scholarly journals Anatomical and Molecular Responses of Soy Bean (Glycine Max (L.) Merr.) Due to Salinity Stresses

Molekul ◽  
2017 ◽  
Vol 12 (1) ◽  
pp. 45 ◽  
Author(s):  
Juwarno Juwarno ◽  
Siti Samiyarsih
Keyword(s):  
Glycine Max ◽  
Molecular Marker ◽  
Leaf Area ◽  
Salinity Stress ◽  
Control Block ◽  
Molecular Responses ◽  
Glycine Max L

Current study was aimed to explore both anatomical and molecular responses of 3 soy bean cultivars (Mahameru, Slamet and Detam) which was given salinity stress. Data of the Mahameru cultivar showed that the widest  stomata  on upper epiderm 11.38 µm, the thickest upper epiderm was 10.71µm, but  the thickest of lower epiderm was only 9.98 µm, the highest density of stomata on lower epiderm was 13.66 per mm2 leaf area, and the thickest mesophyll was 110.37 µm. Molecular marker applying OPA-2 primer with RAPD technique showed the Detam and Slamet cultivars were having different bands one to each other even with the Mahameru cultivar. While the application of OPA-4 primer with the same technique showed there were no genetically different on Mahameru cultivar between control and  treatment 80 mM NaCl. The OPA-8 primer showed that the control block of Slamet cultivar  was different from either control block of others as well as treatment block of 80 mM NaCl. The use of OPA-18 primer showed that the Slamet cultivar of the control block  and so its 80 mM NaCl block was different from Detam and Mahameru, where the 500th base of Slamet cultivar did not have DNA band.

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

Sodium nitroprusside enhances regeneration and alleviates salinity stress in soybean [Glycine max (L.) Merrill]

2019 ◽  
Vol 19 ◽  
pp. 101173 ◽  
Author(s):  
Sivabalan Karthik ◽  
Gadamchetty Pavan ◽  
Veda Krishnan ◽  
Selvam Sathish ◽  
Markandan Manickavasagam
Keyword(s):  
Glycine Max ◽  
Sodium Nitroprusside ◽  
Salinity Stress ◽  
Glycine Max L

SOYBEAN FOLIAGE CONSUMPTION BY PSEUDOPLUSIA INCLUDENS (WALKER) (LEPIDOPTERA: NOCTUIDAE) LARVAE INFECTED WITH NUCLEAR POLYHEDROSIS VIRUS1,2

1987 ◽  
Vol 22 (3) ◽  
pp. 212-223 ◽  
Author(s):  
M. Z. Alam ◽  
W. C. Yearian ◽  
S. Y. Young ◽  
A. J. Mueller
Keyword(s):  
Glycine Max ◽  
Leaf Area ◽  
Nuclear Polyhedrosis Virus ◽  
Pseudoplusia Includens ◽  
Mortality Level ◽  
Total Leaf Area ◽  
Larval Instars ◽  
Glycine Max L ◽  
Nuclear Polyhedrosis ◽  
Lepidoptera Noctuidae

Consumption of greenhouse and field grown ‘Bragg’ soybean, Glycine max (L.) Merrill, foliage was determined for Pseudoplusia includens (Walker) larvae treated with varying dosages of Pseudoplusia nuclear polyhedrosis virus to produce different mortality levels. Uninfected P. includens larvae consumed an average of 158.3 and 78.7 cm2 of greenhouse and field grown soybean foliage, respectively. More than 84% of the total leaf area consumed was by the final two larval instars. The amount of foliage consumed by larvae infected as first (greenhouse and field) or second (greenhouse) instars was significantly reduced with increasing NPV mortality level. Foliage consumption by larvae infected as second (field) and third (greenhouse and field) instars at all dosage levels was significantly reduced when compared to the untreated checks, but differences in foliage consumption at the two lower mortality levels were not significant. Frass produced by infected and uninfected larvae was significantly correlated with the amount of greenhouse or field grown foliage consumed.

Salinity stress phenotyping for soybean (Glycine max L.) for Middle East Asia

2018 ◽  
Author(s):  
Faheema Khan
Keyword(s):  
Chlorophyll Fluorescence ◽  
Glycine Max ◽  
Antioxidant Enzyme ◽  
Salinity Stress ◽  
Nacl Stress ◽  
Salt Tolerant ◽  
Ros Scavenging ◽  
Soybean Genotype ◽  
Fluorescence Measurements ◽  
Glycine Max L

The present study was conducted to evaluate the differences in photosynthetic parameters and antioxidant enzyme activity among two genotypes of soybean (Glycine max L.) in response to salinity stress. Ten-day-old seedlings, grown hydroponically, were treated with 0, 25, 50, 75, 100, 125 and 150 mM NaCl for 7 days and analysed for the traits as biomarkers for identification of salt-tolerant soybean genotype. It was observed that NaCl stress caused severe impairments in photosynthetic rate, chlorophyll fluorescence and chlorophyll content in both the genotypes, but the damage were much more pronounced in salt-sensitive genotype VL SOYA-47. Moreover, chlorophyll fluorescence measurements showed higher non-photochemical quenching in genotype VL SOYA-47 and lower in genotype VL SOYA-21. The antioxidant enzyme activities (superoxide dismutase, catalase, ascorbate peroxidase and glutathione reductase) was observed much higher in VL SOYA-21 than in VL SOYA-47 at various levels of NaCl treatments. From the results, it could be suggested that VL SOYA-21 is the salt tolerant and VL SOYA-47 is a salt sensitive soybean genotype. The tolerance capacity of VL SOYA-21 against NaCl stress can be related with the ability of this genotype in possessing vital photosynthetic system and ROS scavenging capacity.

scholarly journals Effect of water hyacinth compost on the morpho-physiological parameters of Soybean (Glycine max l.)

2021 ◽  
Vol 2 (1) ◽  
pp. 084-095
Author(s):  
Ogbuehi HC ◽  
Ibe PK
Keyword(s):  
Glycine Max ◽  
Leaf Area ◽  
Plant Height ◽  
Water Hyacinth ◽  
Seed Weight ◽  
Dry Weight ◽  
Effect Of Water ◽  
Shoot Dry Weight ◽  
Glycine Max L ◽  
Number Of Leaves

A pot experiment was conducted under rainfed condition to study the effect of water hyacinth compost on the morpho-physiological parameters of soybean (Glycine max L.) at the Teaching and Research Farm of Faculty of Agriculture and Veterinary Medicine, Imo State University, Owerri. The treatments were control (T1) 100g (T2), 150g (T3) and 200g (T4) of water hyacinth compost and replicated four times. The treatments were arranged in Complete Randomized Design (CRD). The parameters measured were plant height, number of leaves, leaf area (cm2), leaf area index, relative growth rate (RGR), Net assimilation rate (NAR), shoot dry weight(g), yield and yield components (Number of pods, pods weight, 100 seed weight). The results obtained indicated that T3 significantly produced highest plant height (57.6cm) compare to control. While it was observed that T4 (200g) significantly produced the highest number of leaves (233.25), leaf area (631.80cm2), shoot dry weight (15.445g), number of pods (129.75), pod weights (25.38g) seed weight (7.23g) and yield (0.72kg/ha) relative to control and other treatment levels. Root parameters were also significantly improved by the rates of water hyacinth application compared to control. It will be worthy to note that there was no nodulation perhaps that was why the yield was poor. The results showed that soybean growth can effectively be improved with incorporation of water hyacinth into soil.

Sign in / Sign up

Export Citation Format

Share Document