First Report of Meloidogyne enterolobii on Ormosia hosiei in China

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43′38″ N, 108°18′06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.

MS/MS-Based Molecular Networking Approach for the Detection of Aplysiatoxin-Related Compounds in Environmental Marine Cyanobacteria

Certain strains of cyanobacteria produce a wide array of cyanotoxins, such as microcystins, lyngbyatoxins and aplysiatoxins, that are associated with public health issues. In this pilot study, an approach combining LC-MS/MS and molecular networking was employed as a rapid analytical method to detect aplysiatoxins present in four environmental marine cyanobacterial samples collected from intertidal areas in Singapore. Based on 16S-ITS rRNA gene sequences, these filamentous cyanobacterial samples collected from Pulau Hantu were determined as Trichodesmium erythraeum, Oscillatoria sp. PAB-2 and Okeania sp. PNG05-4. Organic extracts were prepared and analyzed on LC-HRMS/MS and Global Natural Product Social Molecular Networking (GNPS) for the presence of aplysiatoxin-related molecules. From the molecular networking, six known compounds, debromoaplysiatoxin (1), anhydrodebromoaplysiatoxin (2), 3-methoxydebromoaplysiatoxin (3), aplysiatoxin (4), oscillatoxin A (5) and 31-noroscillatoxin B (6), as well as potential new analogues, were detected in these samples. In addition, differences and similarities in molecular networking clusters related to the aplysiatoxin molecular family were observed in extracts of Trichodesmium erythraeum collected from two different locations and from different cyanobacterial species found at Pulau Hantu, respectively.

DNA barcoding, phylogeny and phylogeography of the cyst nematode species of the Avenae group from the genus Heterodera (Tylenchida: Heteroderidae)

Summary Among the recognised species groups of Heterodera, the Avenae group is one of the largest with a total of 12 species. Ten of them, H. arenaria, H. aucklandica, H. australis, H. avenae, H. filipjevi, H. mani, H. pratensis, H. riparia, H. sturhani and H. ustinovi, are morphologically closely related and represent the H. avenae species complex, and the other two, H. hordecalis and H. latipons, are morphologically more distinct from this complex. In this study we provide comprehensive phylogenetic analyses of several hundred COI and ITS rRNA gene sequences from the Avenae group using Bayesian inference, maximum likelihood and statistical parsimony. Some 220 COI and 11 ITS rRNA new gene sequences from 147 nematode populations collected in 26 countries were obtained in this study. Our study showed that the COI gene is a powerful DNA barcoding marker for identification of populations and species from the Avenae group. A putatively new cyst nematode species related to H. latipons was revealed from the analysis of COI and ITS rRNA gene datasets. COI gene sequences allow distinguishing H. arenaria, H. australis and H. sturhani from each other and other species. Problems of species delimiting of these species are discussed. The results of the analysis showed that COI haplotypes corresponded to certain pathotypes of the cereal cyst nematodes. It is recommended that information on COI haplotypes of studied populations be included in research with these nematodes. Based on the results of phylogeographical analysis and age estimation of clades with a molecular clock approach, it was hypothesised that several species of the Avenae group primarily originated and diversified in the Irano-Anatolian hotspot during the Pleistocene and Holocene periods and then dispersed from this region across the world. Different geographic barriers, centres and times of origin might explain current known distribution patterns for species of the Avenae group. Possible pathways, including a long distance trans-Atlantic dispersal, and secondary centres of diversification are proposed and discussed.

Morphological and molecular characterisation of Heterodera filipjevi (Madzhidov, 1981) from the Slovak Republic

Cysts, males and juveniles from a population of Heterodera filipjevi found on sports-ground turf in Trnava, Slovak Republic, in 2016 are described based on morphology and morphometrics. The identity of species of juveniles extracted from cysts was subsequently determined and confirmed by PCR-RFLP and sequencing. Morphologically, cysts, juveniles and males from the Slovak Republic are similar to paratypes from Tajikistan. The results of the phylogenetic analysis of the ITS rRNA gene sequences confirmed the species identification and phylogenetic relationship of H. filipjevi with other Heterodera species. Of interest, this analysis showed the close similarity between the Slovakian (KY349106) and Chinese (KU896216) samples, which differed by a single nucleotide and clustered together. To our knowledge, this is also the first report of H. filipjevi from the Slovak Republic, thus increasing the total number of cyst nematode species of the Heterodera genus known to occur in the country to a total of 15 species.

Morphological and molecular characterisation of Helicotylenchus pseudorobustus (Steiner, 1914) Golden, 1956 and related species (Tylenchida: Hoplolaimidae) with a phylogeny of the genus

Morphological identification of spiral nematodes of the genus Helicotylenchus is a difficult task because most characters used for their diagnosis vary within species. In this paper we provide morphological and molecular characterisations of several spiral nematodes, H. broadbalkiensis, H. digonicus, H. dihystera, H. microlobus, H. paxilli and H. pseudorobustus, collected in different geographical areas of USA, Switzerland, Italy, New Zealand, Spain, UK, South Korea and Russia. We suggest that H. microlobus and H. pseudorobustus are valid species separated from each other morphologically and molecularly. Seven species with distinct molecular characteristics are also distinguished, but are not ascribed morphologically to any specific taxon because of the low number of specimens available. Phylogenetic relationships of H. pseudorobustus with other Helicotylenchus species are given as inferred from the analyses of 154 sequences of the D2-D3 of 28S rRNA gene and 37 sequences of ITS rRNA gene.

Morphology and molecular analysis of Paratylenchus nanjingensis n. sp. (Nematoda: Paratylenchinae) from the rhizosphere soil of Pinus massoniana in China

Paratylenchus nanjingensis n. sp. was obtained from Nanjing, Jiangsu Province, China. This new species is characterized by having a female with a slender, vermiform body (243–279 μm), head with distinct submedian lobes, slender and long stylet (64–68 μm), anchor-shaped stylet knobs, excretory pore anterior to the level of the stylet knobs, small lateral vulval flaps and lateral field with four lines; and male with more distinct body annuli, stylet lacking and pharynx degenerate. The internal transcribed spacer sequences of ribosomal RNA (ITS rRNA) gene of the new species were amplified and sequenced in this study. The phylogenetic relationships of the new species with other Paratylenchus species using the ITS rRNA gene sequences are given.

Morphological and molecular characterisation of several Paratylenchus Micoletzky, 1922 (Tylenchida: Paratylenchidae) species from South Africa and USA, together with some taxonomic notes

Pin nematodes of the genus Paratylenchus are widely distributed across the world and associated with many plant species. Morphological identification of Paratylenchus species is a difficult task because it relies on many characters with a wide range of intraspecific variation. In this study we provide morphological and molecular characterisation of several pin nematodes: Paratylenchus aquaticus, P. dianthus, P. hamatus, P. nanus and P. straeleni, collected in different states of the USA and South Africa. Paratylenchus aquaticus is reported from South Africa and Hawaii and P. nanus is found from South Africa for the first time. Morphological descriptions, morphometrics, light and scanning electron microscopic photos and drawings are given for these species. Molecular characterisation of nematodes using the D2-D3 of 28S rRNA and ITS rRNA gene sequence revealed that samples morphologically identified as P. aquaticus, P. hamatus and P. nanus indeed represent species complexes containing several species. Sequences of the rRNA genes are also provided for several unidentified Paratylenchus. Phylogenetic relationships within the genus Paratylenchus are given as inferred from the analyses of the D2-D3 of 28S rRNA and ITS rRNA gene sequences. We present here the most complete phylogenetic analysis of the genus.

A new cyst nematode, Cactodera torreyanae sp. n. (Tylenchida: Heteroderidae), parasitising romerito, Suaeda torreyana, in Texcoco, Mexico

A new species of cyst nematode, Cactodera torreyanae sp. n., parasitising romerito plants, Suaeda torreyana (Chenopodiaceae), found in highly saline soils in Texcoco, Mexico, is described. The new species is morphologically and molecularly related to C. weissi, from which it differs in smaller fenestral diam., longer body and shorter tail lengths of second-stage juveniles (J2) and to C. rosae, from which it differs in smaller cyst size, longer body length of J2 and the presence of a smooth eggshell surface. Phylogenetic relationships within populations and species of the Punctoderinae and Cactodera are given based on the analysis of the D2-D3 expansion segments of 28S rRNA and the ITS rRNA gene sequences.

Phylogenetic position of Coronastrum ellipsoideum and description of Parachlorella hussii sp. nov.

Following traditional morphological concepts, the genus Coronastrum is considered to be a rare member of the Scenedesmaceae (Chorophyceae). This classification may be called into question when molecular data are taken into account as well. Recent molecular phylogenetic studies revealed the polyphyletic origin of the family Scenedesmaceae within the Chlorophyceae and Trebouxiophyceae. In a combined approach of morphological analyses, SSU/ITS rRNA gene phylogeny and comparison of the ITS secondary structure, we analysed the systematics of Coronastrum strains available in public strain collections. Our molecular analyses revealed a new subclade within the Chlorella clade of the Chlorellaceae consisting of Coronastrum ellipsoideum, two strains with Dictyosphaerium-like morphology and one strain which fits the description of the genus Parachlorella. Four additional strains formed together a new lineage within the genus Parachlorella in the Parachlorella clade of the Chlorellaceae. These strains differ from the already known Parachlorella species in complementary base changes within the ITS2 and are here described for the first time as Parachlorella hussii sp. nov.