scholarly journals DESAIN TAQMAN PROBE SECARA IN SILICO SEBAGAI PENDETEKSI MUTASI PADA KODON 516 GEN rpoB Mycobacterium tuberculosis UNTUK METODE REAL-TIME PCR

2017 ◽  
Vol 4 (1) ◽  
pp. 22
Author(s):  
Dek Pueteri Dewi Suryani ◽  
Putu Sanna Yustiantara ◽  
Sagung Chandra Yowani
Keyword(s):  
Mycobacterium Tuberculosis ◽  
Real Time ◽  
Aspartic Acid ◽  
Real Time Pcr ◽  
In Silico ◽  
Rpob Gene ◽  
Taqman Probe ◽  
Probe Design ◽  
Accession Number ◽  
Pcr Method

The aim of this research was to in silico design of TaqMan probe. Design of TaqMan probe were conducted using software Clone Manager Suite 6. As a template, the rpoB gene of M. tuberculosis H37Rv (accession number U12205.1) was used. The results of this research were 8 sequences such as, R516MV-2, R516MV-3, R516MV-4, R516MV-5, R516MV-7, R516MV-8, R516MV-11, R516MV-13. These sequences were met the criteria of TaqMan probe, such as length of nucleotide (23-28 nucleotide), Tm value (72ºC), %GC (50-58%), runs and repeats (?4 bases), dimer structure in accordance to the requirements and does not form hairpin structures. In addition, these sequences were met labeling criteria of TaqMan probe which are including the location of G bases and the number of G-C bases in sequences. Therefore, these sequences could be labeled by FAM (reporter) at 5' end and TAMRA (quencher) at 3' end. The conclusion of this research, the sequences were met the criteria of TaqMan probe. Therefore, it could be targeted to detect mutations at codon 516 with a change of aspartic acid into valine (GAC ? GTC) by using real-time PCR method.

scholarly journals Efficient nested-PCR-based method development for detection and genotype identification of Acanthamoeba from a small volume of aquatic environmental sample

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tsui-Kang Hsu ◽  
Jung-Sheng Chen ◽  
Hsin-Chi Tsai ◽  
Chi-Wei Tao ◽  
Yu-Yin Yang ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Nested Pcr ◽  
In Silico ◽  
Environmental Samples ◽  
Method Development ◽  
Small Volume ◽  
Detection Efficiency ◽  
Genotyping Method ◽  
Pcr Method

AbstractAcanthamoeba spp. are opportunistic human pathogens that cause granulomatous amoebic encephalitis and keratitis, and their accurate detection and enumeration in environmental samples is a challenge. In addition, information regarding the genotyping of Acanthamoeba spp. using various PCR methods is equally critical. Therefore, considering the diverse niches of habitats, it is necessary to develop an even more efficient genotyping method for Acanthamoeba spp. detection. This study improved the sensitivity of detection to avoid underestimation of Acanthamoeba spp. occurrence in aquatic environmental samples, and to accurately define the pathogenic risk by developing an efficient PCR method. In this study, a new nested genotyping method was established and compared with various PCR-based methods using in silico, lab, and empirical tests. The in silico test showed that many PCR-based methods could not successfully align specific genotypes of Acanthamoeba, except for the newly designed nested PCR and real-time PCR method. Furthermore, 52 water samples from rivers, reservoirs, and a river basin in Taiwan were analysed by six different PCR methods and compared for genotyping and detection efficiency of Acanthamoeba. The newly developed nested-PCR-based method of genotyping was found to be significantly sensitive as it could effectively detect the occurrence of Acanthamoeba spp., which was underestimated by the JDP-PCR method. Additionally, the present results are consistent with previous studies indicating that the high prevalence of Acanthamoeba in the aquatic environment of Taiwan is attributed to the commonly found T4 genotype. Ultimately, we report the development of a small volume procedure, which is a combination of recent genotyping PCR and conventional real-time PCR for enumeration of aquatic Acanthamoeba and acquirement of biologically meaningful genotyping information. We anticipate that the newly developed detection method will contribute to the precise estimation, evaluation, and reduction of the contamination risk of pathogenic Acanthamoeba spp., which is regularly found in the water resources utilised for domestic purposes.

scholarly journals DESAIN IN SILICO DNA PROBE PENDETEKSI MUTASI DAERAH RESISTENSI QUINOLON Gen gyrA DAN gyrB Mycobacterium tuberculosis

2019 ◽  
Vol 7 (2) ◽  
pp. 44
Author(s):  
Tasya Pramiswari ◽  
Jennifer Tamara ◽  
Ni Made Febrianti ◽  
Sagung Chandra Yowani
Keyword(s):  
Mycobacterium Tuberculosis ◽  
Therapy Resistance ◽  
Dna Probe ◽  
Gyrb Gene ◽  
Taqman Probe ◽  
Probe Design ◽  
Gyra Gene ◽  
Mdr Tb ◽  
Pcr Method ◽  
Two Stages

Fluoroquinolone (FQ) is the main drug used in MDR-TB therapy resistance to FQ can cause death and increase the risk of treatment failure in MDR-TB patients. Mutations in gyrA gene and gyrB gene from Mycobacterium tuberculosis are responsible for the occurrence of FQ resistance. The highest mutation of gyrA gene in QRDR was found in codon 94, while mutations in gyrB gene was found in codon 500. M. Tuberculosis which resistant to FQ can be detected using the Real Time Polymerase Chain Reaction (RT-PCR) method with DNA probe.                                                                                                                                                                                                                             This study will design the nucleotide sequence of the TaqMan type probe using the Clone Manager Suite 9.2 program. The results of the DNA probe design were then analyzed in two stages, which is based on the probe criteria in general and based on the TaqMan probe labeling criteria. The design of the mutant probe DNA using the program produced 1 probe for Asp94Ala specific mutations in the gyrA gene and 33 probes for Asp500Ala specific mutations in the gyrB gene. After being analyzed by the two criteria, it was obtained the A94MA1 probe with the 5 '-TCGATCTACGCCAGCCTGGT-3' sequence and B500MA12 probe with the order of 5 '-TACCACAAGCTCGTGCTGATGGC-3'. The results of these probes meet both criteria and can be used to detect mutations in codon 94 gyrA genes and codons 500 gyrB genes of  Mycobacterium tuberculosis.

Detection of Sesame Seed DNA in Foods Using Real-Time PCR

2007 ◽  
Vol 70 (4) ◽  
pp. 1033-1036 ◽  
Author(s):  
JENNIFER L. BRZEZINSKI
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Sesame Seed ◽  
Food Products ◽  
Taqman Probe ◽  
2S Albumin ◽  
Sesame Seeds ◽  
Baked Goods ◽  
Pcr Method ◽  
Seed Dna

The detection of potentially allergenic foods, such as sesame seeds, in food products is a major concern for the food-processing industry. A real-time PCR method was designed to determine if sesame seed DNA is present in food products. The PCR reaction amplifies a 66-bp fragment of the sesame seed 2S albumin gene, which is detected with a sesame-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other seeds present in baked goods, such as pumpkin, poppy, and sunflower seeds. Additionally, this assay will not cross-react with DNA from several tree nut species, such as almond, Brazil nut, cashew, hazelnut, and walnut, as well as four varieties of peanut. This assay is sensitive enough to detect 5 pg of purified sesame seed DNA, as well as sesame seed DNA in a spiked wheat cracker sample.

scholarly journals Application of quantitative PCR for detection of Mycoplasma suis in blood samples

2014 ◽  
Vol 58 (4) ◽  
pp. 533-539
Author(s):  
Artur Jabłoński ◽  
Dominika Borowska ◽  
Sylwia Zębek ◽  
Andrzej Kowalczyk ◽  
Arkadiusz Dors ◽  
...  
Keyword(s):  
Real Time ◽  
Quantitative Pcr ◽  
Real Time Pcr ◽  
Quantitative Method ◽  
Taqman Probe ◽  
Blood Samples ◽  
Mycoplasma Suis ◽  
Coefficients Of Variation ◽  
Pcr Method ◽  
Detection And Quantification

Abstract The aim of the study was to develop and validate a real-time PCR method, using a TaqMan probe, for quantification of Mycoplasma suis in porcine blood. No PCR signals with closely related non-haemotrophic mycoplasmas were obtained. The detection limit of PCR for plasmid combined with blood DNA was determined to be 103/reaction (5 μL of DNA) (1.2x105 target copies in 1 mL of blood). The linearity of real-time PCR (near 1) indicates its use as a quantitative method. Real-time and quantitative PCR were sensitive and specific for the detection and quantification of M. suis in the blood of animals with acute and chronic form of eperythrozoonosis. Developed quantitative PCR cannot be used to detect carrier animals with a small amount of M. suis in their blood. The validity of real-time PCR used in the studies was confirmed by the low inter- and intra-assay coefficients of variation. This fact confirms the applicability of the assay in other laboratories.

Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)

2021 ◽  
Vol 1 (2) ◽  
pp. 20-29
Author(s):  
Maria A E D Sihotang ◽  
Yola Eka Erwinda ◽  
Eniek Suwarni ◽  
Erita Lusianti
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Rattus Norvegicus ◽  
In Silico ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Polymerase Chain

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR.  Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

Sign in / Sign up

Export Citation Format

Share Document