Presence of a chelydrid turtle in the late Pliocene Camp dels Ninots locality (Spain)

2014 ◽  
Vol 185 (4) ◽  
pp. 253-256 ◽  
Author(s):  
Julien Claude ◽  
Bruno Gomez de Soler ◽  
Gerard Campeny ◽  
Jordi Agusti ◽  
Oriol Oms
Keyword(s):  
Iberian Peninsula ◽  
Time Distribution ◽  
New Taxon ◽  
Late Pliocene ◽  
First Report ◽  
Vertebrate Fauna ◽  
Space And Time ◽  
Snapping Turtles ◽  
Mauremys Leprosa ◽  
Living Species

Abstract The late Pliocene locality Camp dels Ninots is a fossil Lagerstätte that yielded an exceptionally well preserved vertebrate fauna. Several turtles were reported from this locality and were all assigned to the living species Mauremys leprosa. We describe here a second turtle taxon based on carapace material. This new taxon is identified as Chelydropsis cf. pontica. It is the first report of a chelydrid turtle in the Pliocene of the Iberian peninsula. This discovery extends the range of the species to the southwest of Europe and thereby better documents the space and time distribution of snapping turtles before their supposedly rapid disappearance in Europe.

Helminths from the red-eared slider Trachemys scripta elegans (Chelonia: Emydidae) in marshes from the eastern Iberian Peninsula: first report of Telorchis attenuata (Digenea: Telorchiidae)

2014 ◽  
Vol 28 ◽  
Author(s):  
Jesús Cardells ◽  
María Magdalena Garijo ◽  
Clara Marín ◽  
Santiago Vera
Keyword(s):  
Iberian Peninsula ◽  
Intestinal Tract ◽  
Trachemys Scripta ◽  
Trachemys Scripta Elegans ◽  
Emys Orbicularis ◽  
First Report ◽  
Digenean Trematode ◽  
Limited Sampling ◽  
Mauremys Leprosa ◽  
New Habitats

The present work describes the presence of a digenean in the red-eared turtle Trachemys scripta elegans (Wied-Neuwied, 1839) in marshes of the Valencian Community. The faeces and intestinal tract of 105 animals were examined. Only one helminth species was found and identified as the digenean trematode Telorchis atenuatta (Goldberger, 1911), present in the 7.6% of the animals analysed. This is the first report of the parasite in sliders from Spain. Although conclusions are preliminary due to the limited sampling, our results suggest that the presence of red-eared turtles in new habitats may increase the risk of introducing new microorganisms and new diseases with them, altering the sanitary status of the autochthonous terrapins Mauremys leprosa (Schweigger, 1812) and Emys orbicularis (Linnaeus, 1758).

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Camelostrongylus mentulatusin domestic goats from the Iberian Peninsula

2003 ◽  
Vol 77 (4) ◽  
pp. 371-372 ◽  
Author(s):  
M.R. Ruiz de Ybáñez ◽  
M.M. Garijo ◽  
M. Carpintero ◽  
C. Martínez-Carrasco ◽  
J.M. Ortiz
Keyword(s):  
Iberian Peninsula ◽  
First Report ◽  
South Eastern ◽  
Camelostrongylus Mentulatus

AbstractTwo male worms ofCamelostrongylus mentulatuswere found in one of 84 murciano-granadina goats in Murcia, south-eastern Spain. This is the first report ofC. mentulatusin goats in the Iberian peninsula and the possible origin and transmission of this nematode in Spain are discussed.

Presence of the leech Placobdella costata in the south of the Iberian Peninsula

2014 ◽  
Vol 59 (2) ◽  
Author(s):  
David Romero ◽  
Jesús Duarte ◽  
Lucía Narváez-Ledesma ◽  
Miguel Farfán ◽  
Raimundo Real
Keyword(s):  
North America ◽  
Iberian Peninsula ◽  
Fresh Water ◽  
Mediterranean Area ◽  
Southern Spain ◽  
Freshwater Turtle ◽  
Emys Orbicularis ◽  
The North ◽  
Mauremys Leprosa ◽  
Fragmented Population

AbstractPlacobdella costata is a leech specific to freshwater turtle Emys orbicularis. Both genera are native to North America and have co-evolved and undergone dispersion through the Palearctic. The leech is present throughout the Mediterranean area, always associated with E. orbicularis. Their only known presence in the Iberian Peninsula is in the north and center of the peninsula. Here we present the first description of the leech in southern Spain (Andalusia) in association with a small fragmented population of fresh-water turtles in which E. orbicularis and Mauremys leprosa coexist. Unusually, the leech was found attached to the carapace of a male M. leprosa.

Space and time distribution of HF excited Langmuir turbulence in the ionosphere: Comparison of theory and experiment

1993 ◽  
Vol 98 (A10) ◽  
pp. 17543 ◽  
Author(s):  
D. F. Dubois ◽  
Alfred Hanssen ◽  
Harvey A. Rose ◽  
David Russell
Keyword(s):  
Time Distribution ◽  
Langmuir Turbulence ◽  
Space And Time ◽  
Theory And Experiment

Space and time distribution of the intermediate focal depth earthquakes in the Hellenic arc

1980 ◽  
Vol 70 (3-4) ◽  
pp. T35-T47 ◽  
Author(s):  
P.E. Comninakis ◽  
B.C. Papazachos
Keyword(s):  
Time Distribution ◽  
Focal Depth ◽  
Space And Time ◽  
Hellenic Arc

scholarly journals First report on the helminthfauna of the yellow-necked mouse, Apodemus flavicollis, in the Iberian Peninsula

2016 ◽  
Vol 53 (3) ◽  
pp. 294-297 ◽  
Author(s):  
Á. L. Debenedetti ◽  
S. Sainz-Elipe ◽  
S. Sáez-Durán ◽  
D. Galicia ◽  
A. Imaz ◽  
...  
Keyword(s):  
Iberian Peninsula ◽  
Total Sample ◽  
Helminth Parasites ◽  
Apodemus Flavicollis ◽  
Helminth Community ◽  
Trichuris Muris ◽  
Heligmosomoides Polygyrus ◽  
First Report ◽  
Calodium Hepaticum ◽  
Yellow Necked Mouse

Summary Information about the prevalence of helminth parasites of the yellow-necked mouse, Apodemus flavicollis, in the Iberian Peninsula is almost non-existent and there is no reliable data reported from Spain. Fourteen A. flavicollis from the Erro River valley (Navarre, Spain) were examined for endoparasites, between February 2001 and July 2002. Thirteen specimens (92.9 %) of the total sample were parasitized by at least one of the following six helminth species: one trematode (Corrigia vitta), one cestode (Taenia parva larvae) and four nematodes (Trichuris muris, Calodium hepaticum, Heligmosomoides polygyrus and Syphacia stroma). This is the first report about the helminthfauna of A. flavicollis in the Iberian Peninsula. Nevertheless, a larger number of hosts should be analysed to complete these preliminary results and to adequately characterize the helminth community of this rodent. The finding of C. hepaticum, the causative agent of human capillarosis, stands out.

scholarly journals Endochondral bone in an Early Devonian ‘placoderm’ from Mongolia

2020 ◽  
Author(s):  
Martin D. Brazeau ◽  
Sam Giles ◽  
Richard P. Dearden ◽  
Anna Jerve ◽  
Y.A. Ariunchimeg ◽  
...  
Keyword(s):  
Phylogenetic Analyses ◽  
Sister Group ◽  
New Taxon ◽  
Endochondral Bone ◽  
Early Devonian ◽  
Skeletal Tissue ◽  
Bony Fishes ◽  
Computed Microtomography ◽  
Living Species ◽  
X Ray Computed

Endochondral bone is the main internal skeletal tissue of nearly all osteichthyans—the group comprising more than 60,000 living species of bony fishes and tetrapods. Chondrichthyans (sharks and their kin) are the living sister group of osteichthyans and have cartilaginous endoskeletons, long considered the ancestral condition for all jawed vertebrates (gnathostomes). The absence of bone in modern jawless fishes and the absence of endochondral ossification in early fossil gnathostomes appears to lend support to this conclusion. Here we report the discovery of extensive endochondral bone in Minjinia turgenensis, a new genus and species of ‘placoderm’-like fish from the Early Devonian (Pragian) of western Mongolia described using x-ray computed microtomography (XR-µCT). The fossil consists of a partial skull roof and braincase with anatomical details providing strong evidence of placement in the gnathostome stem group. However, its endochondral space is filled with an extensive network of fine trabeculae resembling the endochondral bone of osteichthyans. Phylogenetic analyses place this new taxon as a proximate sister group of the gnathostome crown. These results provide direct support for theories of generalised bone loss in chondrichthyans. Furthermore, they revive theories of a phylogenetically deeper origin of endochondral bone and its absence in chondrichthyans as a secondary condition.

Sign in / Sign up

Export Citation Format

Share Document