scholarly journals Detection and identification of potentially toxic cyanobacteria in Polish water bodies.

2011 ◽  
Vol 58 (3) ◽  
Author(s):  
Joanna Głowacka ◽  
Magdalena Szefel-Markowska ◽  
Małgorzata Waleron ◽  
Ewa Łojkowska ◽  
Krzysztof Waleron
Keyword(s):  
Molecular Markers ◽  
Pcr Amplification ◽  
Water Bodies ◽  
Agricultural Activities ◽  
Gene Fragment ◽  
Detection And Identification ◽  
Toxic Cyanobacteria ◽  
Different Types ◽  
First Time ◽  
Comprehensive Study

The main goal of this study was to determine the distribution of potentially toxic cyanobacteria in 39 selected Polish water bodies. From the water bodies with blooms and also from those in which blooms were not visible 87 samples were investigated. For the first time samples from ponds localized in villages with high agricultural activities were included. Lakes for which microcystin concentrations had been determined before were included as a reference for the research. The detection of cyanobacteria was conducted by microscopic observation as well as by PCR amplification of the rpoC1 gene fragment. Cyanobacteria were present in 75 out of 87 samples. The presence of potentially toxic cyanobacteria was detected by amplification of the mcyB and mcyE genes, which are involved in the biosynthesis of microcystins. Both genes were detected in 7 out of 9 blooms investigated. In the case of samples collected from water bodies in which blooms were not observed, the mcyB and mcyE genes were detected in 20 out of 36. In order to identify the cyanobacteria occurring in selected reservoirs, 16S plus ITS clone libraries were constructed. The method allowed distinguishing 18 different genotypes. After sequence analysis, cyanobacteria belonging to genera Microcystis, Planktothrix, Anabaena, Pseudanabaena, Synechocystis, Synechococcus and Woronichinia were identified. Results confirmed the usefulness of the rpoC1 and mcy genes for monitoring water bodies and detection of potentially toxic cyanobacteria. Application of molecular markers allowed detecting potentially toxic cyanobacteria before the bloom was visible. This is the first comprehensive study concerning cyanobacteria present in different types of Polish water bodies performed using molecular markers.

STRUCTURAL AND SEMANTIC CHARACTERISTICS OF THE NAMES AND DESCRIPTIONS OF DISHES IN GERMAN RESTAURANT DISCOURSE

2021 ◽  
Vol 7 (2) ◽  
pp. 96-119
Author(s):  
Nadezhda G. KANTYSHEVA ◽  
Inna V. Solovyova
Keyword(s):  
Discourse Analysis ◽  
Semantic Features ◽  
Institutional Discourse ◽  
The World ◽  
Different Types ◽  
Complex Words ◽  
First Time ◽  
Comprehensive Study

This article is devoted to a comprehensive study of the structural and semantic features of dish names and their descriptions in German in the field of restaurant discourse. The study employs cognitive discourse analysis, elements of comparative and contextological approaches, taking into account linguocultural parameters. The relevance of the comprehensive study of the names of dishes in restaurant discourse is due to an increased interest in the parameterization of lexical units in different types of institutional discourse. The scientific novelty of this work lies in the fact that for the first time, within the framework of a restaurant menu, not only the nomination of a dish is considered, but also the structural and semantic characteristics of its description are analysed. An attempt is made to analyse a connection between the nominations of dishes and their description in the restaurant menu, as well as to determine the semantic dominants of the genre under study. It is concluded that the text of the menu as a whole presents a combination of the language for special purposes and the language of advertising. In interaction with extralinguistic factors, the nominations of dishes and their descriptions not only document the culture of food in society, but also reflect the ethnocultural picture of the world. Based on the analysis of the menu texts, it is established that structurally the names of dishes are complex words or phrases, built mainly according to the attributive model. The description of dishes performs the function of verbalizing the sensations of taste and clarifying the method of preparing dishes, characterizing the quality of dishes, their ingredients, and the intensity of taste. Evaluative parameters in descriptions are expressed at the lexical, grammatical, syntactic and stylistic levels.

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

scholarly journals ACANTHOCEPHALUS AND NEMATODES OF FISH IN WATER BODIES OF THE SYRDARYA RIVER MIDSTREAMS

2019 ◽  
pp. 529-533
Author(s):  
Safarova ◽  
Abduganiev ◽  
Akramova ◽  
Soatov ◽  
Akramov
Keyword(s):  
Species Diversity ◽  
Aquatic Ecosystems ◽  
Preventive Measures ◽  
Water Bodies ◽  
Fish Parasites ◽  
Intermediate Hosts ◽  
Different Types ◽  
Acanthocephalus Lucii ◽  
First Time ◽  
Artificial Reservoirs

The features of the nematode and acanthocephalus fauna of Cypriniformes and Siluriformes fish, their distribution in the water bodies of the Syrdarya River midstream were studied. In total, 18 helminth species belonging to the classes Nematoda – (14 species) and Acantocephala – (4) are registered in the region. 7 species we marked for the first time for the region of under consideration.Studies were conducted of different types of water bodies of the Syrdarya river in 2016–2019 years. The collection and study of helminths of fish were carried out by known methods in helminthology and ichthyoparasitology. 1239 copies of Cypriniformes fish belonging to 15 species (Cyprinidae – 12 species, Cobitidae – 3) and 12 specimens of Siluriformes fishes from the families (Siluridae and Clariidae) were researched.According to preliminary data, 18 species of helminths belonging to the class Nematoda (14 species) and to the class Acantocephala (4 species) were found in the studied fish orders in the reservoirs of the region. Significant species diversity is characterized by the class Nematoda. We have registered 14 species belonging to 4 orders. The detachment Trichocephalida Skrjabin et Schulz, 1928 is represented by one species – Capillaria tomentosa Dujardin, 1843, which is noted in most Cypriniformes in the natural and artificial reservoirs of the northeast of Uzbekistan. The greatest species diversity is distinguished by the detachment Spirurida Chitwood, 1933. We noted 8 species. The remaining units are represented by 1–2 species – banal fish parasites. The findings of Dioctophyme renale Goeze, 1782 (larvae) in Cypriniformes in the studied region should be noted.The Acanthocephala class is represented by 4 species: Neoechinorhynchus rutileMüller, 1780, Pomphorhynchus laevis Müller, 1776, Acanthocephalus lucii Müller, 1776 and A. anguillae Müller, 1780. Nematodes are dominant. The results suggest that the most optimal conditions for the functioning of the corresponding helminth communities probably exist in the water bodies of the Syrdarya’s midstream. The abundance of a number of invertebrate groups, the inhabitants of aquatic ecosystems, which are intermediate hosts of parasites, the accumulation of waterbirds and mammals contribute to the irreversible circulation of helminths in aquatic cenoses of the study area. All this requires systematic monitoring of fish helminthiasis in order to develop preventive measures.

Thermophilic potentially pathogenic amoebae isolated from natural water bodies in Poland and their molecular characterization

2014 ◽  
Vol 59 (3) ◽  
Author(s):  
Malgorzata Adamska ◽  
Agata Leonska-Duniec ◽  
Natalia Lanocha ◽  
Bogumila Skotarczak
Keyword(s):  
Natural Water ◽  
18S Rdna ◽  
Water Bodies ◽  
Intergenic Spacers ◽  
Source Of Infection ◽  
Detection And Identification ◽  
First Time ◽  
Surface Water Samples ◽  
Natural Water Bodies ◽  
18S Rdna Gene

AbstractThe free-living amoebae (FLA) may live in the environment and also within other organisms as parasites and then they are called amphizoic. They are potentially pathogenic for humans and animals and are found in water that is a source of infection. The aim of this study was molecular detection and identification of these FLA in natural water bodies in North-Western Poland to evaluate the risk of the pathogenic amoebae infections. We examined surface water samples collected from 50 sites and first, the tolerance thermic test was performed in order to select thermophilic, potentially pathogenic strains. For molecular identification of FLA, regions of 18S rDNA, 16S rDNA and intergenic spacers were amplified. Acanthamoeba T4 and T16 genotypes of 18S rDNA gene and 18S rDNA of H. vermiformis were detected. We identified two variants of Acanthamoeba T4 genotype, two variants of Acanthamoeba T16 genotype and one variant of H. vermiformis. Identification of the T16 genotype and H. vermiformis in water was for the first time in Poland. Additionally, we made attempts to adapt the RLB method for detection and differentiation of FLA species and strains. PCR seems to be more sensitive than RLB hybridization, though.

scholarly journals Molecular Detection and Identification of Piroplasms in Semi-Intensively Managed Cattle from Abeokuta, Nigeria

2020 ◽  
Vol 64 (4) ◽  
pp. 1-8
Author(s):  
I. M. Famuyide ◽  
M. I. Takeet ◽  
A. O. Talabi ◽  
E. B. Otesile
Keyword(s):  
Molecular Detection ◽  
Pcr Amplification ◽  
Single Infection ◽  
Babesia Bigemina ◽  
Haemolytic Disease ◽  
Detection And Identification ◽  
Intensively Managed ◽  
Livestock Health ◽  
Female Cattle ◽  
First Time

AbstractPiroplasmosis is a tick-borne haemolytic disease caused by different species of the Babesia and Theileria genera. Data on the prevalence of bovine piroplasms and their genetic diversity are scanty in Nigeria. Hence, this study reported the detection of some piroplasms in the blood of cattle in Abeokuta, Nigeria by the polymerase chain reaction (PCR). Blood samples were collected from 252 cattle and subjected to DNA extraction followed by PCR amplification of the partial region of 18S rRNA of the haemoprotozoans. Selected positive amplicons were unidirectionally sequenced and compared to the reference sequences from the Genbank. A total of 220 (87.3 %) cattle were positive for Theileria velifera and/or Babesia bigemina. The T. velifera was detected only in 163 (64.7 %) cattle, while 7 (2.8 %) cattle had a single infection with B. bigemina. Fifty cattle (19.8 %) had mixed infections with both parasites. There were no significant differences in piroplasm infections between the ages of cattle for both parasites. There were no significant differences in infection rates between the sexes for T. velifera, while the males had a significantly higher (P < 0.05) rate of infection for B. bigemina than the female cattle. The molecular detection of Babesia and Theileria species of cattle are reported for the first time in cattle in Abeokuta, Nigeria. This study, which confirmed the endemic nature of the parasites in cattle in the study area, stresses their importance in livestock health and production in Nigeria.

To the flora of сonjugates (Streptophyta, Conjugatophyceae) of the Valdai District area of the National Park «Valdaiskiy» (Novgorod Region, Russia)

2014 ◽  
Vol 48 ◽  
pp. 81-88
Author(s):  
A. F. Luknitskaya
Keyword(s):  
Species Distribution ◽  
National Park ◽  
Species Abundance ◽  
Water Bodies ◽  
Number Of Species ◽  
First Time

76 species, 3 varieties and 1 form from 21 genera of Streptophyta, Conjugatophyceae (Actinotaenium, Bambusina, Closterium, Cosmarium, Cylindrocystis, Euastrum, Gonatozygon, Haplotaenium, Micrasterias, Mougeotia, Netrium, Penium, Planotaenium, Pleurotaenium, Raphidiastrum, Spirogyra, Spirotaenia, Staurastrum, Staurodesmus, Tetmemorus, Xanthidium) were found in the basins of the Valdai District area of the National Park «Valdaiskiy» (Novgorod Region, Russia). The list of species is annotated with data on the species distribution in 55 collecting sites of 29 water bodies of the national park, and species abundance in collected samples according to Luknitskaya (2009). Among above mentioned genera, the genus Cosmarium is represented by the greatest number of species (20). Staurastrum chaetoceros has been found for the first time for the Novgorod Region.

Probabilistic Assessment of Reliability and Risk Values by Certification Results

2020 ◽  
pp. 52-67
Author(s):  
Vladimir A. Lapin ◽  
Erken S. Aldakhov ◽  
S. D. Aldakhov ◽  
A. B. Ali
Keyword(s):  
Seismic Risk ◽  
Housing Stock ◽  
Seismic Resistance ◽  
Probabilistic Assessment ◽  
Quantitative Estimates ◽  
Different Types ◽  
Reduce Risk ◽  
First Time ◽  
Structural Solutions ◽  
Practical Recommendations

For the first time in Almaty full passport of apartment stock of multiapartment building was carried out. The structure of the housing stock was revealed with the allocation of groups of buildings according to structural solutions and assessment of their seismic resistance. Based on the results of certification, quantitative estimates of failure probability values for different types of buildings were obtained. Formulas for estimation of quantitative value of seismic risk are obtained. The number of deaths in the estimated zem-shakes was estimated. The results of the assessments will be used for practical recommendations to reduce risk and expected losses in possible earthquakes.

Sign in / Sign up

Export Citation Format

Share Document