Insidensi dan Sebaran Tungau Hama pada Pepaya di Pulau Lombok (Incidence and Distribution of Mites on Papaya in Lombok Island)

2021 ◽  
Vol 31 (1) ◽  
pp. 61
Author(s):  
Wieke Mei Dina ◽  
Sugeng Santoso ◽  
Tri Asmira Damayanti
Keyword(s):  
Mite Species ◽  
Distribution Analysis ◽  
Sampling Area ◽  
Pcr Assay ◽  
Panonychus Citri ◽  
First Report ◽  
Rdna Its2 ◽  
Dna Size ◽  
Lombok Island

<p>Tungau hama merupakan salah satu penyebab penurunan produksi pepaya di Pulau Lombok. Penelitian bertujuan menentukan insidensi, sebaran, dan identitas tungau hama pepaya di Pulau Lombok. Sebaran ditentukan berdasarkan insidensi tungau hama pada 50 lokasi pengambilan contoh dan tungau hama diidentifikasi secara morfologi dan molekuler berdasarkan runutan rDNA ITS2. Hasil penelitian menunjukkan terdapat 12 spesies tungau berdasarkan identifikasi morfologi, yaitu Aculops pelekassi, Calacarus carinatus, Brevipalpus californicus, B. obovatus, B. phoenicis, Tenuipalpus pasificus, Eutetranychus africanus, Panonychus citri, Tetranychus fijiensis, T. kanzawai, T. piercei, dan Tarsonemus bilobatus dengan insidensi berkisar antara 2–72%. Di antara spesies yang ditemukan, P. citri merupakan tungau hama dengan sebaran dan insidensi tertinggi (72%). Hasil analisis persebaran menunjukkan bahwa keanekaragaman spesies tungau hama pada tanaman pepaya di Pulau Lombok adalah tinggi dengan tingkat dominansi rendah dan tingkat kemerataan spesies yang tinggi. Uji PCR dan analisis runutan DNA berhasil mendeteksi dan mengidentifikasi enam spesies tungau hama, yaitu T. piercei, T. kanzawai, E. africanus, dan P. citri (Tetranychidae), pada 500–600 pb serta B. californicus dan B. phoenicis (Tenuipalpidae) pada 600–700 pb. Similaritas tertinggi ditemukan pada T. piercei dan T. kanzawai (100%). Ini merupakan laporan pertama keberadaan B. californicus sebagai hama pada tanaman pepaya di Pulau Lombok.</p><p><strong>Keywords</strong></p><p>Frekuensi kemunculan; PCR; Perunutan DNA; Sebaran</p><p><strong>Abstract</strong></p><p>Mites are one obstacle of papaya production in Lombok Island. Thus, the aim of research was to determine incidence, distribution and identity of mites on papaya plant in Lombok Island. Distribution is determined based on incidence of in 50 sampling area, while mites identified morphological and molecularly based on rDNA ITS2. This studies revealed that there were 12 species of mites based on morphological, namely Aculops pelekassi, Calacarus carinatus, Brevipalpus californicus, B. obovatus, B. phoenicis, Tenuipalpus pacificus Eutetranychus africanus, Panonychus citri, Tetranychus fijiensis, T. kanzawai, and T. pierce with an incidence ranging 2-72%. Among species found, P. citri has the highest distribution and incidence of 72%. The results of the distribution analysis showed that diversity of mite species was high, with low dominance and high evenness. PCR assay successfully amplified DNA of six species, namely T. piercei, T. kanzawai, E. africanus, P. citri with the DNA size of 500-600 bp and B. californicus, B. phoenicis with the DNA size of 600-700 bp. The highest similarity species was found on T .piercei and T. kanzawai (100%). This was the first report of B. californicus infestating on papaya in Lombok.</p>

scholarly journals First report of Berkeleyomyces basicola causing mango root rot and decline in India

Plant Disease ◽  
2020 ◽  
Author(s):  
Prabhat Kumar Shukla ◽  
Tahseen Fatima ◽  
Nidhi Kumari
Keyword(s):  
Root Rot ◽  
Fungal Pathogens ◽  
Mangifera Indica ◽  
Uttar Pradesh ◽  
Its2 Region ◽  
Mature Trees ◽  
Ceratocystis Fimbriata ◽  
First Report ◽  
Rdna Its2 ◽  
Mango Tree

Mango wilt has been a serious constraint in mango (Mangifera indica L.) production in several countries including India (Shukla et al. 2018). Although, several fungal pathogens have been reported associated with the disease, species of Ceratocystis, Verticillium and Lasiodiplodia have been found predominantly responsible for the wilt (Shukla et al. 2018). A twenty-seven-year old mango tree cv. Dashehari at Rehmankhera, Lucknow, Uttar Pradesh, India suffered sudden wilt (Fig. 1A) during February 2020. Though, symptoms were similar to Ceratocystis wilt, no gummosis was observed on trunk or branches which occurred in the majority of Ceratocystis fimbriata infected trees. The infected roots of the wilted tree exhibited dark brown to black discoloration in woody portions (Fig. 1B). Severely affected roots were completely rotten. Similar symptoms of root infection were observed in an additional 16 declining trees within an orchard of 120 trees total (Fig. 2). The infected hard wood samples from live roots of 16 declining and one wilted trees were utilized for isolation by placing stem tissue of discolored and normal colored tissue on surface sterilized fresh carrot discs placed in a moisture chamber (Fig. 1C) for 10 days. Out of 17 tree samples, isolates of Berkeleyomyces basicola (Berk. & Broome) W.J. Nel, Z.W. de Beer, T.A. Duong, M.J. Wingf. (Nel et al. 2018) obtained from 1 wilted and 9 declining trees were transferred to and maintained in pure culture on potato dextrose agar. Isolates were grown for 7 to 10 days at 23±1 °C temperature in the dark. The isolates were characterized by a greyish black compact mycelial colony (Fig. 1D). Two types of spores, endoconidia (phialospores) and chlamydospores (aleuriospores or amylospores) were observed under microscope. The endoconidia were hyaline, cylindrical in shape with 10 to 42 × 3 to 6 μm (n=50) in size (Fig. 1E). Chains of dark colored chlamydospores (3 to 7 spores in chain) of 24 to 52 × 10 to 12 μm (n=50) size were apparent (Fig. 1E&F). Molecular identification of the fungus isolated from the wilted tree was established by amplifying the ITS1-5.8 rDNA-ITS2 region of fungal genomic DNA and the set of ITS primers (ITS 1 and ITS4) (White et al. 1990) followed by sequencing. The sequence has been submitted to the NCBI database vide accession number MT786402. The present isolate (MT786402) shared >99 percent nucleotide similarity with other B. basicola isolates. The phylogenetic tree was constructed using the ITS1-5.8 rDNA-ITS2 sequences of other B. basicola isolates and other Thielaviopsis spp., C. fimbriata, Chalaropsis thielavioides through neighbor joining method using MEGAX software (Fig. 3) (Kumar et al. 2018). The present isolate formed a distinct cluster along with other B. basicola isolates in a separate clade. Koch's postulate was performed under a transparent polycarbonate sheet roof net house at 14.4 and 42.2 °C minimum and maximum temperatures, respectively. A 100 ml macerated culture suspension consisting of 1000 chlamydospores and endoconidia per ml suspension was inoculated in the rhizosphere of mango seedlings planted in sterilized soil filled in earthen pots, using ten replicates for inoculated and uninoculated plants. Symptoms of necrotic root tissue were observed 90 days after inoculation and were consistent with those observed in the field. The same fungus was re-isolated from infected roots and identity was confirmed. All control plants remained symptom-free and B. basicola was not isolated from the roots. Thus, we conclude that B. basicola is capable of causing root rot disease of mango. To the best of our knowledge this is the first report of B. basicola causing mango root rot and decline across the globe, hitherto unreported. The extent of the root necrosis symptoms associated with mature mango trees demonstrates the potential virulence of B. basicola, although its pathogenicity risk on healthy mature trees is still unknown. However, the possibility of severe losses to the mango industry in world number one mango producer country, India cannot be ruled out, if found widespread.

scholarly journals First report of Alternaria alternata causing leaf blight on little millet (Panicum sumatrense) in India.

Plant Disease ◽  
2020 ◽  
Author(s):  
Boda Praveen ◽  
A. Nagaraja ◽  
M. K. Prasanna Kumar ◽  
Devanna Pramesh ◽  
K. B. Palanna ◽  
...  
Keyword(s):  
Crop Yields ◽  
Disease Incidence ◽  
Leaf Blight ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Pcr Assay ◽  
Causal Organism ◽  
First Report ◽  
Little Millet

Little millet (LM) is a minor cereal crop grown in the Indian sub-continent. During October 2018, dark brown, circular to oval necrotic spots surrounded by concentric rings were observed on the upper leaf surface of the LM (cv. VS-13) grown in the fields of the University of Agricultural Sciences, Bengaluru, India (13.0784oN, 77.5793oE). As the disease progressed, infected leaves became blighted. Disease incidence up to 53% was recorded in 3 fields of 0.4-hectare area each. Thirty symptomatic leaves were collected to isolate the associated causal organism. The margins of diseased tissue were cut into 5 × 5-mm pieces, surface-sterilized in 75% ethanol for 45 seconds followed by 1% sodium hypochlorite for 1 min, finally rinsed in sterile distilled water five times and placed on PDA. After 7 days of incubation at 25°C, greyish fungal colonies appeared on PDA. Single-spore isolations were performed to obtain ten isolates. Pure cultures of the fungus initially produced light gray aerial mycelia that later turned to dark grey. All isolates formed obclavate to pyriform conidia measured 22.66-48.97μm long and 6.55-13.79µm wide with 1-3 longitudinal and 2-7 transverse septa with a short beak (2.55-13.26µm) (n=50). Based on the conidial morphology, the fungus was identified as Alternaria sp. Further, the taxonomic identity of all ten isolates was confirmed as A. alternata using species-specific primers (AAF2/AAR3, Konstantinova et al. 2002) in a PCR assay. Later, one of the isolate UASB1 was selected, and its internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), major allergen Alt a 1 (Alt a 1), major endo-polygalacturonase (endoPG), OPA10-2, and KOG1058 genes were amplified in PCR (White et al. 1990; Berbee et al. 1999; Woudenberg et al. 2015), and the resultant products were sequenced and deposited in the NCBI GenBank (ITS, MN919390; gapdh, MT637185; Alt a 1, MT882339; endoPG, MT882340; OPA10-2, MT882341; KOG1058, MT882342). Blastn analysis of ITS, gapdh, Alt a 1, endoPG, OPA10-2, KOG1058 gene sequences showed 99.62% (with AF347031), 97.36% (with AY278808), 99.58% (with AY563301), 99.10% (with JQ811978), 99.05% (with KP124632) and 99.23% (with KP125233) respectively, identity with reference strain CBS916.96 of A. alternata, confirming UASB1 isolate to be A. alternata. For pathogenicity assay, conidial suspension of UASB1 isolate was spray inoculated to ten healthy LM (cv. VS-13) plants (45 days old) maintained under protected conditions. The spore suspension was sprayed until runoff on healthy leaves, and ten healthy plants sprayed with sterile water served as controls. Later, all inoculated and control plants were covered with transparent polyethylene bags and were maintained in a greenhouse at 28±2 ◦C and 90% RH. The pathogenicity test was repeated three times. After 8 days post-inoculation, inoculated plants showed leaf blight symptoms as observed in the field, whereas no disease symptoms were observed on non-inoculated plants. Re-isolations were performed from inoculated plants, and the re-isolated pathogen was confirmed as A. alternata based on morphological and PCR assay (Konstantinova et al. 2002). No pathogens were isolated from control plants. There is an increasing acreage of LM crop in India, and this first report indicates the need for further studies on leaf blight management and the disease impacts on crop yields.

scholarly journals First Report on the Natural Occurrence of Cherry virus A in Mirabelle Plum (Prunus domestica var. insititia)

Plant Disease ◽  
2005 ◽  
Vol 89 (4) ◽  
pp. 433-433 ◽  
Author(s):  
L. Svanella-Dumas ◽  
A. Marais ◽  
P. Gentit ◽  
J. Lamorte ◽  
T. Candresse
Keyword(s):  
Natural Infection ◽  
Plant Viruses ◽  
Natural Occurrence ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Pcr Assay ◽  
First Report ◽  
Specific Pcr ◽  
Specific Pcr Assay ◽  
Prunus Spp

Cherry virus A (CVA) is a member of the Capillovirus genus (2). It was discovered serendipitously during cloning of the little cherry agent (2) and has since been shown to be relatively widespread in sweet and sour cherry (Prunus cerasus and P. avium) (2,3). It is currently unclear whether CVA is associated with any specific symptoms in these hosts. Although it can be transmitted by grafting and thus propagated in peach, it has not been reported to naturally infect any host other than cherry. Using a degenerate reverse transcription-polymerase chain reaction (RT-PCR) technique targeting a conserved region of the RNA-dependent RNA polymerase (RdRp) and allowing the amplification of members of the Trichovirus, Capillovirus, and Foveavirus genera of filamentous plant viruses (1), a number of symptomatic Prunus spp. germplasm were evaluated. Among these, a cv. Mirabelle dorée accession (Prunus domestica var. insititia P332) of French origin exhibited severe symptoms of rosetting, severe leaf and fruit deformation, and yellow mosaic occasionally turning necrotic. RT-PCR conducted on symptomatic samples produced an amplification product of the expected size (362 bp) in several independent experiments. Sequencing of these products yielded a single sequence (GenBank Accession No. AY792509) with 88.1% nucleotide identity and 93.2% amino acid identity with the type strain of CVA (2). Presence of a CVA isolate was independently confirmed using a CVA-specific PCR assay directly on the original plum material or following experimental transmission by grafting on several new hosts including apricot (P. armeniaca cv. Priana) and plum (P. domestica cv. Prune d'Ente). To our knowledge, this is the first report of natural infection of CVA in plum. The symptoms observed in the infected plum are reminiscent of those caused by severe Prune dwarf virus (PDV) strains. Infection by PDV was confirmed using a PDV-specific PCR assay. The contribution, if any, of CVA to the symptoms observed remains to be evaluated. These findings suggest that the possible presence of CVA in noncherry Prunus spp. hosts should be taken into consideration by quarantine and certification programs. References: (1) X. Foissac et al. Acta Hortic. 550:3743, 2001. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995. (3) M. J. Kirby et al. Plant Pathol. 50:6, 2001.

scholarly journals Five New Records of Raphignathoid Mites (Acari: Raphignathoidea) from Poland/ Pięć Nowych Gatunków Roztoczy Z Nadrodziny Raphignathoidea (Acari) Stwierdzonych W Faunie Polski

2014 ◽  
Vol 59 (1-4) ◽  
pp. 1-6 ◽  
Author(s):  
Salih Doðan ◽  
Sevgi Sevsay ◽  
Joanna Mąkol ◽  
Erhan Zeytun ◽  
Evren Buğa
Keyword(s):  
New Records ◽  
Mite Species ◽  
First Report ◽  
The Family

Abstract Five raphignathoid (Acari: Raphignathoidea) mite species, including three of family Stigmaeidae, Eustigmaeus rhodomela (KOCH), Mediolata obtecta DÖNEL and DOĞAN, Stigmaeus glabrisetus SUMMERS, one of Cryptognathidae, Favognathus cucurbita (BERLESE), and one of Barbutiidae, Barbutia anguineus (BERLESE), are recorded as new for the Polish fauna. This is the first report of the family Barbutiidae from Poland.

scholarly journals Updated and annotated review of Tetranychidae occurring in mainland Portugal, the Azores, and Madeira Archipelagos

Acarologia ◽  
2021 ◽  
Vol 61 (2) ◽  
pp. 380-393
Author(s):  
Pedro Naves ◽  
Filomena Nóbrega ◽  
Philippe Auger
Keyword(s):  
Scientific Information ◽  
National Level ◽  
First Record ◽  
Relevant Information ◽  
Spider Mites ◽  
Mite Species ◽  
Tetranychus Kanzawai ◽  
Panonychus Citri ◽  
New Host ◽  
Mainland Portugal

Data on the diversity, distribution, and main hosts of spider mites (Acari: Tetranychidae) are scarce in the Iberian Peninsula, particularly for Portugal, where only 21 species are recorded on the mainland and in the Azores and Madeira archipelagos. Moreover, the scientific information is mainly available in national publications, and difficult to access for international researchers. In this paper, we review the literature dealing with spider mites in mainland Portugal and the archipelagos of the Azores and Madeira, compiling and synthesizing the most relevant information on their distribution, hosts and pest potential. Further information was obtained by verifying slides in the acarological collection of the Instituto Nacional de Investigação Agrária e Veterinária (INIAV), the most important national collection, and by verifying mites collected on different plant hosts during the period 2018-2020. In total, we found records for 28 spider mite species in Portugal, comprising nine Bryobiinae and 19 Tetranychinae, and including new national records for Stigmaeopsis nanjingensis and Eotetranychus tiliarium. Additionally, we record a new exotic mite species for the mainland, Eotetranychus lewisi, which was found in two localities in the Algarve District on leaves of Euphorbia pulcherrima. This is the first record for continental Europe of an established population in outdoor conditions of this regulated quarantine pest. We also comment on the presence of seven species not reported by international taxonomic databases but already recorded from Portugal: Aplonobia histricina, Eotetranychus rubiphilus, Schizonobia sycophanta, Tetranychus kanzawai and Tetranycopsis horridus (at a national level), and Oligonychus perseae and Panonychus citri (for the mainland). New host records are given for Bryobia praetiosa, Petrobia (Tetranychina) harti, S. sycophanta, E. coryli, E. rubiphilus, Tetranychus kanzawai, Tetranychus lintearius, Tetranychus ludeni and Tetranychus turkestani.

scholarly journals The first report of the prevalence of Nosema ceranae in Bulgaria

PeerJ ◽  
2018 ◽  
Vol 6 ◽  
pp. e4252 ◽  
Author(s):  
Rositsa Shumkova ◽  
Ani Georgieva ◽  
Georgi Radoslavov ◽  
Daniela Sirakova ◽  
Gyulnas Dzhebir ◽  
...  
Keyword(s):  
Apis Mellifera ◽  
Honey Bee ◽  
Molecular Detection ◽  
Ssu Rdna ◽  
Nosema Ceranae ◽  
Nosema Apis ◽  
Pcr Assay ◽  
First Report ◽  
Duplex Pcr Assay ◽  
Different Parts

Nosema apis and Nosema ceranae are the two main microsporidian parasites causing nosematosis in the honey bee Apis mellifera. The aim of the present study is to investigate the presence of Nosema apis and Nosema ceranae in the area of Bulgaria. The 16S (SSU) rDNA gene region was chosen for analysis. A duplex PCR assay was performed on 108 honey bee samples from three different parts of the country (South, North and West Bulgaria). The results showed that the samples from the northern part of the country were with the highest prevalence (77.2%) for Nosema ceranae while those from the mountainous parts (the Rodopa Mountains, South Bulgaria) were with the lowest rate (13.9%). Infection with Nosema apis alone and co-infection N. apis/N. ceranae were not detected in any samples. These findings suggest that Nosema ceranae is the dominant species in the Bulgarian honey bee. It is not known when the introduction of Nosema ceranae in Bulgaria has occurred, but as in the rest of the world, this species has become the dominant one in Bulgarian Apis mellifera. In conclusion, this is the first report for molecular detection of Nosema infection of honey bee in Bulgaria. The results showed that N. ceranae is the main Nosema species in Bulgaria.

scholarly journals First Report of Fusarium Wilt on Philotheca myoporoides Caused by Fusarium oxysporum in Italy

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 877-877 ◽  
Author(s):  
G. Polizzi ◽  
D. Aiello ◽  
V. Guarnaccia ◽  
A. Vitale ◽  
G. Perrone ◽  
...  
Keyword(s):  
Fusarium Oxysporum ◽  
Fusarium Wilt ◽  
Morphological Characteristics ◽  
Plant Production ◽  
Pathogenicity Test ◽  
Gene Sequences ◽  
Pcr Assay ◽  
First Report ◽  
Gene Coding ◽  
Eastern Australia

Philotheca myoporoides (DC.) M.J. Bayly (previously known as Eriostemon myoporoides), commonly called long-leaf waxflower and native to eastern Australia (Rutaceae family), is a hardy compact shrub or small tree occurring in subtropical to cool temperate regions. P. myoporoides is cultivated in Sicily (Italy) for its ornamental appeal. During April of 2010, a widespread wilting was observed on approximately 80% of 2,000 1-year-old, potted long-leaf waxflower plants grown in a commercial nursery near Catania (eastern Sicily, Italy). Internally, symptomatic plants had conspicuous vascular brown discoloration from the crown to the canopy. Diseased crown and stem tissues of 20 plants were surface disinfested for 30 s in 1% NaOCl, rinsed in sterile water, plated on potato dextrose agar (PDA) amended with 100 mg/liter of streptomycin sulfate, and incubated at 25°C. A Fusarium sp. was consistently isolated from affected plant tissues. Colonies with white or light purple aerial mycelia and violet pigmentation on the underside of the cultures developed after 9 days. On carnation leaf agar, 20 single-spore isolates produced microconidia on short monophialides, macroconidia that were three to five septate with a pedicellate base, and solitary and double-celled or aggregate chlamydospores. A PCR assay was conducted on one representative isolate (ITEM 13490) by analyzing sequences of the benA gene (coding β-tubulin protein) and CaM gene (coding calmodulin protein) using the primers reported by O'Donnell et al. (1). The benA gene sequences of ITEM 13490 (GenBank No. FR828825) exhibited an identity of 100% to Fusarium oxysporum f. sp. radicis-lycopersici strain ATCC 52429 (GenBank No. DQ092480). CaM gene sequences of ITEM 13490 (GenBank No. FR828826) exhibited an identity of 99.6% to F. oxysporum strain ITEM 2367 (GenBank No. AJ560774). Morphological characteristics of the 20 isolates, as well as the PCR assay on a representative strain, identified the isolates associated with disease symptoms as F. oxysporum Schlechtend.:Fr. A pathogenicity test was performed by placing two 1-cm2 plugs of PDA from 9-day-old mycelial cultures near the crown on potted, healthy, 2-month-old cuttings of P. myoporoides. Thirty plants were inoculated with strain ITEM 13490 and the same number of plants served as noninoculated controls. All plants were enclosed for 4 days in plastic bags and placed in a growth chamber at 25 ± 1°C. Plants were then moved to a greenhouse where temperatures ranged from 23 to 27°C. First symptoms, which were identical to those observed in the nursery, developed on one plant 15 days after inoculation. Wilting was detected on all plants after 30 days. Control plants remained symptomless. F. oxysporum was successfully reisolated from symptomatic crown and stem tissues and identified as described above, fulfilling Koch's postulates. To our knowledge, this is the first report of F. oxysporum causing disease of P. myoporoides worldwide. Moreover, this pathogen was recently reported in the same nursery on Eremophila sp. (2), confirming the presence of Fusarium wilt as a potential threat to ornamental plant production in this area, and necessitates the innovation and development of disinfection methods for alveolar trays, greenhouses, and various propagation materials to reduce future disease outbreaks. References: (1) K. O'Donnell et al. Mycoscience 41:61, 2000. (2) G. Polizzi et al. Plant Dis 94:1509, 2010.

scholarly journals First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 75-75 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
C. Córdoba-Sellés ◽  
T. Tornos ◽  
M. C. Cebrián ◽  
M. I. Font
Keyword(s):  
Plant Viruses ◽  
Dwarf Virus ◽  
Eastern Coast ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Specific Primers ◽  
First Report ◽  
Type Isolate ◽  
The Mean ◽  
Pittosporum Tobira

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

scholarly journals First Report of Oleander Leaf Scorch Caused by Xylella fastidiosa in Florida

Plant Disease ◽  
2000 ◽  
Vol 84 (2) ◽  
pp. 198-198 ◽  
Author(s):  
R. L. Wichman ◽  
D. L. Hopkins ◽  
T. A. Wichman
Keyword(s):  
Xylella Fastidiosa ◽  
Trisodium Citrate ◽  
Nerium Oleander ◽  
Sodium Ascorbate ◽  
Eastern United States ◽  
Pcr Assay ◽  
First Report ◽  
Leaf Scorch ◽  
Chlorotic Mottling ◽  
Specific Amplification

During the spring of 1998, mature oleanders (Nerium oleander L.), pruned to form a 2-m-high hedge along an interstate highway in Orlando, FL, were observed declining and dying. Numerous plants along a 200-m section of highway were in various stages of decline. Symptoms began as chlorotic mottling along the edges of leaves and as the disease progressed, mottling became more severe and leaf margins became necrotic. Scorched leaves died, and symptoms spread throughout the plants, resulting in defoliation. New growth from the base of affected plants was stunted and severely mottled. Petioles and leaf midribs were taken from leaves with mottling symptoms and assayed for the presence of Xylella fastidiosa by polymerase chain reaction (PCR) and culturing on periwinkle wilt agar medium. For PCR assay, infected tissue from three plants was extracted by grinding in SCP buffer (1.0 g of trisodium citrate and 1.0 g of disodium succinate per liter, in 0.015 M phosphate buffer, pH 7.0) containing 0.02 M sodium ascorbate and 5% acid-washed polyvinylpyrrolidone. Amplification was performed with primers RST31 and RST33, as previously described, for specific detection of X. fastidiosa strains (1). A X. fastidiosa-specific amplification product was produced from all three extracts. For culturing, petioles and leaf midribs were cut into 0.5-cm sections, and sap was extracted from the tissue by squeezing with a forceps. Sap was blotted directly onto the medium and incubated at 28°C. Colonies typical of X. fastidiosa were observed after 10 to 14 days of incubation, and single colonies were transferred to fresh periwinkle wilt agar. The colonies were confirmed as X. fastidiosa by PCR assay. Two of the oleander strains were used to inoculate three red and three white 18-month-old oleanders by needle-puncture of the stem through a cloudy drop of bacterium in SCP buffer (108 CFU/ml). For controls, three red and three white oleanders were inoculated with SCP buffer alone. After 9 weeks in a screenhouse, marginal leaf mottling was observed in both the red and white oleanders inoculated with X. fastidiosa, and the bacterium was reisolated from leaves as described above, completing Koch's postulates. Control plants remained symptomless. Oleander leaf scorch caused by X. fastidiosa has been described previously in California and Texas (2). This is the first report of oleander leaf scorch in Florida and the eastern United States. References: (1) G. V. Minsavage et al. Phytopathology 84:456, 1994. (2) A. H. Purcell et al. Phytopathology 89:53, 1999.

Sign in / Sign up

Export Citation Format

Share Document