A Contactless Classification Method for Early Detection of Nematodes Using Deep Neural Networks (DNNs) and TensorFlow

Soil-borne plant-parasitic nematodes are microscopic, eellike roundworms. The root-knot nematodes (Meloidogyne spp.) and root-lesion nematodes (Pratylenchus vulnus) are among the most damaging in California, which are difficult to control and can spread easily in soil on tools, boots, and infested plants. Root-knot nematodes can attack many different crops, including nut and fruit trees, usually cause unusual swellings, called galls, on affected plants’ roots. It is not easy to recognize the infestations of these nematodes. For instance, researchers need to dig up walnut trees with symptoms, wash or gently tap the soil from the roots, and examine the roots for galls. The nematode extraction procedures, identification, and enumeration under a microscope are tedious and time-consuming. Therefore, in this article, the authors proposed to use a low-cost contactless radio frequency tridimensional sensor “Walabot,” and Deep Neural Networks (DNNs), to perform the early detection of nematodes in a walnut site. Radiofrequency reflectance of walnut leaves from different nematode infestation levels was measured. The hypothesis was that waveforms generated from walnut leaves can estimate the damage caused by nematodes. DNNs with Tensor-Flow were used to train and test the proposed method. Results showed that the Walabot predicted nematode infestation levels with an accuracy of 82%, which showed great potentials for early detection of nematodes.

Pratylenchus vulnus going nuts in California.

This chapter discusses the economic importance, geographical distribution, host range, damage symptoms, biology and life cycle, interactions with other nematodes and pathogens, recommended integrated management, and management optimization of Pratylenchus vulnus infesting nut crops in California, USA. Future research requirements and future developments are also mentioned.

The effect of fumigation on nematode communities in California almond orchards

Summary Fumigants, such as 1,3-dichloropropene and chloropicrin, have become key to pre-plant pest management in almond production. Whilst the use of these fumigants has become increasingly restricted due to human health concerns, less is known about their below-ground non-target effects in orchards and how nematode communities recover from fumigation over time. In this study, replicated trials compared 1,3-dichloropropene + chloropicrin to non-treated controls in two almond orchards in California, USA. Nematode communities, nematode indices and nematode metabolic footprints were quantified soon after fumigation and for 2 years afterwards. Fumigation reduced the Herbivore Metabolic Footprint in year 1, and populations of Pratylenchus vulnus in year 3. Fumigation also reduced populations of larger omnivores and predators, resulting in lower levels of the Structure Index at one site. Populations of fungal-feeding nematodes were more adversely affected by fumigation than bacterial-feeding nematode populations. At both sites, fumigation still influenced nematode community composition 2 years after treatment application.

Functional Variation of Two Novel Cellulases, Pv-eng-5 and Pv-eng-8, and the Heat Shock 90 Gene, Pv-hsp-90, in Pratylenchus vulnus and Their Expression in Response to Different Temperature Stress

Functional characterization of two novel endoglucanase genes, Pv-eng-5 and Pv-eng-8, of the root-lesion nematode Pratylenchus vulnus was carried out. In situ-hybridization experiments revealed that Pv-eng-8 transcript was localized in the pharyngeal glands. Silencing of Pv-eng-5 and Pv-eng-8 resulted in a significant reduction of expression level (52% and 67%, respectively). Furthermore, the silencing of Pv-eng-8 determined a reduction (41%) in nematode reproduction, suggesting that treated nematodes are much less able to process food. Surprisingly, no significant difference on reproduction rate was observed with Pv-eng-5 dsRNA nematodes, suggesting a neofunctionalization of Pv-eng-5 despite the high similarity with nematode endoglucanases. Pratylenchus species are poikilothermic organisms showing close relationships with the environmental temperature. The effects of different temperature ranges revealed that the reproductive potential of P. vulnus increased with increasing temperature from 23 °C to 28 °C, but no reproduction was observed at 33 °C. In real time, increasing temperature from 23 °C to 28 °C the heat shock gene Pv-hsp-90 was differentially expressed in adult stages, while the levels of the effector genes Pv-eng-1 and Pv-eng-8 in females showed no significant differences compared to those observed at 23 °C, only in males Pv-eng-8 level decreased (45%). The upregulation of Pv-hsp-90 in both adult stages suggests a protective mechanism in order to cope with unfavorable environmental conditions.

PLANT-PARASITIC NEMATODES ASSOCIATED WITH WALNUT IN THE SANANDEJ REGION OF WEST IRAN

A survey of plant-parasitic nematodes associated with walnut was carried out in the Sanandej region, of the province of Kurdistan, in western Iran, during the 2011-2012 time period. After taking samples from fifty-four localities and then doing the routine laboratory work for processing, fixing, and mounting of the nematodes, twenty-one species of plant-parasitic nematodes were finally identified. Among the identified species: Cacopaurus pestis, Mesocriconema xenoplax, Pratylenchus vulnus and Meloidogyne incognita are likely to cause damage. Spiral (Helicotylenchus crassatus, H. digonicus, H. pseudorobustus and H. vulgaris), ring (Mesocriconema antipolitanum and M. xenoplax) and root-lesion nematodes (Pratylenchus neglectus, P. thornei, P. vulnus and P. delattrei) were the most predominant nematodes in the sampled area (frequencies in soil were 87.0, 77.8, and 72.2% and 46.3, 20.4 and 14.8% in root samples, respectively). In the present study, Pratylenchus delattrei, Trophurus lomus, Paratylenchus similis, Geocenamus stegus, Helicotylenchus crassatus, Scutellonema brachyurus and Meloidogyne incognita were reported as new species associated with walnut in Iran.

First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.