scholarly journals The Phylogenetic Study of the White-Bellied Sea Eagle [Haliaeetus leucogaster (Gmelin, 1788)] Based on DNA Barcoding Cytochrome-c Oxidase Subunit I (COI)

2017 ◽  
Vol 3 (4) ◽  
pp. 208
Author(s):  
Riri Wiyanti Retnaningtyas ◽  
Windri Hermadhiyanti ◽  
Dwi Listyorini
Keyword(s):  
Phylogenetic Analysis ◽  
Dna Barcoding ◽  
Gene Sequence ◽  
Genetic Data ◽  
Coi Gene ◽  
Phylogenetic Study ◽  
Haliaeetus Leucocephalus ◽  
Coastal Regions ◽  
Illegal Hunting ◽  
Global Population

<p class="Els-Abstract-text">Even though not yet considered as endangered, White-bellied Sea Eagle’s global population is decreasing due to illegal hunting, bird trading, and deforestation. So far, there hasn’t been any report regarding the phylogenetic study of the White-bellied Sea Eagle inhabiting the coastal regions of Java. Moreover, there hasn’t been any report on the genetic data, especially COI gene, of the White-bellied Sea Eagle living in coastal area of Java. Thus, in this research, two individuals of <em>Heliaeetus leucogaster</em><em> </em>(<a title="Johann Friedrich Gmelin" href="https://en.wikipedia.org/wiki/Johann_Friedrich_Gmelin">Gmelin</a>, 1788); <em> </em>are compared based on its COI gene sequence to the member of genus <em>Haliaeetu</em>s to determine their position in the phylogenetic tree of genus Haliaeetus. COI gene amplification is performed using <em>Forward</em> primer BirdF1 5’- TTC TCC AAC CAC AAA GAC ATT GGC AC-3’ and <em>Reverse </em>primer BirdR2 5’ ACT ACA TGT GAG ATG ATT CCG AAT-3’. The phylogenetic analysis using MEGA6 with <em>Maximum Likelihood </em>method shows that <em>Haliaeetus leucogaster</em> in this study is related to <em>Haliaeetus leucocephalus</em> (Linnaeus, 1766), <em>Haliaeetus pelagicus</em> (Pallas, 1811), and <em>Haliaeetus albicilla</em> (Linnaeus, 1758).</p><p> </p><div><p class="Els-keywords"><strong>Keywords:</strong> phylogenetic study; <em>Heliaeetus leucogaster</em><em> </em>(<a title="Johann Friedrich Gmelin" href="https://en.wikipedia.org/wiki/Johann_Friedrich_Gmelin">Gmelin</a>, 1788); DNA barcoding, <em>C</em><em>ytochrome-c </em><em>O</em><em>xidase </em><em>S</em><em>ubunit</em> I (COI).</p></div>

DNA barcoding and phylogenetic analysis of bagrid catfish in China based on mitochondrial COI gene

2020 ◽  
Vol 31 (2) ◽  
pp. 73-80
Author(s):  
Rui Zou ◽  
Cong Liang ◽  
Mengmeng Dai ◽  
Xiaodong Wang ◽  
Xiuyue Zhang ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Dna Barcoding ◽  
Coi Gene ◽  
Mitochondrial Coi ◽  
Mitochondrial Coi Gene

scholarly journals A BARCODE-BASED PHYLOGENETIC SCAFFOLD FOR XYSTICUS AND ITS RELATIVES (ARANEAE: THOMISIDAE: CORIARACHNINI)

2019 ◽  
Vol 20 ◽  
pp. 198-206 ◽  
Author(s):  
Rainer Breitling
Keyword(s):  
Phylogenetic Analysis ◽  
Dna Barcoding ◽  
Phylogenetic Relationships ◽  
Genetic Data ◽  
Target Area ◽  
Starting Point ◽  
Main Target ◽  
Holarctic Region ◽  
Species Groups ◽  
Crab Spider

The phylogenetic relationships and taxonomy of the crab spider genus Xysticus and its closest relatives (i.e., the tribe Coriarachnini, also including, e.g., Ozyptila, Coriarachne and Bassaniana) have long been controversial, with several alternative classifications being proposed, none of which has gained universal acceptance. As Coriarachnini is largely confined to the Holarctic region, the main target area of recent DNA barcoding projects for spiders, a large amount of genetic data for the group is now publicly available. The results of a phylogenetic analysis of this sequence dataset are largely congruent with earlier morphology-based results regarding the evolutionary structure of the group. In particular, they highlight the fact that Xysticus s. lat. is a paraphyletic assembly and that several species groups need to be placed in separate genera to achieve monophyly of Xysticus s. str. Similarly, Coriarachne and Bassaniana appear as independent clades rather than a joined monophyletic Coriarachne s. lat. In contrast, further subdivision of Ozyptila is not supported by the genetic data. Importantly, the analysis also shows that anapophysate members of Xysticus s. lat. form two widely separated groups: a primarily anapophysate division, also including Coriarachne and Bassaniana, at the base of Xysticus s. lat., and a secondarily anapophysate clade deeply nested within Xysticus s. str. This might explain some of the earlier difficulties when trying to define generally accepted subgroups within Xysticus s. lat. The phylogenetic scaffold based on barcode sequences is sufficiently dense and well resolved to attempt the tentative and provisional placement of the majority of species in Xysticus s. lat. in the independent genera Xysticus s. str., Bassaniodes, Psammitis and Spiracme as a starting point for a future more formal revision of the group.

scholarly journals Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

2021 ◽  
Vol 8 (3) ◽  
Author(s):  
K M Kiran ◽  
B V Sandeep
Keyword(s):  
Phylogenetic Analysis ◽  
Phylogenetic Tree ◽  
Gene Sequence ◽  
Phylogenetic Study ◽  
Rbcl Gene ◽  
Evolutionary Divergence ◽  
Multiple Sequence ◽  
Sorghum Propinquum ◽  
Oryza Punctata ◽  
Mangrove Associate

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

scholarly journals The duck cytochrome oxidase I (COI) gene: Sequence and patterns analysis for potential barcoding tool

2018 ◽  
Vol 19 (3) ◽  
pp. 997-1003
Author(s):  
R. SUSANTI ◽  
RETNO SRI ISWARI ◽  
FIDIA FIBRIANA ◽  
INDRIAWATI INDRIAWATI
Keyword(s):  
Cytochrome Oxidase ◽  
Dna Barcoding ◽  
Cytochrome C Oxidase ◽  
Gene Sequence ◽  
Cytochrome Oxidase I ◽  
Coi Gene ◽  
Mitochondrial Cytochrome ◽  
Central Java ◽  
Synonym Substitution ◽  
Haplotype A

Susanti R, Iswari RS, Fibriana F, Indriawati. 2018. The duck cytochrome oxidase I (COI) gene: Sequence and patterns analysis for potential barcoding tool. Biodiversitas 19: 997-1003. The local duck DNA barcoding is still rarely conducted in Indonesia while DNA barcoding is extensively used as a tool of species identification and delineation tool. This study aimed to analyze the sequence and patterns of Central Javanese ducks mitochondrial cytochrome c oxidase subunit 1 (COI) gene. Feather samples of seven breeds of native duck were collected from traditional husbandries in Central Java. The samples were employed for DNA extraction and COI gene amplification. Five haplotypes were obtained from 35 samples, i.e., haplotype A, B, C, D, and E. Also, 9 variable sites with synonym substitution was detected in four nucleotides number 55, 61, 100, and 109; whereas five synonym substitutions were identified in the nucleotides number 36, 48, 51, 66, and 756. In conclusion, this study annotates that COI mtDNA gene is essential for local ducks barcoding system.

scholarly journals DNA barcoding of razor clam Solen spp. (Solinidae, Bivalva) in Indonesian beaches

2020 ◽  
Vol 21 (2) ◽  
Author(s):  
Ninis trisyani Margono ◽  
DWI ANGGOROWATI RAHAYU
Keyword(s):  
Phylogenetic Analysis ◽  
Genetic Distance ◽  
Dna Barcoding ◽  
Dna Barcode ◽  
Morphological Characteristics ◽  
Wide Distribution ◽  
Coi Gene ◽  
Razor Clam ◽  
Molecular Phylogenetic ◽  
Solen Grandis

Abstract. Trisyani N, Rahayu DA. 2020. DNA barcoding of razor clam Solen spp. (Solinidae, Bivalva) in Indonesian beaches. Biodiversitas 21: 478-484. Solen spp. are shells with various morphological characteristics with a wide distribution of tropical and subtropical beaches, including Indonesia. The identification of Solen spp. is generally based on its morphological characteristics. This method is very problematic due to specimens share similarity in morphology and color. This study was using DNA barcode as a molecular identification tool. The bivalve COI sequence was amplified using PCR and molecular phylogenetic analysis using the Neighbor-Joining method. The amplified COI gene has a length of about 665 bp. The purpose of this study was to evaluate genetic variation and compare the phylogenetic Solen spp. in Indonesian waters. The composition of the nucleotide bases of Solen spp. the comparative species are A = 26.79%, C = 23.16%, G = 19.17% and T = 30.93%. The total nucleotide base A + T was 57.72%, while G + C was 42.33%. The results of phylogenetic analysis showed that Solen spp. Cirebon and Jambi are in one clade with Solen regularis with genetic distance 0.000 - 0.002. Solen spp. Surabaya, Bangkalan, Pamekasan, and Sumenep are in separate clades and are related to Solen grandis, Solen stricus and Solen lamarckii with genetic distance from 0.146 - 0.156. The diversity of nucleotide was 0.9780 and was divided into 12 haplotypes.

scholarly journals Phylogenetic analysis of transparent gobies in three Sumatran lakes, inferred from mitochondrial Cytochrome Oxidase I (COI) gene

2019 ◽  
Vol 21 (1) ◽  
Author(s):  
DEWI IMELDA ROESMA ◽  
DJONG HON TJONG ◽  
DYTA RABBANI AIDIL
Keyword(s):  
Phylogenetic Analysis ◽  
Cytochrome Oxidase ◽  
Cytochrome Oxidase I ◽  
Coi Gene ◽  
Phylogenetic Study ◽  
Mitochondrial Cytochrome ◽  
Base Pairs ◽  
Low Genetic Diversity ◽  
West Sumatra ◽  
Mitochondrial Cytochrome Oxidase

Abstract. Roesma DI, Tjong DH, Aidil DR. 2020. Phylogenetic analysis of transparent gobies in three Sumatran lakes, inferred from mitochondrial Cytochrome Oxidase I (COI) gene. Biodiversitas 21: 43-48. The transparent gobies fish found in three lakes in Sumatra island is known as Rinuak fish (in Maninjau Lake and Singkarak Lake, West Sumatra, Indonesia) or Badar fish (in Siais Lake, North Sumatra, Indonesia), and are morphologically very similar to the Gobiopterus brachypterus. The phylogenetic study was carried out by analyzing 619 base pairs of the mitochondrial DNA cytochrome oxidase subunit I (COI) gene in 12 fish individuals from the three lakes. Rinuak and Badar fish in three populations have four haplotypes. The sequence divergences in and between populations are very low (0.0-0.5%). This value indicates that Rinuak and Badar fish are the same species with low genetic diversity. The phylogenetic tree illustrates that this fish belongs to the group of Gobiidae and a sister taxon from G. brachypterus.

scholarly journals Phylogeography of Simulium Subgenus Wilhelmia (Diptera: Simuliidae)—Insights From Balkan Populations

2019 ◽  
Vol 56 (4) ◽  
pp. 967-978 ◽  
Author(s):  
Jelena Đuknić ◽  
Vladimir M Jovanović ◽  
Nataša Popović ◽  
Ivana Živić ◽  
Maja Raković ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Mitochondrial Dna ◽  
Dna Barcoding ◽  
Balkan Peninsula ◽  
Genetic Distances ◽  
Coi Gene ◽  
Similar Species ◽  
Mtdna Sequences ◽  
The Balkans ◽  
The Status

Abstract Many morphologically similar species of the simuliid (Diptera: Simuliidae) subgenus Wilhelmia, Enderlein are difficult to distinguish. Thus, the revision of the subgenus using various morphological, cytogenetic, and genetic analyses has been attempted. Neglected until now, the Balkan Peninsula, a crossroad between Europe and Anatolia, provides insight which could resolve problematic interrelationships of the taxa within this subgenus. To uncover the status and relations within the subgenus Wilhelmia, mtDNA was extracted from 47 individuals of six morphospecies: Simulium balcanicum (Enderlein, 1924), Simulium turgaicum Rubtsov, 1940, Simulium lineatum (Meigen, 1804), Simulium pseudequinum Séguy, 1921, Simulium equinum (Linnaeus, 1758), and Simulium paraequinum Puri, 1933 from 21 sites throughout the Balkan Peninsula. Phylogenetic analysis of the Wilhelmia species using mitochondrial DNA barcoding (COI) gene showed two major branches, the lineatum branch, which includes the lineages sergenti, paraequinum, and lineatum, and the equinum branch. In the equinum branch, the mtDNA sequences formed six clades, with high genetic distances, suggesting the existence of different species. Historically, the clades of the equinum branch appeared at numerous islands, perhaps as a result of allopatric speciation. The paraequinum lineage (lineatum branch) is composed of two species. However, six clades of the lineatum lineage overlapped with intra- and interspecific genetic distances. Our results revealed that the species S. balcanicum, S. pseudequinum B, and S. equinum were omnipresent in the Balkans. The results point to not only the fair diversity of Wilhelmia species in the Balkans, but also indicate that most Wilhelmia species live in sympatry.

Sign in / Sign up

Export Citation Format

Share Document