scholarly journals First Report of Meloidogyne enterolobii on Ormosia hosiei in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Chaorong Wu ◽  
Hailian Zhou ◽  
Luming Jia ◽  
Bochang Chen ◽  
H.Y. Wu
Keyword(s):  
Host Range ◽  
Body Length ◽  
Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Body Width ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Its Rrna Gene ◽  
Stylet Length

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43′38″ N, 108°18′06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.

scholarly journals First Report ofClostridium lavalenseIsolated in Human Blood Cultures

2016 ◽  
Vol 2016 ◽  
pp. 1-3
Author(s):  
Richard Garceau ◽  
Christine Bourque ◽  
Louise Thibault ◽  
Jean-Charles Côté ◽  
Jean Longtin ◽  
...  
Keyword(s):  
Human Blood ◽  
Gene Sequence ◽  
Blood Cultures ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Oral Amoxicillin ◽  
Diagnostic Samples ◽  
Human Blood Cultures

An 88-year-old man was admitted to the hospital with worsening malaise, fever, and weakness. Anaerobic blood culture bottles revealed the presence of an anaerobic, Gram-positive sporulated bacillus. Empirical antibiotherapy with intravenous piperacillin-tazobactam was initiated. The patient defervesced after four days and was switched to oral amoxicillin on his 6th day of antibiotic therapy and later discharged from the hospital. Four months later, he had recovered. The bacterium was initially identified asClostridium butyricumusing anaerobic manual identification panel. 16S rRNA gene sequence and phylogenetic analysis showed the bacterium to beClostridium lavalense, a recently described species with no previously published case of isolation in human diagnostic samples so far. This is the first report ofClostridium lavalenseisolation from human blood cultures. Further studies are needed in order to elucidate the role ofClostridium lavalensein human disease and its virulence factors.

scholarly journals First Report of the Dagger Nematode Xiphinema diversicaudatum in Citrus Orchards in Morocco

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 575-575 ◽  
Author(s):  
F. Mokrini ◽  
F. Abbad Andaloussi ◽  
L. Waeyenberge ◽  
N. Viaene ◽  
M. Moens
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Morphological Identification ◽  
Rrna Gene ◽  
Body Width ◽  
Arabis Mosaic Virus ◽  
First Report ◽  
Citrus Orchards ◽  
Plant Pathol ◽  
Xiphinema Diversicaudatum

Xiphinema species are migratory ectoparasitic nematodes that feed on an extensive range of hosts, and several species are vectors of nepoviruses. In May 2012, during a survey of the citrus-growing areas in the Gharb region of Morocco, several Xiphinema nematodes were detected in three locations: Kénitra (INRA, plot P1), Sidi Kacem, and Sidi Slimane. Samples were taken 30 cm deep at 50 cm distance from the tree trunks, in 40-year-old orange groves planted with the variety Maroc Late, grafted on rootstocks of Sour Orange and Citrange Carrizo. The trees showed yellowing of leaves, reduced tree vigor, and swellings at the tips of the roots. There were no weeds or grasses in the sampled area. Nematodes were extracted from soil using an automated centrifuge for extracting free-living nematode stages (2) and identified morphologically and by sequencing. All specimens were identified as Xiphinema diversicaudatum based on key morphological features from females and males. The average measurements of six females were: body length 4.1 mm, body width 60.4 μm, odontostylet 133.5 μm, odontophore 64.0 μm, spear 197.5 μm, tail length 45 μm, body width at anus 31 μm, and vulval position 48%. The females had two genital branches of similar length and structure, which contained a pseudo-Z differentiation. The average measurements of four males were: body length 4.3 mm, body width 51 μm, odontostylet 139 μm, odontophore 70 μm, spear 209 μm, tail length 45 μm, body width at anus 35 μm. To confirm the morphological identification, molecular observations were made. DNA was extracted from one nematode of each location. The D3 expansion region of the 26S rRNA gene was amplified using the primers D3A (5′-GACCCGTCTTGAAACACGGA-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′) (1). The PCR products were purified and sequenced (Macrogen, Inc., Seoul, Korea). All sequences obtained (GenBank Accession Nos. KF057879, KF057880, and KF057881) were compared with sequences available from the GenBank database including several species of Xiphinema. This comparison revealed a sequence similarity of 99 to 100% with X. diversicaudatum. Morphological and molecular identification demonstrated that the isolates of dagger nematodes from three citrus growing areas in Gharb belonged to X. diversicaudatum. An average of six X. diversicaudatum per 100 cm3 soil were found. This is the first report of this species in Morocco. X. diversicaudatum can transmit Arabis mosaic and Strawberry latent ringspot viruses (3). Arabis mosaic virus is of great economic importance in viticulture as it is associated with grapevine fanleaf degeneration disease, together with Grapevine fan leaf virus transmitted by X. index (4). As vineyards are planted amid citrus orchards in the Gharb region, particular attention should be given to this nematode, especially to the risk of its spread by soil. Our finding of X. diversicaudatum in a citrus orchard does not necessarily imply that X. diversicaudatum causes damage in citrus. However, its presence indicates that this nematode species can survive in this environment from where it could spread to other, more susceptible, crops. References: (1) L. Al-Banna et al. Mol. Phylogenet. Evol. 7:94, 1997. (2) G. Hendrickx. Nematologica 41:30, 1998. (3) J. Hübschen et al. Eur. J. Plant Pathol. 110:779, 2004. (4) A. Marmonier et al. J. Plant Pathol. 92:275, 2010.

scholarly journals Range extension of Ichthyophis multicolor Wilkinson et al., 2014 to India and first molecular identification of Ichthyophis moustakius Kamei et al., 2009

Check List ◽  
2021 ◽  
Vol 17 (4) ◽  
pp. 1021-1029
Author(s):  
Hmar Tlawmte Lalremsanga ◽  
Jayaditya Purkayastha ◽  
Mathipi Vabeiryureilai ◽  
Lal Muansanga ◽  
Ht Decemson ◽  
...  
Keyword(s):  
16S Rrna ◽  
Gene Sequence ◽  
Sequence Data ◽  
Northeast India ◽  
Range Extension ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Body Width ◽  
New Material ◽  
Gene Sequence Data

We report a substantial range extension of Ichthyophis multicolor Wilkinson, Presswell, Sherratt, Papadopoulou & Gower, 2014, with new material from Mizoram State, Northeast India. The species was previously known only from its type locality more than 800 km away in Ayeyarwady Region, Myanmar. The species was identified by both its morphology and 16s rRNA gene sequence data. One of the studied individuals represents the largest known specimen for the species (total length = 501 mm; mid-body width = 18.8 mm). Brief comparisons of I. multicolor with the sympatric as well as parapatric congeners in the region, and first barcode data for I. moustakius Kamei, Wilkinson, Gower & Biju, 2009 are also presented.

scholarly journals First Report of a Natural Infection of Stevia rebaudiana by a Group 16SrXXIV Phytoplasma in India

Plant Disease ◽  
2011 ◽  
Vol 95 (12) ◽  
pp. 1582-1582 ◽  
Author(s):  
A. Samad ◽  
S. Dharni ◽  
M. Singh ◽  
S. Yadav ◽  
A. Khan ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Sequence ◽  
Natural Infection ◽  
Stevia Rebaudiana ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Wide Range

Stevia rebaudiana Bertoni (Asteraceae) is one of the most important commercial crops in the world (4). It is known to produce glycosides that are as much as 300 times sweeter than sucrose and do not affect blood sugar levels. Unlike artificial sweeteners like saccharin, they are noncarcinogenic and safe for diabetics. An unknown disease emerged during the summers of 2007 to 2009 in a field of S. rebaudiana at CIMAP Lucknow, India, where more than 20% of the plants exhibited symptoms typical of phytoplasma infection including leaf yellowing, reduced size of leaves, shoot proliferation, flower bud deficiency, as well as bushy and stunted growth. Some of these plants were potted and kept in a glasshouse for investigation. Affected plants in the field expressed a quick decline consisting of growth cessation, bronzing of mature leaves, wilting, and death, resulting in a significant reduction in biomass and quality. Typical phytoplasma-like (pleomorphic) bodies ranging from 450 to 900 nm were observed in the phloem cells of infected plants by transmission electron microscopy (1). These bodies were always found in diseased plants, but not in asymptomatic ones. No other microorganisms were noted. Total DNA was extracted from symptomatic as well as asymptomatic plants by a CTAB method. PCR was carried out with the universal phytoplasma primers P1/P6 (P1, 5′-AAGAGTTTGATCCTGGCTCAGGATT-3′; P6, 5′-CGGTAGGGATACCTTGTTACGACTTA-3′) (2) followed by nested primers R16F2n/R16R2 (R16F2n, 5′-GAAACGACTGCTAAGACTGG-3′; R16R2, 5′-TGACGGGCGGTGTGTACAAACCCCG-3′) targeting the 16S rRNA gene sequence (3). The P1/P6 and R16F2n/R16R2 primers produced the expected 1.5- and 1.2-kb amplicons, respectively, from the symptomatic plants and not from the asymptomatic ones. Seventeen symptomatic and eight asymptomatic samples were analyzed through PCR. Nested PCR products were ligated into the plasmid vector using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA). Transformation and selection of recombinant clones was carried out according to the manufacturer's recommended protocol. The sequence obtained from the final PCR product was deposited in the GenBank database (No. JF970603). It was analyzed through the iPhyClassifier ( http://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi ) online tool and found to share 98.2% similarity with that of the ‘Sorghum bunchy shoot phytoplasma’ reference strain (GenBank No. AF509322) that belongs to 16SrXXIV-A subgroup. The virtual restriction fragment length polymorphism pattern of the S. rebaudiana phytoplasma 16S rRNA gene sequence showed maximum similarity to the reference pattern of AF509322 (similarity coefficient of 0.85). Although a number of phytoplasmas have been detected on a wide range of plants in India, little is known about the leafhopper that presumably transmits them to S. rebaudiana and other medicinal crops. Infections by diverse phytoplasma strains/species underscore the need for phytoplasma-free planting stock and intensification of research efforts to reduce ecological and economic impacts of these phytoplasmas. To our knowledge, this is the first report of a natural infection of S. rebaudiana by a group of 16SrXXIV-A phytoplasma. References: (1) P. V. Ajayakumar et al. Aust. Plant Dis. Notes 2:67, 2007. (2) S. Deng and C. Hiruki. J. Microbiol. Methods 14:53, 1991. (3) D. E. Gundersen and I. M. Lee. Phytopathol. Mediterr. 35:144, 1996. (4) S. M. Savita et al. J. Hum. Ecol. 15:261, 2004.

scholarly journals First Report of Meloidogyne incognita on Mulberry in Saudi Arabia

Plant Disease ◽  
2021 ◽  
Author(s):  
Hamzeh Lafi ◽  
Fahad Al-Yahya ◽  
Ahmad Al Hazmi
Keyword(s):  
Saudi Arabia ◽  
Body Length ◽  
Meloidogyne Incognita ◽  
Tail Length ◽  
Total Body Length ◽  
Morus Alba ◽  
Body Width ◽  
First Report ◽  
Stylet Length ◽  
Total Body

The genus Morus comprises many species (Suttie 2012). The species Morus alba is one of the most popular mulberry species worldwide. In October 2020, numerous mulberry trees presented chlorotic leaves and stunted growth with severe root galling in a private compound in Riyadh region, Saudi Arabia. The infected roots showed galls, which are typical symptoms of infection by root-knot nematodes (RKNs). Infected roots were dissected, and males and females were extracted from roots while second stage juveniles (J2s) were from both soil and eggmasses. Morphological and morphometrical features were documented. Perineal patterns of females, males, and J2s were studied using a compound microscope. The endoparasitic females had pearly shaped bodies with projecting neck. Stylet knobs were rounded and set off and the shape of the cone distinctly curved. The posterior perineal had a dorsally high square arch. Striae patterns were zig-zag or forked along the lateral lines. Males were vermiform and the head cap flat to concave. Mostly conus of stylet was longer than shaft. Stylet knobs were prominent, set off, flat and usually greater width than the length. Males had a bluntly rounded tail, spicules were slightly curved and gubernaculum was crescentic. The J2s were vermiform, and stylet knobs were prominent and rounded shape. The J2s tail had a transparent area with an obtuse tip. The morphological measurements (means and range) of the perineal patterns of females (n = 4) were: length of vulval slit (LVS) = 22.5 (21.5 to 23.4) μm, anus to vulval slit (AVS) = 22 (21.8 to 22.1) μm, and anus length (AL) = 7.7 (7.5 to 7.8) μm. The males (n = 16) measurements were: length (L) = 1136 (1116 to 1159) μm; a (total body length / greatest body width) = 34.8 (33 to 37.1); body width = 32.7 (31.2 to 33.8) μm; stylet length = 25.6 (24.7 to 27.3) μm; dorsal oesophageal gland orifice (DGO) = 2.9 (2.6 to 3) μm, tail length = 7.1 (6.5 to 7.8) μm, c (total body length / tail length) = 161 (143.1 to 175), spicules length = 30.8 (26 to 33.8) μm; gubernaculum = 9.7 (9.1 to 10.4) μm. The J2s (n = 11) measurements were: L = 395 (378 to 405) μm; a = 26.2 (24.3 to 28.4); c = 8.6 (8.2 to 9.2); head end to metacorpus valve = 53 (49.4 to 54.6) μm; excretory pore to head end = 78 (72.8 to 80) μm, stylet length = 10.7 (10.4 to 11.7) μm; body width = 15.1 (14.3 to 15.6) μm; tail length = 45.8 (44.2 to 49.4) μm; hyaline tail terminus length = 12.5 (10.4 to 13) μm. Both the morphological and morphometrical features of the perineal pattern of the females, males, and J2s match the original description of Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Eisenback and Hirschmann 1981; Taylor and Netscher 1974). To perform Koch’s postulates, mulberry plants maintained in pots were inoculated with 2,500 J2s and eggs of the original population of M. incognita using five replicates. After two months, all inoculated plants had galled roots typical of RKNs. Reproduction factor value was 6.4. The noninoculated plants did not present galls in the roots. These results confirmed the nematode’s pathogenicity on mulberry. To the best of our knowledge, this is the first report that M. incognita was identified as a parasite of mulberry (Morus alba) in Saudi Arabia and the world, while Meloidogyne hispanica was reported on mulberry trees in Iran (Shokoohi et al. 2016). The importance of this report shed some lights on this new problem to direct the attention of farmers and home gardeners to take actions for the management of this newly identified problem. The authors declare no conflict of interest. Acknowledgments Authors wish to thanks College of Food and Agricultural Sciences, Research Center and Deanship of Scientific Research, King Saud University, Saudi Arabia for supporting this work. References: Eisenback, J. D. and Hirschmann, H. 1981. J. Nematol. 13:513. Shokoohi, E. et al. 2016. Australasian Plant Dis. Notes 11:16. Suttie, J. M. 2012. Food and Agricultural Organization of the United Nations. Taylor D. P., Netscher, C. 1974. Nematologica 20:268.

scholarly journals First Report of Group 16SrXII-A Phytoplasma Causing Stolbur Disease in Saponaria officinalis Plants in Serbia

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 420-420 ◽  
Author(s):  
D. Josic ◽  
M. Starovic ◽  
S. Stojanovic ◽  
T. Popovic ◽  
N. Dolovac ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Gene Sequence ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
Saponaria Officinalis

Saponaria officinalis L. (Caryophyllaceae; also known as bouncingbet or soapwort) is a perennial medicinal plant important for the pharmaceutical industry and used as an expectorant, alterative, laxative, and ointment for some skin diseases and arthritic conditions. S. officinalis plants with typical symptoms (23% in 2011 and 47% in 2012) of phytoplasma infection were observed in Pancevo plantation, Serbia. The symptoms appeared in May with leaves changing color from green to brown with severe reddening and necrosis. Severely diseased plants died. The infected plants had a significant reduction in biomass and quality. To investigate the presence of phytoplasma, total DNA was extracted from 10 symptomatic and four asymptomatic plants by a CTAB method. The nested PCR was carried out using phytoplasma-specific primer set P1/16S-SR followed by R16F2n/R16R2, targeting the 16S rRNA gene sequence of 1.5 and 1.2 kb in length, respectively. The amplicons of expected size were obtained from the symptomatic plants, but not from the asymptomatic plants. To obtain restriction fragment length polymorphism (RFLP) patterns, the R16F2n/R2 amplicons were digested with AluI, TruI1, HpaII, and HhaI endonucleases. The resulting patterns indicated that seven plants were infected by a Stolbur phytoplasma belonging to the 16SrXII-A subgroup, since it had the identical RFLP pattern as the STOL reference strain. The 1.2 kb nested PCR products of representative isolate Sap7 were purified using PCR purification kit (Fermentas, Vilnius, Lithuania) according to the recommended protocol and sequenced using facilities of IMGGI SeqService, Belgrade, Serbia. The obtained sequence was deposited in the NCBI database (GenBank Accession No. JX866951). The phytoplasma 16S rRNA gene sequence from Sap7 had a sequence identity of 97% with GenBank accessions GQ273961.1 (‘Euonymus japonicus’ phytoplasma), JX311953.1 (Candidatus Phytoplasma solani clone 5043), JQ412100.1 (Iranian alfalfa phytoplasma M21), and JN561702.1 (‘Convolvulus arvensis’ stolbur phytoplasma clone P1/P7-Conv2/2010-Bg). To our knowledge, this is the first report of a natural infection of S. officinalis by 16SrXII-A subgroup (Stolbur) phytoplasma in Serbia. As cited by Lee et al. (1), the 16SrI-M subgroup phytoplasma in S. officinalis sample was already detected in Lithuania by Valiunas (2). The identification of phytoplasma in the Pancevo plantation caused the intensification of our biological control tests and efforts to reduce the ecological and economic impacts of these phytoplasmas. References: (1) I. M. Lee et al. Int. J. Syst. Evol. Microbiol. 54:1037, 2004. (2) D. Valiunas. PhD thesis, Institute of Botany, Vilnius, Lithuania, 2003.

scholarly journals Streptomonospora litoralis sp. nov., a halophilic thiopeptides producer isolated from sand collected at Cuxhaven beach

2021 ◽  
Author(s):  
Shadi Khodamoradi ◽  
Richard L. Hahnke ◽  
Yvonne Mast ◽  
Peter Schumann ◽  
Peter Kämpfer ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Gene Sequence ◽  
Sequence Similarity ◽  
Bioinformatic Analysis ◽  
Biosynthetic Gene Cluster ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Polar Lipid Profile

AbstractStrain M2T was isolated from the beach of Cuxhaven, Wadden Sea, Germany, in course of a program to attain new producers of bioactive natural products. Strain M2T produces litoralimycin and sulfomycin-type thiopeptides. Bioinformatic analysis revealed a potential biosynthetic gene cluster encoding for the M2T thiopeptides. The strain is Gram-stain-positive, rod shaped, non-motile, spore forming, showing a yellow colony color and forms extensively branched substrate mycelium and aerial hyphae. Inferred from the 16S rRNA gene phylogeny strain M2T affiliates with the genus Streptomonospora. It shows 96.6% 16S rRNA gene sequence similarity to the type species Streptomonospora salina DSM 44593 T and forms a distinct branch with Streptomonospora sediminis DSM 45723 T with 97.0% 16S rRNA gene sequence similarity. Genome-based phylogenetic analysis revealed that M2T is closely related to Streptomonospora alba YIM 90003 T with a digital DNA-DNA hybridisation (dDDH) value of 26.6%. The predominant menaquinones of M2T are MK-10(H6), MK-10(H8), and MK-11(H6) (> 10%). Major cellular fatty acids are iso-C16:0, anteiso C17:0 and C18:0 10-methyl. The polar lipid profile consisted of diphosphatidylglycerol phosphatidyl glycerol, phosphatidylinositol, phosphatidylcholine, phosphatidylethanolamine, three glycolipids, two unknown phospholipids, and two unknown lipids. The genome size of type strain M2T is 5,878,427 bp with 72.1 mol % G + C content. Based on the results obtained from phylogenetic and chemotaxonomic studies, strain M2T (= DSM 106425 T = NCCB 100650 T) is considered to represent a novel species within the genus Streptomonospora for which the name Streptomonospora litoralis sp. nov. is proposed.

scholarly journals Faecalicoccus acidiformans gen. nov., sp. nov., isolated from the chicken caecum, and reclassification of Streptococcus pleomorphus (Barnes et al. 1977), Eubacterium biforme (Eggerth 1935) and Eubacterium cylindroides (Cato et al. 1974) as Faecalicoccus pleomorphus comb. nov., Holdemanella biformis gen. nov., comb. nov. and Faecalitalea cylindroides gen. nov., comb. nov., respectively, within the family Erysipelotrichaceae

2014 ◽  
Vol 64 (Pt_11) ◽  
pp. 3877-3884 ◽  
Author(s):  
Celine De Maesschalck ◽  
Filip Van Immerseel ◽  
Venessa Eeckhaut ◽  
Siegrid De Baere ◽  
Margo Cnockaert ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Type Species ◽  
Gene Sequence ◽  
Sequence Similarity ◽  
16S Rrna Gene Sequence ◽  
Rrna Gene ◽  
Rrna Gene Sequence ◽  
Content Type ◽  
Link Type

Strains LMG 27428T and LMG 27427 were isolated from the caecal content of a chicken and produced butyric, lactic and formic acids as major metabolic end products. The genomic DNA G+C contents of strains LMG 27428T and LMG 27427 were 40.4 and 38.8 mol%. On the basis of 16S rRNA gene sequence similarity, both strains were most closely related to the generically misclassified Streptococcus pleomorphus ATCC 29734T. Strain LMG 27428T could be distinguished from S. pleomorphus ATCC 29734T based on production of more lactic acid and less formic acid in M2GSC medium, a higher DNA G+C content and the absence of activities of acid phosphatase and leucine, arginine, leucyl glycine, pyroglutamic acid, glycine and histidine arylamidases, while strain LMG 27428 was biochemically indistinguishable from S. pleomorphus ATCC 29734T. The novel genus Faecalicoccus gen. nov. within the family Erysipelotrichaceae is proposed to accommodate strains LMG 27428T and LMG 27427. Strain LMG 27428T ( = DSM 26963T) is the type strain of Faecalicoccus acidiformans sp. nov., and strain LMG 27427 ( = DSM 26962) is a strain of Faecalicoccus pleomorphus comb. nov. (type strain LMG 17756T = ATCC 29734T = DSM 20574T). Furthermore, the nearest phylogenetic neighbours of the genus Faecalicoccus are the generically misclassified Eubacterium cylindroides DSM 3983T (94.4 % 16S rRNA gene sequence similarity to strain LMG 27428T) and Eubacterium biforme DSM 3989T (92.7 % 16S rRNA gene sequence similarity to strain LMG 27428T). We present genotypic and phenotypic data that allow the differentiation of each of these taxa and propose to reclassify these generically misnamed species of the genus Eubacterium formally as Faecalitalea cylindroides gen. nov., comb. nov. and Holdemanella biformis gen. nov., comb. nov., respectively. The type strain of Faecalitalea cylindroides is DSM 3983T = ATCC 27803T = JCM 10261T and that of Holdemanella biformis is DSM 3989T = ATCC 27806T = CCUG 28091T.

Sign in / Sign up

Export Citation Format

Share Document