900 nm were observed in the phloem cells of infected plants by transmission electron microscopy (1). These bodies were always found in diseased plants, but not in asymptomatic ones. No other microorganisms were noted. Total DNA was extracted from symptomatic as well as asymptomatic plants by a CTAB method. PCR was carried out with the universal phytoplasma primers P1/P6 (P1, 5′-AAGAGTTTGATCCTGGCTCAGGATT-3′; P6, 5′-CGGTAGGGATACCTTGTTACGACTTA-3′) (2) followed by nested primers R16F2n/R16R2 (R16F2n, 5′-GAAACGACTGCTAAGACTGG-3′; R16R2, 5′-TGACGGGCGGTGTGTACAAACCCCG-3′) targeting the 16S rRNA gene sequence (3). The P1/P6 and R16F2n/R16R2 primers produced the expected 1.5- and 1.2-kb amplicons, respectively, from the symptomatic plants and not from the asymptomatic ones. Seventeen symptomatic and eight asymptomatic samples were analyzed through PCR. Nested PCR products were ligated into the plasmid vector using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA). Transformation and selection of recombinant clones was carried out according to the manufacturer's recommended protocol. The sequence obtained from the final PCR product was deposited in the GenBank database (No. JF970603). It was analyzed through the iPhyClassifier ( http://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi ) online tool and found to share 98.2% similarity with that of the ‘Sorghum bunchy shoot phytoplasma’ reference strain (GenBank No. AF509322) that belongs to 16SrXXIV-A subgroup. The virtual restriction fragment length polymorphism pattern of the S. rebaudiana phytoplasma 16S rRNA gene sequence showed maximum similarity to the reference pattern of AF509322 (similarity coefficient of 0.85). Although a number of phytoplasmas have been detected on a wide range of plants in India, little is known about the leafhopper that presumably transmits them to S. rebaudiana and other medicinal crops. Infections by diverse phytoplasma strains/species underscore the need for phytoplasma-free planting stock and intensification of research efforts to reduce ecological and economic impacts of these phytoplasmas. To our knowledge, this is the first report of a natural infection of S. rebaudiana by a group of 16SrXXIV-A phytoplasma. References: (1) P. V. Ajayakumar et al. Aust. Plant Dis. Notes 2:67, 2007. (2) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (3) D. E. Gundersen and I. M. Lee. Phytopathol. Mediterr. 35:144, 1996. (4) S. M. Savita et al. J. Hum. Ecol. 15:261, 2004.

scholarly journals First Report of Group 16SrXII-A Phytoplasma Causing Stolbur Disease in Saponaria officinalis Plants in Serbia

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 420-420 ◽  
Author(s):  
D. Josic ◽  
M. Starovic ◽  
S. Stojanovic ◽  
T. Popovic ◽  
N. Dolovac ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Gene Sequence ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
Saponaria Officinalis

Saponaria officinalis L. (Caryophyllaceae; also known as bouncingbet or soapwort) is a perennial medicinal plant important for the pharmaceutical industry and used as an expectorant, alterative, laxative, and ointment for some skin diseases and arthritic conditions. S. officinalis plants with typical symptoms (23% in 2011 and 47% in 2012) of phytoplasma infection were observed in Pancevo plantation, Serbia. The symptoms appeared in May with leaves changing color from green to brown with severe reddening and necrosis. Severely diseased plants died. The infected plants had a significant reduction in biomass and quality. To investigate the presence of phytoplasma, total DNA was extracted from 10 symptomatic and four asymptomatic plants by a CTAB method. The nested PCR was carried out using phytoplasma-specific primer set P1/16S-SR followed by R16F2n/R16R2, targeting the 16S rRNA gene sequence of 1.5 and 1.2 kb in length, respectively. The amplicons of expected size were obtained from the symptomatic plants, but not from the asymptomatic plants. To obtain restriction fragment length polymorphism (RFLP) patterns, the R16F2n/R2 amplicons were digested with AluI, TruI1, HpaII, and HhaI endonucleases. The resulting patterns indicated that seven plants were infected by a Stolbur phytoplasma belonging to the 16SrXII-A subgroup, since it had the identical RFLP pattern as the STOL reference strain. The 1.2 kb nested PCR products of representative isolate Sap7 were purified using PCR purification kit (Fermentas, Vilnius, Lithuania) according to the recommended protocol and sequenced using facilities of IMGGI SeqService, Belgrade, Serbia. The obtained sequence was deposited in the NCBI database (GenBank Accession No. JX866951). The phytoplasma 16S rRNA gene sequence from Sap7 had a sequence identity of 97% with GenBank accessions GQ273961.1 (‘Euonymus japonicus’ phytoplasma), JX311953.1 (Candidatus Phytoplasma solani clone 5043), JQ412100.1 (Iranian alfalfa phytoplasma M21), and JN561702.1 (‘Convolvulus arvensis’ stolbur phytoplasma clone P1/P7-Conv2/2010-Bg). To our knowledge, this is the first report of a natural infection of S. officinalis by 16SrXII-A subgroup (Stolbur) phytoplasma in Serbia. As cited by Lee et al. (1), the 16SrI-M subgroup phytoplasma in S. officinalis sample was already detected in Lithuania by Valiunas (2). The identification of phytoplasma in the Pancevo plantation caused the intensification of our biological control tests and efforts to reduce the ecological and economic impacts of these phytoplasmas. References: (1) I. M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:1037, 2004. (2) D. Valiunas. PhD thesis, Institute of Botany, Vilnius, Lithuania, 2003.

scholarly journals First Report of Meloidogyne enterolobii on Ormosia hosiei in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chaorong Wu ◽  
Hailian Zhou ◽  
Luming Jia ◽  
Bochang Chen ◽  
H.Y. Wu
Keyword(s):  
Host Range ◽  
Body Length ◽  
Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Body Width ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Its Rrna Gene ◽  
Stylet Length

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43′38″ N, 108°18′06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.

scholarly journals Streptomonospora litoralis sp. nov., a halophilic thiopeptides producer isolated from sand collected at Cuxhaven beach

2021 ◽  
Author(s):  
Shadi Khodamoradi ◽  
Richard L. Hahnke ◽  
Yvonne Mast ◽  
Peter Schumann ◽  
Peter Kämpfer ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Sequence ◽  
Sequence Similarity ◽  
Bioinformatic Analysis ◽  
Biosynthetic Gene Cluster ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Polar Lipid Profile

AbstractStrain M2T was isolated from the beach of Cuxhaven, Wadden Sea, Germany, in course of a program to attain new producers of bioactive natural products. Strain M2T produces litoralimycin and sulfomycin-type thiopeptides. Bioinformatic analysis revealed a potential biosynthetic gene cluster encoding for the M2T thiopeptides. The strain is Gram-stain-positive, rod shaped, non-motile, spore forming, showing a yellow colony color and forms extensively branched substrate mycelium and aerial hyphae. Inferred from the 16S rRNA gene phylogeny strain M2T affiliates with the genus Streptomonospora. It shows 96.6% 16S rRNA gene sequence similarity to the type species Streptomonospora salina DSM 44593 T and forms a distinct branch with Streptomonospora sediminis DSM 45723 T with 97.0% 16S rRNA gene sequence similarity. Genome-based phylogenetic analysis revealed that M2T is closely related to Streptomonospora alba YIM 90003 T with a digital DNA-DNA hybridisation (dDDH) value of 26.6%. The predominant menaquinones of M2T are MK-10(H6), MK-10(H8), and MK-11(H6) (> 10%). Major cellular fatty acids are iso-C16:0, anteiso C17:0 and C18:0 10-methyl. The polar lipid profile consisted of diphosphatidylglycerol phosphatidyl glycerol, phosphatidylinositol, phosphatidylcholine, phosphatidylethanolamine, three glycolipids, two unknown phospholipids, and two unknown lipids. The genome size of type strain M2T is 5,878,427 bp with 72.1 mol % G + C content. Based on the results obtained from phylogenetic and chemotaxonomic studies, strain M2T (= DSM 106425 T = NCCB 100650 T) is considered to represent a novel species within the genus Streptomonospora for which the name Streptomonospora litoralis sp. nov. is proposed.

Sign in / Sign up

Export Citation Format

Share Document