scholarly journals Intra-specific morphological and morphometric variability of Radopholus similis (Cobb, 1893) Thorne, 1949

2018 ◽  
Vol 10 (3) ◽  
pp. 841-846 ◽  
Author(s):  
S. Roy ◽  
K Roy ◽  
S. Sarkar ◽  
A Rathod ◽  
J. Hore
Keyword(s):  
The Body ◽  
Radopholus Similis ◽  
Body Width ◽  
Head Region ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Oesophageal Gland ◽  
Morphometric Features ◽  
Basal Bulb ◽  
Stylet Length

All the root inhabiting migratory endoparasitic nematode populations of Radopholus procured from banana crop of Vellayani, Thiruvananthapuram, Kerala were identified as Radopholus similis. Heat killed females were straight to slightly ventrally curved posteriorly. Female’s head was low, rounded, continuous or slightly setoff with the body contour. Females were 500-660 µm long and were comparatively longer than males. Males had button shaped head set off by a constriction; female with three to five lip annuli, four crenate and areolated lateral incisures, stylet 14-18 µm long with rounded knobs, vulva post-equatorial (58%), sometimes with slight protuberant lips, ovary paired and equally developed, oesophageal gland overlapped the intestine dorsally, tail elongate-conoid with narrowly rounded terminus. The stylet length (µm), width of stylet knob (µm), distance of excretory pore from anterior end (µm), distance from head to basal bulb (µm), lateral field structure, shape of stylet knob, head region, position of phasmid, tail shape with its terminus, morphometric values like m%, o% and v% and a, c and c´ ratios of females were stable (CV<12%) features. There is an existence of intra-specific variability in the morphological and morphometric features of R. similis. The main morphological diversity was observed with P% of male and female, b ratio of female and stylet length, distance of DEGO from stylet base, o% and T% of male. All the root inhabiting migratory endoparasitic nematode populations of Radopholus Thorne, 1949 procured from banana of Vellayani, Thiruvananthapuram, Kerala were identified as Radopholus similis (Cobb, 1893) Thorne, 1949. A high degree of intra-specific morphometric variability was observed with regard to the total body length (µm), body width (µm), stylet length (µm), distance of dosrsal oesophageal gland orifice (DEGO) from stylet base (µm), number of lip annuli, lip height (µm), distance from head to basal bulb (µm), distance of anus from anterior end (µm), tail length (µm), anal body width (µm), distance of phasmid from tail terminus (µm), number of lateral lines, width of lateral field (µm), b ratio and P % among females of R. similis. Morphometric features like m%, o% and v% of females of R. similis showed least variability. These can be considered as the stable morphometric characters for discrimination of females of R. similis. Ratios like ‘a’ and ‘c’ of females of R. similis were found moderately variable. The morphometric feature and of male i.e. distance from head to basal bulb (µm) was found least variable; while number of lip annuli and spicule length (µm) were moderately variable.  

Description of Helicotylenchus amplius n. sp. and a key to the Canadian species of the genus (Nematoda: Hoplolaimidae)

1982 ◽  
Vol 60 (3) ◽  
pp. 318-321 ◽  
Author(s):  
R. V. Anderson ◽  
E. S. Eveleigh
Keyword(s):  
The Body ◽  
Body Width ◽  
Lateral Field ◽  
Large Uterus ◽  
Stylet Length ◽  
Plant Parasitic

Helicotylenchus amplius n. sp., a parthenogenetic plant-parasitic spiral nematode in Canada, is described and illustrated. The distinguishing characters are a thick, digitate ventral tail projection with a terminal mucro, fine annulations on the tail end and open-ended lateral field, a conical head, stylet length of 26–29 μm, and a deep vulval atrium and large uterus which occupies most of the body width. A key is provided to aid in the identification of the Canadian species of Helicotylenchus Steiner, 1945.

Two rare species of tylenchids, Discotylenchus biannulatus n. sp. and Labrys chinensis Qing & Bert, 2018 (Nematoda: Tylenchidae) from western Iran

Zootaxa ◽  
2018 ◽  
Vol 4413 (2) ◽  
pp. 260 ◽  
Author(s):  
EHSAN KONANI ◽  
YOUSEF PANAHANDEH ◽  
EBRAHIM POURJAM ◽  
SERGIO ÁLVAREZ-ORTEGA ◽  
MAJID PEDRAM
Keyword(s):  
Rare Species ◽  
Cephalic Region ◽  
Morphometric Characters ◽  
Lateral Field ◽  
The Family ◽  
Type Population ◽  
Rare Males ◽  
Stylet Length ◽  
Morphological Differences ◽  
Pointed End

Two rare species of the family Tylenchidae are described and illustrated based on morphological and morphometric characters. Scanning electron microscope (SEM) studies provided details of anterior end structures, helpful in generic identification of the studied populations. Discotylenchus biannulatus n. sp. is characterized by its dorso-ventrally flattened smooth cephalic region having two proximal annuli and a rectangular perioral disc, short longitudinal amphidial slits, lateral field with four incisures, stylet 9–10 μm long, with the conus shorter than half the total stylet length and with posteriorly directed knobs, well-developed median bulb, mono-prodelphic reproductive system with rounded empty spermatheca and short postvulval uterine sac (PUS), and filiform tail with pointed end. It is compared with other species of Discotylenchus having four lines in the lateral field. The Iranian population of Labrys chinensis is characterized by its long and slender (a = 45.2–57.2) body, smooth rounded cephalic region and an offset disc-like apical labial plate, short longitudinal lateral amphidial slits, lateral field with two incisures, moderately developed stylet with the conus less than half the total length and posteriorly directed knobs, median bulb fusiform with distinct but weak valve, gradually joining the isthmus, vulva at 57.2–59.1% with small flaps, elongate conoid tail, uniformly and slightly narrowing toward end with broadly rounded terminus and rare males. The minor morphological differences of the recovered population with the type population are discussed. 

Additional information on Meloidogyne inornata Lordello, 1956 (Tylenchida: Meloidogynidae) and its characterisation as a valid species

Nematology ◽  
2008 ◽  
Vol 10 (1) ◽  
pp. 123-136 ◽  
Author(s):  
Regina M.D.G. Carneiro ◽  
Maria de Lourdes Mendes ◽  
Maria Ritta A. Almeida ◽  
Marcilene F.A. dos Santos ◽  
Ana Cristina M.M. Gomes ◽  
...  
Keyword(s):  
Tail Length ◽  
Original Description ◽  
The Body ◽  
Valid Species ◽  
Root Knot Nematode ◽  
Head Region ◽  
Body Contour ◽  
Additional Information ◽  
Stylet Length ◽  
Species Specific

Abstract A root-knot nematode parasitising yakon (Polymia sonchifolia) in São Paulo State, Brazil, is identified as Meloidogyne inornata. The species is redescribed from this material and compared with the original description of M. inornata. The female perineal patterns have a distinct, high, dorsal arch composed of smooth to wavy striae, similar to Meloidogyne incognita. The female stylet is 15.0-17.0 μm long with the cone generally slightly curved dorsally and with well developed knobs. DGO is 3.5-4.5 μm. Males have a high, rounded, head cap that is continuous with the body contour and has a large, round, centrally concave, labial disc raised above the medial lips. The head region is never marked by incomplete annulations and the stylet is robust, 20.0-25.0 μm long, with a straight cone, cylindrical shaft with several small projections and pear-shaped, backwardly sloping knobs. The stylet length of second-stage juveniles is 10.0-13.0 μm, DGO is 2.5-3.5 μm, tail length is 35.0-58.0 μm and c = 6.7-13.9. Biochemically, the esterase phenotype I3 (= Y3) is species-specific and is the most useful character for differentiating M. inornata from other Meloidogyne species. Reproduction is by mitotic parthenogenesis, 3n = 54-58. In a soybean test, cv. Abura was susceptible and cv. LA411219 was highly resistant. As the type material is lost, a neotype female is formally designated.

scholarly journals First Report of Aphelenchoides besseyi Causing White Tip Disease of Rice in Jilin Province, China

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1165-1165 ◽  
Author(s):  
S. Q. Ou ◽  
J. Gao ◽  
D. L. Peng ◽  
C. Y. Qi ◽  
J. H. Zhang ◽  
...  
Keyword(s):  
Body Length ◽  
Flag Leaf ◽  
The Body ◽  
Jilin Province ◽  
Morphological Data ◽  
Pcr Analysis ◽  
Body Width ◽  
Internal Transcribed Spacer Region ◽  
Lateral Field ◽  
Aphelenchoides Besseyi

White tip disease of rice caused by the plant-parasitic nematode Aphelenchoides besseyi is an important domestic quarantine issue causing heavy yield losses of rice. During a survey for rice diseases in 2013, suspect white tip disease of rice was observed in the cities of Changchun and Gongzhuling, Jinlin Province, China. Leaf tips of susceptible rice varieties were white or yellow, becoming brown or black as necrosis set in. Tips of developing leaves were twisted and wrinkled. The flag leaf became twisted above the panicle until development was inhibited. General stunting of the plant accompanied leaf injury. Panicles were severely reduced and produced small deformed kernels while spikelets were reduced in number. Maturity of panicles was delayed, and secondary panicles arising from the lower nodes of the panicle were sterile. Nematodes were isolated from rice grains of diseased panicles. Key morphological features were determined for females and males. Measurements of females (n = 15) were: body length 612.50 to 735.00 μm (mean 673.75 μm), body width 17.37 to 22.21 μm (mean 19.79 μm), esophagus to gland 64.44 to 68.07 μm (mean 66.26 μm), and tail 34.41 to 41.29 μm (mean 37.85 μm). Females had a relatively short ovary with oocytes arranged in several lines; posterior uterine branch two to four times as long as body width; and tail tapering, conoid, with terminus bearing a mucro with four processes arranged in a shape somewhat that of a star. Measurements of males (n = 22) were: body length 483.39 to 580.00 μm (mean 531.70 μm), body width 14.46 to 17.12 μm (mean 15.79 μm), esophagus to gland 63.97 to 66.42 μm (mean 65.20 μm), and tail 30.38 to 36.45 μm (mean 33.41 μm). Males had a curved tail about 180° when relaxed, three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, and terminus bearing four mucrones arranged variably. Both males and females had lateral field occupying one fourth of the body width, marked by four incisures; delicate cephalic framework; small spear with moderate-size basal knobs; excretory pore was anterior to nerve ring; and intestine joined to esophagus immediately behind median bulb (3). All morphological data and characters were consistent with A. besseyi. Molecular diagnosis as A. besseyi was confirmed after DNA was extracted from nematodes (n = 16) and the templates were used in PCR analysis. The internal transcribed spacer region (ITS) of rDNA was amplified with primers TW81 and AB28 (2). The size of PCR product was 842 bp, and this sequence (KJ009342) was submitted to GenBank and was 98% similar with that of A. besseyi isolates from India (JF826519, JF93390, JF826517, JF826518) and Russia (EU186069). Molecular identification was further confirmed by amplifying part of the ITS region and part of the 5.8 gene of rDNA using the A. besseyi-specific primers BSF and BSR (1). The amplification yielded a 312-bp product specific to A. besseyi. Morphological and molecular data confirmed that the pathogen responsible for white tip disease in Changchun and Gongzhuling was A. besseyi. While this nematode has been reported from many rice-producing areas in China, this is the first detection of A. besseyi in Jilin Province, China. References: (1) R. Q. Cui et al. Plant Quarantine (Chinese) 24:10-12, 2010. (2) S. A. Subbotin et al. Nematology 2:153, 2000. (3) G. Thorne. Principles of Nematology. McGraw-Hill, New York, 1972.

Morphological and molecular characterisation of Coslenchus persicus n. sp. (Nematoda: Tylenchidae) from Iran

Nematology ◽  
2020 ◽  
pp. 1-10
Author(s):  
Manouchehr Hosseinvand ◽  
Ali Eskandari ◽  
Reza Ghaderi
Keyword(s):  
New Species ◽  
Molecular Data ◽  
Ribosomal Genes ◽  
28S Rrna ◽  
Lateral Field ◽  
Rrna Tree ◽  
Basal Bulb ◽  
Stylet Length ◽  
North Western ◽  
A New Species

Summary A new species of Coslenchus from north-western Iran is illustrated and described using morphological, morphometric and molecular data. Coslenchus persicus n. sp. is characterised by a medium-sized body of 694-810 μm, often 18 (seldom 20-22) longitudinal ridges excluding lateral field, head with four distinct annuli, stylet 9.6-10.8 μm long, pharyngeal basal bulb large and cylindrical, spermatheca offset and ovate, without sperm, vulval flaps extending for two annuli, 5-7 μm in length, tail striated with finely to bluntly rounded tip, 110-153 μm long and without males. The new species comes close to C. assamensis, C. diversus, C. japonicus, C. leiocephalus, C. maritus, C. multigyrus, C. paramaritus, C. pastor, and C. polonicus, but can be distinguished from all by differences in body length, stylet length and shape of basal bulb, post-vulval uterine sac, tail and certain morphometric data. Molecular data are provided for the characterisation of the new species using ribosomal genes (18S and 28S rRNA). In the 18S rRNA tree, the new species was placed in a clade including one isolate of Coslenchus sp. from Iran. In the reconstructed 28S rRNA phylogenetic tree, C. persicus n. sp. clustered with other known Coslenchus species.

scholarly journals First report of the nematodes Filenchus orientalis and Hemicriconemoides californianus on faba bean in Iran

2016 ◽  
Vol 9 (1) ◽  
pp. 44-50
Author(s):  
S. Azimi ◽  
E. Mahdikhani-Moghadam ◽  
H. Rouhani ◽  
H. Rajabi Memari
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Stylet Length ◽  
First Time ◽  
Plant Parasitic ◽  
Iranian Populations

Summary During a survey in Iran, two known species of plant-parasitic nematodes of the families Tylenchidae and Criconematidae were reported for the first time. The morphological and morphometric characters of Iranian populations of the two recovered species are discussed and illustrated based on morphological and morphometrics data. Iranian population of Filenchus orientalis is characterized by having a 601-755μm body length, stylet length of 9.0-11.3 μm, lateral field with four incisures, tail length of 100-118 μm and males with 15-21 μm long spicules. Hemicriconemoides californianus population is characterized by having a body length of 430-550μm, lip region with two annuli, stylet length of 75-83μm and tail length of 20-28 μm. The morphological and morphometric characters of both species are in agreement with those in original descriptions.

scholarly journals First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1385-1385
Author(s):  
H. D. Lopez-Nicora ◽  
T. Mekete ◽  
N. J. Taylor ◽  
T. L. Niblack
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The Body ◽  
28S Rrna ◽  
Lateral Field ◽  
First Report ◽  
Pratylenchus Vulnus ◽  
Buxus Sempervirens ◽  
Stylet Length ◽  
De Man

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

Description of Cryphodera brinkmani n. sp. (Nematoda: Heteroderidae), a parasite of Pinus thunbergii Parlatore from Japan, including a key to the species of the genus Cryphodera Colbran, 1966

Nematology ◽  
1999 ◽  
Vol 1 (2) ◽  
pp. 121-130 ◽  
Author(s):  
Gerrit Karssen ◽  
Adriaan Van Aelst
Keyword(s):  
New Species ◽  
Excretory Pore ◽  
Pinus Thunbergii ◽  
The Body ◽  
Head Region ◽  
Lateral Field ◽  
Second Stage ◽  
Stage Juvenile ◽  
Long Head

AbstractA non cyst-forming heteroderid nematode, Cryphodera brinkmani n. sp., is described and illustrated from the roots of Pinus thunbergii Parlatore from Japan; this new species is characterised by globose female with annulated cuticle and curved projecting neck; stylet 41.5 mum long, with rounded knobs, set off from the shaft; excretory pore located 120 to 157 mum from the anterior end, vulva terminal, with a vulva-anus distance of 49 mum and slightly protruding vulval lips, vulva-anus area ranging from flat to concave, subcrystalline layer present, eggs retained in the body; males rare, with head region set off, two lip annules present, stylet 37.5 mum long, rounded knobs set off, anteriorly slightly pointed, lateral field with three incisures, areolated; second-stage juvenile body 493 mum long, head region set off, four cephalic annuli present, stylet 33.5 mum long, with large anteriorly concave knobs, set off from the shaft, tail 70 mum, tapering towards a pointed hyaline tail terminus of 37 mum in length, areolated lateral field with three incisures, phasmids with a lens-like structure located 6 to 10 mum posterior to the anus. A key for the Cryphodera species is proposed. Description de Cryphodera brinkmani n. sp. (Nematoda: Heteroderidae) parasite de Pinus thunbergii Parlatore au Japon et clef des especes du genre Cryphodera Colbran, 1966 - Un nematode Heteroderide ne formant pas de kyste, Cryphodera brinkmani n. sp., provenant des racines de Pinus thunbergii au Japon, est decrit et illustre; cette nouvelle espece est caracterisee par les femelles globuleuses a cuticule annelee et extremite anterieure courbe, stylet long de 41,5 mum a boutons basaux arrondis bien individualises, pore excreteur situe a 120-157 mum de l'extremite anterieure, vulve terminale (distance vulve-anus 49 mum) et levres vulvaires legerement saillantes, aire perineale plate a concave, presence d'une couche subcristalline, oeufs retenus dans le corps. Les males, rares, ont une region labiale separee du reste du corps, deux anneaux cephaliques, un stylet long de 37,5 mum avec boutons basaux arrondis, bien individualises et legerement pointus anterieurement, des champs lateraux avec trois incisures, areoles. Les juveniles de deuxieme stade, longs de 493 mum, ont une region cephalique separee avec quatre anneaux, un stylet long de 33,5 mum avec des boutons basaux de grande taille, bien individualises et a face anterieure concave, une queue longue de 70 mum, amincie a extremite effilee avec une zone hyaline longue de 37 mum, des champs lateraux marques de trois incisures et areoles, des phasmides a structure lenticulaire situees 6-10 mum posterieurement a l'anus. Une clef pour la determination des especes du genre Cryphodera est proposee.

First record of the genus Discotylenchus Siddiqi, 1980 (Nematoda: Tylenchidae) from Iran, with description of one new and data on two known species

Zootaxa ◽  
2012 ◽  
Vol 3493 (1) ◽  
pp. 72
Author(s):  
RAZIEH GHAEMI ◽  
EBRAHIM POURJAM ◽  
MOHAMMAD REZA ATIGHI ◽  
MAJID PEDRAM ◽  
GERRIT KARSSEN
Keyword(s):  
Tail Length ◽  
Original Description ◽  
First Record ◽  
Morphological Characters ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Original Population ◽  
Stylet Length ◽  
First Time ◽  
Labial Disc

The genus Discotylenchus is reported for the first time from Iran. Discotylenchus iranicus n. sp. is described and illustratedbased on morphological and morphometric characters. The new species is characterized by a combination of the followingmorphological features: lip region continuous and smooth, tapering to an offset prominent labial disc, lateral field withfour incisures, stylet length of 14–15μm, vulva position at 70.8–76.5 %, tail length of 81–100μm, conoid with a roundedtip and presence of males. The Iranian population of D. brevicaudatus shows a wider morphometric range compared tothe original description and the male of this species is described for the first time. The morphological characters and range of morphometric data of D. discretus are in full agreement with the original population.

Description of Ektaphelenchus cupressi n. sp. (Nematoda: Ektaphelenchinae) from Iran

Nematology ◽  
2019 ◽  
Vol 21 (7) ◽  
pp. 679-691 ◽  
Author(s):  
Behrouz Golhasan ◽  
Mehdi Abdollahpour ◽  
Yiwu Fang ◽  
Joaquín Abolafia ◽  
Ramin Heydari
Keyword(s):  
New Species ◽  
Large Subunit ◽  
Small Subunit ◽  
The Body ◽  
Cupressus Sempervirens ◽  
Mazandaran Province ◽  
Head Region ◽  
Northern Iran ◽  
Body Contour ◽  
Lateral Field

Summary Ektaphelenchus cupressi n. sp. was isolated during a survey of nematodes associated with bark samples of a dead cypress tree (Cupressus sempervirens) in Mazandaran province, northern Iran. The new species is characterised by a female body length of 612 (520-693) μm, stylet 17-19 μm long with wide lumen and lacking basal swellings, head region hemispherical in lateral view and slightly offset from the body contour by a shallow constriction, three incisures in the lateral field, excretory pore situated anterior to level of metacorpus valve, hemizonid not seen, post-uterine sac 29-35 μm long, shape of the tail terminus, and arrangement of the male caudal papillae. By a combination of morphological characters, e.g., stylet without knobs or swellings at the base, short conical tail, PUS length, and only a vestigial anus and rectum in most individuals, the new species shares similarities with species belonging to three genera, i.e., Anomyctus, Ektaphelenchus, and Seinura. Phylogenetic analysis based on small subunit (SSU) and partial large subunit (LSU) sequences of rDNA confirmed its status as a new species.

Sign in / Sign up

Export Citation Format

Share Document