Development, Popularization and Application of An Online OvAge Calculator: Qualitative Study Based on the WeChat Mini Program (Preprint)

2020 ◽  
Author(s):  
Wenwen Xu ◽  
Hui Wang ◽  
Zheng Zhu ◽  
Quan Wang ◽  
Jing Jin ◽  
...  
Keyword(s):  
Predictive Model ◽  
Ovarian Reserve ◽  
Chinese Women ◽  
Polycystic Ovary ◽  
Statistical Significance ◽  
Clinical Samples ◽  
Clinical Markers ◽  
Clinical Trial Registry ◽  
Specificity And Sensitivity ◽  
Short Period

BACKGROUND At present, there are many clinical markers and models to assess ovarian reserve, but none of them are ideal. The number of clinical samples is a key factor limiting the specificity and sensitivity of the markers and models, and traditional methods of subject recruitment are time and vigor. In addition, the model of ovarian reserve assessment for Chinese women need to be further explored. OBJECTIVE To explore the possibility of self-reporting for subjects through the WeChat mini program, and provide more data support for further optimization of the OvAge model, and to develop a predictive model of ovarian reserve that is specific to Chinese women. METHODS In this paper, with reference to the existing OvAge model, we developed an online OvAge calculator based on the WeChat mini program for data collection, and then applied the generalized linear model theory to obtain a predictive model of ovarian reserve which is in line with the characteristics of Chinese women. RESULTS Compared to traditional recruiting methods, the online OvAge calculator is able to collect a large number of samples in a short period of time, which is efficient and convenient. Optimized model of estimated OvAge =exp (3.5254-0.001*PRL-0.0231*AMH). This model showed a high statistical significance for each marker included in the equation. We applied the final equation on diminished ovarian reserve and polycystic ovary syndrome datasets and obtained a mean of predicted ovarian age significantly different from the mean of chronological age in both groups. CONCLUSIONS The OvAge calculator based on the WeChat mini program is a novel online subject self-reporting system that can collect many samples in a short period of time, continuously optimize the model and update the mini program version, which is economical, time-saving and efficient., and is worthy of promotion. In addition, the optimized OvAge model is suitable for Chinese women and provides a reference for clinical assessment of ovarian reserve. CLINICALTRIAL The study was approved by Chinese Clinical Trial Registry (registration No. ChiCTR2000037522) and Medical ethics committee of Jiangsu Province Hospital of Chinese Medicine (approved No. 2019NL-152-02).

scholarly journals Development, Popularization and Application of An Online OvAge Calculator Based on Subject Self-reporting System

2020 ◽  
Author(s):  
Wenwen Xu ◽  
Zheng Zhu ◽  
Quan Wang ◽  
Jing Jin ◽  
Haiyang Zhao ◽  
...  
Keyword(s):  
Predictive Model ◽  
Ovarian Reserve ◽  
Reporting System ◽  
Chinese Women ◽  
Polycystic Ovary ◽  
Statistical Significance ◽  
Clinical Samples ◽  
Clinical Markers ◽  
Specificity And Sensitivity ◽  
Short Period

Abstract Background: At present, there are many clinical markers and models to assess ovarian reserve, but none of them are ideal. The number of clinical samples is a key factor limiting the specificity and sensitivity of the markers and models, and traditional methods of subject recruitment are time and vigor. In addition, the model of ovarian reserve assessment for Chinese women need to be further explored.Objective: To explore the possibility of self-reporting for subjects through the WeChat mini program, and provide more data support for further optimization of the OvAge model, and to develop a predictive model of ovarian reserve that is specific to Chinese women.Methods: In this paper, with reference to the existing OvAge model, we developed an online OvAge calculator based on the WeChat mini program for data collection, and then applied the generalized linear model theory to obtain a predictive model of ovarian reserve which is in line with the characteristics of Chinese women.Results: Compared to traditional recruiting methods, the online OvAge calculator is able to collect a large number of samples in a short period of time, which is efficient and convenient. Optimized model of estimated OvAge =exp (3.5254-0.001*PRL-0.0231*AMH). This model showed a high statistical significance for each marker included in the equation. We applied the final equation on diminished ovarian reserve and polycystic ovary syndrome datasets and obtained a mean of predicted ovarian age significantly different from the mean of chronological age in both groups.Conclusions: The OvAge calculator based on the WeChat mini program is a novel online subject self-reporting system that can collect a large number of samples in a short period of time, continuously optimize the model and update the mini program version, which is economical, time-saving and efficient., and is worthy of promotion. In addition, the optimized OvAge model is suitable for Chinese women and provides a reference for clinical assessment of ovarian reserve.

EFFECT OF AROMATASE INIBITOR IN OVULATION INDUCTION IN FETILE WOMEN WITH POLYCYSTIC OVARY SYNDROME

2014 ◽  
pp. 86-93
Author(s):  
Minh Tam Le
Keyword(s):  
Polycystic Ovary Syndrome ◽  
Ovulation Induction ◽  
Polycystic Ovary ◽  
Endometrial Thickness ◽  
Statistical Significance ◽  
Ovulation Rate ◽  
Normal Body Mass Index ◽  
Ovary Syndrome ◽  
Group I ◽  
First Choice

Backgrounds: Polycystic Ovary Syndrome (PCOS) is one of the most common causes of female infertility due to ovulation disorders. Clomiphene citrate (CC) is a first choice to restore ovulation but it has some side effects by estrogen receptor down-regulation. Aromatase inhibitor (AI) is a newer class of drugs which increases the production of endogenous FSH to stimulate ovulation. Subjects and methods: randomized control trial to compare 64 cases of infertile women with PCOS examined at the Hue University Hospital, alternately used AI (group I) or CC (group II) for ovulation induction from day 2 cycle. Follow-up follicle growth, endometrium and ovulation via ultrasound. Evaluation were done on 10th day cycle, day of hCG trigger and after administration of hCG. Results: Total of 64 PCOS cases distributed into 2 groups using alternatively AI and CC had similar characteristics with average age of 28.8 ± 4.6, the majority were primary infertility (84.4%), infertility duration was 2.6 ± 2.4 years, 85.9% had oligomenorrhrea or amenorrhea, normal body mass index accounts for 60.9% and 21.9% was lean. Evaluation of both groups on day 10 revealed no differences in the dominant follicle and endometrial thickness. Number of days until the follicle mature appears to be shorter in AI group (15.1 ± 2.9) compared to the CC group (16.5 ± 2.8) with statistical significance. The number of mature follicles in 2 groups were not different at a rate of 81.3% (AI) and 84.4% (CC) but a higher proportion of single mature follicle in the AI ​​group (71.9%) compared with the CC group (65.7%) and There is no case with 3-4 mature follicles in the AI group. The rate of thin endometrium (<8 mm) in the AI group (25%) was lower than the CC group (53.1%) with statistically significance and higher ovulation rate (68.8%) compared with the CC group (56.3%) but have not found statistically significant. Conclusion: Two drugs AI and CC potentially induce follicle development and ovulation similarly, but AI has the potential to be more effective than CC on factors such as the shorter stimulation duration, increasing rate of single follicle, limiting multiple pregnancies, improve endometrial thickness and higher ovulation rate. More researches are needed with a larger sample size to clarify the statistical significance of differences.

scholarly journals Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari
Keyword(s):  
Point Of Care ◽  
Hemorrhagic Fever ◽  
Diagnostic Methods ◽  
Clinical Samples ◽  
Crimean Congo Hemorrhagic Fever ◽  
Point Of Care Test ◽  
Specificity And Sensitivity ◽  
Rural And Remote Areas ◽  
Cchf Virus ◽  
Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

scholarly journals Hepatic Alveolar Echinococcosis: the Possibilities of Ultrasonographyin the Planning of Surgical Operation

2017 ◽  
pp. 32-48
Author(s):  
O. I. Ashivkina
Keyword(s):  
Liver Resection ◽  
Alveolar Echinococcosis ◽  
New Technologies ◽  
Statistical Significance ◽  
Vena Cava ◽  
Hepatic Veins ◽  
Surgical Operation ◽  
Curative Therapy ◽  
Specificity And Sensitivity ◽  
Ct And Mri

Alveolar echinococcosis (AE) is a rare anthropozoonotic parasitic disease, which can affects the liver, lungs and other organs. R0-radical liver resection is the sole curative therapy for the patients with AE. Size of the parasitic foci, distant dissemination, and involvement of main liver vessels – all this information allows the surgeon to make the right decision about practicability and volume of operation. Formerly, ultrasonography (US) was not method of choice for the qualitative pre-operative diagnostic of AE. Nevertheless nowadays development of new technologies allows US to be an equal to CT and MRI.The aim:to estimate the possibilities of US in the planning of surgery in patients with AE.Materials and methods.The data of 64 patients who were undergone complete liver resection or reduction surgery in A.V. Vishnevsky Surgery Institute in period from January 2008 to December 2016 we respectively analyzed. Specificity and sensitivity of US, CT and MRI were analyzed and ROC-curves were constructed. Statistical significance was calculated using Chi-square.Results.The efficiency of US was significantly comparable to CT and MRI when we analyzed the involved of porta hepatis, vena cava, hepatic veins. Assessment of involvement of liver arteries and vena porta was not statistical significant.Conclusion.Accumulated experience of A.V. Vishnevsky Surgery Institute shows the possibility of qualitative preoperationUS evaluation of AE-lesion, which has to include assessment of distant dissemination and involvement of the liver main vessels. In a big surgical hospitals, which has an experience of AE treatment, pre-operative US can become the method of choice in planning of surgical operation. 

scholarly journals High preanalytical non-compliance and samples rejection rate in clinical biochemistry laboratory are decreased by nurse staff training in phlebotomy and sample handling

2020 ◽  
Vol 13 (3) ◽  
pp. 113-118
Author(s):  
Modibo Coulibaly ◽  
Abdelaye Keita ◽  
Moussa Diawara ◽  
Valentin Sagara ◽  
Brehima Traoré ◽  
...  
Keyword(s):  
Staff Training ◽  
Clinical Biochemistry ◽  
Statistical Significance ◽  
Venous Blood ◽  
Diagnostic Errors ◽  
Hospital Staff ◽  
Clinical Samples ◽  
Sample Handling ◽  
Significant Difference ◽  
Clinical Biochemistry Laboratory

Background: Preanalytical phase of biomedical analysis remains an important source of diagnostic errors that deserves special attention. This study aims to evaluate the training in phlebotomy and sample handling impact on the preanalytical non-compliances. Material and Methods: we performed a prospective study before and after staff training in phlebotomy and sample handling by systematically recording all clinical samples non-compliances. First, we assessed and describe the non-compliance baseline rate from January to December 2017 in the clinical biochemistry laboratory of Hôpital Sominé DOLO de Mopti. After two sessions of one week staff training in January 2018, we performed the same study from January to December 2018. We compared the proportions of non-compliances between the two assessments. Data were collected on the case report forms, captured in Excel and analyzed by R software for (Mac) OS X version 4.0.3. Pearson Ch2 or Fisher exact tests were used for the comparison of proportions. The statistical significance was set at p < 5%. Results: a total of 27,810 venous blood samples were received during the study period; 48% was for biochemistry, 41% for immuno-serology, 9% for blood cell count and 2% for coagulation tests. There were 3,826 instances of preanalytical non-compliances (13.76%) identified that led to sample rejection. Out of the 11 types of non-compliances investigated, 5 (45.4%) accounted for nearly 91% of the problems: insufficient sample volume (28.9%), hemolyzed samples (20.5%), inappropriate collection time (17.8%), sample clot (12.9%), and inappropriate sample collection tube (10.8%). We observed a significant difference in rates of non-compliance between inpatients and outpatients samples (44.4% vs 7.3%; p < 0.001). The proportion of non-compliance have significatively decreased after the two training sessions of hospital staff in phlebotomy and sample handling 3,826/27,810 (13.8%) vs 3,009/32,476 (9.3%); p < 0.001. Conclusion: we report a significantly higher rate of non-compliance in inpatients. Hospital staff training in phlebotomy and sample handling reduce the proportion of preanalytical non-compliance and thereby improve patient management and safety.

Sign in / Sign up

Export Citation Format

Share Document