Thyroid Hormone Receptor β Suppression of RUNX2 Is Mediated by Brahma-Related Gene 1–Dependent Chromatin Remodeling

Abstract Thyroid hormone receptor β (TRβ) suppresses tumor growth through regulation of gene expression, yet the associated TRβ-mediated changes in chromatin assembly are not known. The chromatin ATPase brahma-related gene 1 (BRG1; SMARCA4), a key component of chromatin-remodeling complexes, is altered in many cancers, but its role in thyroid tumorigenesis and TRβ-mediated gene expression is unknown. We previously identified the oncogene runt-related transcription factor 2 (RUNX2) as a repressive target of TRβ. Here, we report differential expression of BRG1 in nonmalignant and malignant thyroid cells concordant with TRβ. BRG1 and TRβ have similar nuclear distribution patterns and significant colocalization. BRG1 interacts with TRβ, and together, they are part of the regulatory complex at the RUNX2 promoter. Loss of BRG1 increases RUNX2 levels, whereas reintroduction of TRβ and BRG1 synergistically decreases RUNX2 expression. RUNX2 promoter accessibility corresponded to RUNX2 expression levels. Inhibition of BRG1 activity increased accessibility of the RUNX2 promoter and corresponding expression. Our results reveal a mechanism of TRβ repression of oncogenic gene expression: TRβ recruitment of BRG1 induces chromatin compaction and diminishes RUNX2 expression. Therefore, BRG1-mediated chromatin remodeling may be obligatory for TRβ transcriptional repression and tumor suppressor function in thyroid tumorigenesis.

Download Full-text

Thyroid hormone receptor-β gene expression in the brain of the frog Pelophylax esculentus: Seasonal, hormonal and temperature regulation

General and Comparative Endocrinology ◽

10.1016/j.ygcen.2012.07.014 ◽

2012 ◽

Vol 178 (3) ◽

pp. 511-518 ◽

Cited By ~ 6

Author(s):

Alessandra Santillo ◽

Lavinia Burrone ◽

Diana Ferrara ◽

Sergio Minucci ◽

Claudia Pinelli ◽

...

Keyword(s):

Gene Expression ◽

Thyroid Hormone ◽

Temperature Regulation ◽

Hormone Receptor ◽

Thyroid Hormone Receptor ◽

Pelophylax Esculentus ◽

Thyroid Hormone Receptor Β ◽

The Brain

Download Full-text

Ligand-dependent enhancement of human antithrombin gene expression by retinoid X receptor α and thyroid hormone receptor β

Biochemical Journal ◽

10.1042/bj3180263 ◽

1996 ◽

Vol 318 (1) ◽

pp. 263-270 ◽

Cited By ~ 6

Author(s):

René W. L. M. NIESSEN ◽

Farhad REZAEE ◽

Pieter H. REITSMA ◽

Marjolein PETERS ◽

Jan J. M. de VIJLDER ◽

...

Keyword(s):

Gene Expression ◽

Thyroid Hormone ◽

Hormone Receptor ◽

Promoter Region ◽

Promoter Activity ◽

Thyroid Hormone Receptor ◽

Retinoid X Receptor ◽

Hepatoma Cell Line ◽

Promoter Fragment ◽

Thyroid Hormone Receptor Β

We studied potential modulators of antithrombin gene expression. A putative hormone response element (HRE) was identified by sequence similarity analysis of the antithrombin promoter, situated between nucleotides -92 and -54 relative to the transcription start site. This HRE contains three hexanucleotide motifs with an AGGTCA consensus, which are potential targets of members of the steroid/thyroid superfamily of nuclear receptors. Stimulation of the hepatoma cell line HepG2 with the receptor ligands l-3,5,3´-tri-iodothyronine, all-trans retinoic acid, or their combination, increased production of antithrombin into the culture medium by 1.3-, 1.6-, and 2.0-fold, respectively. In contrast, the receptor ligand 1,25-dihydroxycholecalciferol [1,25-(OH)2VitD3] did not influence antithrombin production. Analysis of promoter chloramphenicol acetyltransferase (CAT) constructs, showed that the first 86 bp of the antithrombin promoter region are sufficient for basal transcription. The DNA length polymorphism of 32 bp or 108 bp, located upstream of position -276, did not influence antithrombin promoter activity. The antithrombin promoter activity dropped to background values when deleting the region -97/-49 of promoter fragment -453/+57. Transactivation of the antithrombin promoter by retinoid X receptor α (RXRα) (5–7-fold) or thyroid hormone receptor β (TRβ) (4–5-fold) was only observed when at least -167/+57 bp of the promoter region is present in CAT constructs, and when the appropriate ligand of the nuclear receptor was added. This transactivation was not observed upon deletion of the antithrombin promoter region -97/-49. With three copies of the antithrombin promoter fragment -109/-42 in front of the thymidine kinase minimal promoter, transactivation was only obtained with RXRα, and not with TRβ. In conclusion, these results indicate that the ligand-dependent enhancement of antithrombin gene expression is regulated by RXRα as well as by TRβ. Transactivation of antithrombin gene expression by RXRα and TRβ appears to be dependent upon the presence of promoter region up to nucleotide -167. The HRE segment (-109/-42) only confers RXRα responsiveness to a heterologous promoter. Further study is needed to unravel the exact nature of this HRE and its 5´-flanking sequences.

Download Full-text

Aberrant Expression of Thyroid Hormone Receptor β Isoform May Cause Inappropriate Secretion of TSH in a TSH-Secreting Pituitary Adenoma

The Journal of Clinical Endocrinology & Metabolism ◽

10.1210/jc.2010-2496 ◽

2011 ◽

Vol 96 (6) ◽

pp. E948-E952 ◽

Cited By ~ 18

Author(s):

Tetsuya Tagami ◽

Takeshi Usui ◽

Akira Shimatsu ◽

Mutsuo Beniko ◽

Hiroyuki Yamamoto ◽

...

Keyword(s):

Gene Expression ◽

Pituitary Adenoma ◽

Thyroid Hormone ◽

Hormone Receptor ◽

Thyroid Hormone Receptor ◽

Transient Gene Expression ◽

Negative Regulation ◽

Aberrant Expression ◽

Inappropriate Secretion ◽

Thyroid Hormone Receptor Β

Context: Patients with TSH-secreting pituitary adenomas (TSHoma) show inappropriate secretion of TSH; serum TSH levels are not suppressed despite high serum free thyroid hormone levels. The mechanism of a defect in negative regulation of TSH in a TSHoma is still unclear. Objective: Recently, we cloned a novel thyroid hormone receptor β isoform (TRβ4) from a human pituitary library. To elucidate the clinical significance of TRβ4, we investigated the expression of this isoform in TSHoma. Methods: RT-PCR was performed to detect TRβ isoforms such as TRβ1, TRβ2, and TRβ4 using RNA obtained from surgically resected TSHoma. The effects of TRβ4 on the TSH gene expression were examined in the transient gene expression experiments. Results: Quantitative analysis using a real-time PCR revealed that relative expression of TRβ4 to TRβ1+2 was higher in three TSHoma than in a prolactinoma or a nonfunctioning pituitary adenoma. TRβ4 construct did not mediate T3-dependent gene regulation but inhibited the negative regulation of TSHα mediated by TRβ1 or TRβ2. Conclusions: Aberrant expression of TRβ4 may partly contribute to the inappropriate secretion of TSH in a TSHoma.

Download Full-text

Thyroid Hormone Regulation of Gene Expression in Primary Cerebrocortical Cells: Role of Thyroid Hormone Receptor Subtypes and Interactions with Retinoic Acid and Glucocorticoids

PLoS ONE ◽

10.1371/journal.pone.0091692 ◽

2014 ◽

Vol 9 (3) ◽

pp. e91692 ◽

Cited By ~ 40

Author(s):

Pilar Gil-Ibáñez ◽

Juan Bernal ◽

Beatriz Morte

Keyword(s):

Gene Expression ◽

Retinoic Acid ◽

Thyroid Hormone ◽

Hormone Receptor ◽

Thyroid Hormone Receptor ◽

Regulation Of Gene Expression ◽

Receptor Subtypes ◽

Hormone Regulation

Download Full-text

Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Endocrinology ◽

10.1210/en.2006-0116 ◽

2006 ◽

Vol 147 (9) ◽

pp. 4292-4302 ◽

Cited By ~ 50

Author(s):

Koshi Hashimoto ◽

Masanobu Yamada ◽

Shunichi Matsumoto ◽

Tsuyoshi Monden ◽

Teturou Satoh ◽

...

Keyword(s):

Gene Expression ◽

Thyroid Hormone ◽

Hormone Receptor ◽

Thyroid Hormone Receptor ◽

Binding Protein ◽

Retinoid X Receptor ◽

Mrna Levels ◽

Response Element ◽

Element Binding Protein ◽

Thyroid Hormone Receptor Β

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

Download Full-text