scholarly journals First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1385-1385
Author(s):  
H. D. Lopez-Nicora ◽  
T. Mekete ◽  
N. J. Taylor ◽  
T. L. Niblack
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The Body ◽  
28S Rrna ◽  
Lateral Field ◽  
First Report ◽  
Pratylenchus Vulnus ◽  
Buxus Sempervirens ◽  
Stylet Length ◽  
De Man

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

scholarly journals First Report of Leipotylenchus abulbosus in Iran

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 882-882
Author(s):  
M. Mirzaee-Qomi ◽  
F. Khozeini ◽  
S. Barooti ◽  
S. Rezaee
Keyword(s):  
Body Length ◽  
Sandy Loam ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Crop Plants ◽  
The Body ◽  
Posterior Portion ◽  
First Report ◽  
Pure Cultures ◽  
Stylet Length

Leipotylenchus abulbosus (Thorne, 1949) Sher, 1974 belongs to the family Tylenchidae, subfamily Leipotylenchinae, and order Tylenchida. During the spring and autumn months of 2008 to 2010, 80 samples were collected from rhizosphere soil of symptomatic plants including wheat (Tritichum aestivum L.), beet (Beta vulgaris L.), and maize (Zea mays L.) from Meighan and Gavar regions of Markazi Province in central Iran. Plants were dwarfed and leaves were chlorotic. Diseased plants comprised ~7% of all plants in the field. Sandy loam soil was collected from roots up to 15 cm from the base of the plants. Nematodes were extracted from the soil by sieving and centrifugation (3). For species identification, nematodes were transferred to anhydrous glycerin (2) and mounted on slides by the paraffin ring method. Identification was based on morphometric and morphological characteristics of females and males. No other forms of the nematode were isolated from collected samples. L. abulbosus was found in 10% of the collected samples. The nematodes showed typical characteristics of the genus Leipotylenchus: striated and anteriorly flattened lip region, stylet without basal knobs, didelphic gonads, four incisures in lateral fields that were areolated in the posterior portion, presence of deirids and adanal caudal alae, amphid inconspicuous in males. Males contained bursa in tail. Females contained an almost straight body, tapering anteriorly from median bulb and posteriorly beyond the anus; cuticle thick, annules fine. Labial framework was moderately sclerotized. Median bulb with prominent valvular apparatus in the center, oval, occupied two-thirds of the body. Deirids were prominent and at the level of the excretory pore. Vagina a transverse slit at right angles to body axis, extending less than half width into body. Tai1 finely annulated, short, tapering to a narrow tip but becoming broader just before the terminus. Phasmids small in anterior half of the tail. Measurements of 12 females: body length = 1,377 ± 90 (1,276 to 1,469) μm; a = 39.2 ± 1.62 (36.8 to 41.1); b = 7.2 ± 0.34 (6.6 to 8.30); c = 11.1 ± 0.16 (10.7 to 11.3); V% = 52.6 ± 1.42 (50.4 to 53.8); stylet length = 17 ± 0.22 (16.6 to 18) μm; tail length = 124 ± 6.83 (116 to 137) μm); and 7 males: (body length = 1,150 ± 56.84 (1,090 to 1,246) μm; a = 39.5 ± 1.48 (37.5 to 41.5); b = 6.4 ± 0.21 (6.1 to 6.8); c = 9.5 ± 0.06 (9.4 to 9.6); T% = 55.1 ± 0.91 (54.4 to 56.20); stylet length = 17.6 ± 0.36 (17 to 18) μm; tail length = 120 ± 3.77 (115 to 129) μm) conformed to the description of L. abulbosus. L. abulbosus, originally isolated from crop plants in surveyed regions, was cultured on beet (B. vulgaris L.) in the greenhouse. Pure cultures of the nematode were inoculated on beet seedlings at the 4- to 6-leaf stage as described previously (1). Sterilized soils were inoculated with 1,000 infective mature nematodes with three replications. Infection of beet roots by the nematode resulted in leaf chlorosis and reduction in plant height. Previously, L. amiri was collected from soils associated with the roots of onion (Allium cepa L.) plants in Pakistan (4). However there have not been any reports of L. abulbosus in crop plants before. To our knowledge, this is also the first report of L. abulbosus infecting wheat, beet, and maize plants in Iran. References: (1) K. R. Barker. Methodology 2:19, 1985. (2) A. De Grisse. Meded. Rijksfac. Landbouwwet. Gent. 34:351, 1969. (3) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964. (4) M. A. Maqbool and F. Shahina. Rev. Nèmatol. 7:363, 1984.

scholarly journals First Report of Subanguina moxae Infecting Mugwort in Yunnan, China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1232-1232 ◽  
Author(s):  
R. Y. Yao ◽  
X. Q. Hu ◽  
J. P. Xue
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Total Body Length ◽  
Guizhou Province ◽  
Universal Primers ◽  
Parasitic Nematodes ◽  
Its Sequence ◽  
First Report ◽  
Stylet Length ◽  
Total Body

Mugwort is a perennial in the Compositae family distributed throughout Asia and Europe. The leaves are reported to have various pharmaceutical properties, e.g., antibacterial, antiviral, antitussive, and hemostatic properties, and have been used in traditional Chinese medicine for more than 2,000 years. In August 2011, a field of mugwort in Kunming, Yunnan Province, China, exhibited more than 90% incidence of whitish and rounded galls on the leaves. There were approximately 10 galls on each leaf, impacting the quality of the leaves for medicinal use. Parasitic nematodes were found upon dissection of the galls, then eggs, second-stage juveniles (J2), and mature males and females were observed. Through the morphologic observation of juveniles and female and male adults, the parasitic nematode was identified as Subanguina moxae (Yokoo and Choi, 1968) Brzeski, 1981 (3). Key morphological features are as follows: eggs (n = 20) measured 54.0 to 71.4 × 24.1 to 30.0 μm; J2 (n = 20) had the following characteristics: body length 689.3 to 873.2 μm (x = 775.5 μm); stylet length 8.2 to 9.8 μm (x = 8.8 μm); tail length 49.5 to 74.5 μm (x = 60.1 μm); a (total body length/maximum body width) ranged from 28.6 to 38.6 μm (x = 34.1 μm); and c (total body length/the length of the tail) ranged from 11.2 to 16.0 μm (x = 13.0 μm). Females (n = 20) had the following characteristics: body length 1,252.8 to 1,665.2 μm (x = 1,475.7 μm); stylet length 7.2 to 9.2 μm (x = 8.2 μm); V of 88.0 to 92.3 μm (x = 89.6 μm); a ranged from 17.6 to 24.5 μm (x = 21.3 μm); and c ranged from 20.2 to 28.9 μm (x = 22.8 μm). Males (n = 20) had the following characteristics: body length 994.2 to 1,453.6 μm (x = 1,253.2 μm); stylet length 7.5 to 9.9 μm (x= 9.1 μm); tail length 69.2 to 88.1 μm (x = 78.0 μm); spicule length 22.2 to 33.4 μm (x = 29.4 μm); gubernaculum length 10.4 to 14.2 μm (x = 12.2 μm); a ranged from 23.1 to 37.2 μm (x = 29.9 μm); and c ranged from 13.9 to 18.7 μm (x = 16.1 μm). Amplification of the rDNA-internal transcribed spacer (ITS) region and the D2/D3 (1) fragments of the 28S RNA with universal primers rDNA1/rDNA2 and D2A/D3B yielded PCR fragments of 934 bp and 754 bp, respectively. The ITS sequence (JN865234) and D2D3 sequence (JN885540) were submitted to GenBank. The ITS sequence (JN865234) exhibited 99.4% similarity with Mesoanguina moxae (AF396314) (synonym of S. moxae) (4). S. moxae has been identified from the common mugwort in Japan (2) and in China, was reported to infect wheat in Guizhou Province, but to our knowledge, this is the first report of this nematode affecting mugwort in Yunnan, China. References: (1) S. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) K. Daigo et al. Bull. School Agric. Meiji University. 56:237, 2007. (3) M. R. Siddiqi. Tylenchida: Parasites of Plants and Insects. CABI Publishing, New York, 2000. (4) S. A. Subbotin et al. Mol. Phylogenet. Evol. 30:226, 2004.

First Report of the Apple Root-Knot Nematode, Meloidogyne mali, on Maple Trees in Republic of Korea

Plant Disease ◽  
2021 ◽  
Author(s):  
Heonil Kang ◽  
Jongmin Seo ◽  
Hyoung-Rai Ko ◽  
Sohee Park ◽  
Nam-Sook Park ◽  
...  
Keyword(s):  
Body Length ◽  
National Park ◽  
Its Region ◽  
28S Rdna ◽  
Republic Of Korea ◽  
Egg Mass ◽  
Lateral Field ◽  
First Report ◽  
Future Production ◽  
Stylet Length

Meloidogyne mali was originally described in Japan on roots of an apple rootstock (Malus prunifolia) (Itoh et al. 1969) and found on elm trees in Italy, Netherlands, Belgium, France and United Kingdom, and euonymus in the USA (EPPO 2018; Prior et al. 2019). In Italy, the nematode was initially described as a new species, Meloidogyne ulmi, but was later synonymized with M. mali (Ahmad et al., 2013). During the study of Meloidogyne species in Republic of Korea, galled roots were found on Acer palmatum collected in Naejangsan National Park, Republic of Korea located at 35°29'29.1"N, 126°55'42.7"E, altitude 147.8 m. Morphologically, the perineal patterns of the females was very similar to M. mali due to rounded dorsal arch and smooth, finely-spaced, indistinct striae. Lateral field shallow, narrow, and faint. Phasmids large, very distinct. Head region of second–stage juveniles flattened anteriorly to hemispherical, slightly set-off from body, without annulations, low head cap. Stylet slender, sharply pointed cone, cylindrical shaft with rounded knob sloping posteriorly. Tail conoid with irregular, and rounded end. Rectum undilated. Several micrographs were made from 25 J2s and females for mean, standard deviation and range. J2s were measured with a body length: 408.2 ± 25.1 (366-449) µm, maximum body width: 15.9 ± 1.0 (14.1-17.9) µm, stylet length: 14.1 ± 0.5 (13.1-15.3) µm, hyaline tail terminus: 10.0 ± 0.9 (8.3-11.0) µm and tail length: 31.7 ± 3.0 (26.0-36.1) µm. Females (n=25) were characterized by a body length: 656.7 ± 102.7 (516-947) µm, a stylet length: 16.4 ± 2.2 (13.9-19.0) µm, a vulval slit length: 22.2 ± 1.8 (19.8-25.7) µm, and a vulva-anal distance: 20.2 ± 2.4 (17.1-25.4) µm. Morphological measurements and configuration of perineal patterns (Fig. 1S) were comparable to M. mali (Itoh et al. 1969; Ahmed et al. 2013; Gu et al. 2020). To confirm pathogenicity, a modified version of Koch’s postulates was conducted in the greenhouse by inoculating 300 eggs from a single egg mass onto each of three, two-year-old A. palmatum plants, grown in sterilized sandy soil. After about one year, symptoms developed on the maple tree roots, with numerous galls containing females and egg masses by visual inspection. In addition, PCR was performed for the 28S rDNA D2-D3 segment and ITS region using the primers D2A, D3B, TW81 and AB28. The resulting sequences (MW522548, MW522549, MW523004 and MW523005) were at least 99% identical to other 28S rDNA D2-D3 segment and ITS region sequences on Genbank (MT406757 and JX978229). The molecular phylogenetic relationships of this species strongly supports M. mali (Fig. 2S). To the best of our knowledge, this is the first report of M. mali in Republic of Korea. The host range of M. mali includes many species which are of economic importance in fruit trees (e.g. apple, chestnut, fig, mulberry), forestry trees (e.g. elm, maple, oak, Yew), and vegetable crops (e.g. cabbage, carrot, cucumber, eggplant, soybean, watermelon). The potential danger to these economically important plants caused M. mali to be added the EPPO Alert List and also the Quarantine List of the Korean Animal and Plant Quarantine Agency. Additionally, in our survey around the Naejangsan National Park, M. mali was not found on other economically important host crops, such as grapes. Although this nematode was not detected other crops, it requires regular monitoring because it poses a serious threat to the future production of these crops.

scholarly journals First report of the nematodes Filenchus orientalis and Hemicriconemoides californianus on faba bean in Iran

2016 ◽  
Vol 9 (1) ◽  
pp. 44-50
Author(s):  
S. Azimi ◽  
E. Mahdikhani-Moghadam ◽  
H. Rouhani ◽  
H. Rajabi Memari
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Parasitic Nematodes ◽  
Plant Parasitic Nematodes ◽  
Morphometric Characters ◽  
Lateral Field ◽  
Stylet Length ◽  
First Time ◽  
Plant Parasitic ◽  
Iranian Populations

Summary During a survey in Iran, two known species of plant-parasitic nematodes of the families Tylenchidae and Criconematidae were reported for the first time. The morphological and morphometric characters of Iranian populations of the two recovered species are discussed and illustrated based on morphological and morphometrics data. Iranian population of Filenchus orientalis is characterized by having a 601-755μm body length, stylet length of 9.0-11.3 μm, lateral field with four incisures, tail length of 100-118 μm and males with 15-21 μm long spicules. Hemicriconemoides californianus population is characterized by having a body length of 430-550μm, lip region with two annuli, stylet length of 75-83μm and tail length of 20-28 μm. The morphological and morphometric characters of both species are in agreement with those in original descriptions.

scholarly journals First Report of Meloidogyne incognita on Cardamine Violifohia in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rui Liu ◽  
Hongqing Yin ◽  
Lin Li ◽  
Kaiwei Huang ◽  
Huixia Li ◽  
...  
Keyword(s):  
Body Length ◽  
Meloidogyne Incognita ◽  
Uv Light ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Economic Losses ◽  
Egg Masses ◽  
First Report ◽  
Stylet Length

Cardamine violifohia is an economically-important medicinal plant, and also a valuable plant for strong ability to accumulate selenium (Se) (Ebba et al. 2020). It is not only be used to extract selenium protein and selenium polysaccharide, but also widely used to develop selenium-supplement reagent. In September 2020, root-knot nematodes (RKN; Meloidogyne spp.) infection experiments showed that galls and egg masses were observed on the roots of numerous C. violifolia plants in Enshi (30°32′25.67″ N; 109°48′48.46″ E), Hubei Province, China. Meanwhile, the overground plants of C. violifohia were stunted and leaves were yellow. Almost 5% C. violifohia plants were affected by the disease. The roots with galls were collected, and nematodes were dissected and extracted (Fig. S1). Based on phytopathological clinic, the number of galls on each plant was 91.87 ± 19.01, and egg masses was 15.27 ± 5.36 (n = 15). Nematodes and galls were collected from soil and infected roots (Barker 1985). The morphological diagnostic of the nematode species was measured as follows. Measurements of adult females (n=20), body length = 628.15 ± 73.69 μm, width = 356.77 ± 36.72 μm, stylet length = 15.58 ±0.93 μm. Meanwhile, a high and trapezoidal dorsal arch with thick striations was observed in the perineal region of females. Second-stage juveniles (J2s) (n=20): body length = 377.09 ± 18.19 μm, body width = 15.64 ± 1.24 μm, stylet length = 13.31 ± 1.04 μm, tail length = 42.49 ± 4.64 μm, hyaline tail terminus = 12.35 ± 2.02 μm and presented well developed esophageal glands. Eggs (n=20): length = 80.81 ± 3.47 μm, and width = 37.09 ± 2.98 μm. All the morphological characteristics of the identified species were consistent with the descriptions of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 (Whitehead, 1968). Molecular identification was carried out by PCR with the M. incognita-specific primers Mi-F/Mi-R (Meng et al. 2004) and 28S rDNA D2/D3 region primers MF/MR (Hu et al. 2011). The target fragments of 955 bp and 478 bp amplified by of the primer pairs Mi-F/Mi-R and MF/MR were observed under a UV light, which confirmed that these nematodes collected from C. violifohia were M. incognita (Fig. S2). Fragments were, sequenced (MZ596342 and MZ566843, respectively) and aligned with available sequences on NCBI, which were 100% identical to the MK410954, MN728679, and MK410953, MF177882 M. incognita sequences, respectively. Pathogenicity testing was conducted to perform Koch’s postulates in a greenhouse by inoculation of 500 J2s from the original population into C. violifohia seedlings (n = 30, 5-6 leaves stage). After 7 weeks, all inoculated plants exhibited the same symptoms that observed in the field initially. Different life stages of M. incognita were observed in dissected galled tissues. The average reproductive factor was 37.30 ± 6.13, which is considered as the pathogenicity of M. incognita to C. violifohia. Therefore, C. violifohia is a suitable host for M. incognita in China. The growers should be informed of the current findings to avoid serious economic losses that might be caused by this pathogenic nematode, and prepare for proper management action. To our knowledge, this is the first report of M. incognita infecting C. violifohia in China.

Data on some members of the family Tylenchidae (Nematoda: Tylenchina) from Iran

Biologia ◽  
2015 ◽  
Vol 70 (10) ◽  
Author(s):  
Yousef Panahandeh ◽  
Ebrahim Pourjam ◽  
Farzad Aliramaji ◽  
Majid Pedram
Keyword(s):  
Body Length ◽  
Phylogenetic Analyses ◽  
Tail Length ◽  
Iranian Population ◽  
Lateral Field ◽  
Rdna Sequences ◽  
The Family ◽  
Molecular Phylogenetic ◽  
28S Rdna Sequences ◽  
Stylet Length

AbstractThree species belonging to the family Tylenchidae, Malenchus nanellus, M. undulatus and Tylenchus naranensis, are reported for the first time for Iran. These species are characterized based on morphological and morphometric data. The Iranian population of M. nanellus is characterized by its body length ranging from 410-485 μm, cuticle annuli 1.1- 1.5 μm wide at mid-body and lateral field with two crenate lines, starting at the mid-region of procorpus and ending near 1/3 of tail length. The population of M. undulatus is characterized by its 458-526 μm body length, cuticle coarsely annulated, annuli 1.8-2.4 μm wide at mid-body, lateral field with crenate incisures, beginning at about half of the stylet length, ending at middle of tail, head narrower than adjacent body, median bulb well developed with prominent valve plates and functional males in population. Iranian population of T. naranensis, is characterized by having a 631-774 μm body length, lateral field with four lines, outer lines crenate, a stylet length ranging from 10-11 μm and a tail of 102-131 μm long. Molecular phylogenetic analyses based on partial 28S rDNA sequences of T. naranensis revealed its close affinity with the genus Filenchus. Other Tylenchidae genera, such as Aglenchus (including the newly sequenced isolate from Iran) and Coslenchus were sister taxa and formed a well-supported clade. Malenchus exiguus, a previously reported species from Iran and sequenced in the present study, formed a monophyletic clade with other species of Malenchus and Lelenchus leptosoma.

scholarly journals First report of a Sheathoid Nematode (Hemicriconemoides litchi) on Longan in Taiwan

Plant Disease ◽  
2021 ◽  
Author(s):  
Che-Chang Liang ◽  
Chin-Wei Chiu ◽  
P. Janet Chen
Keyword(s):  
Tail Length ◽  
Its Region ◽  
The United States ◽  
The Body ◽  
Molecular Characteristics ◽  
Nutrient Deficiencies ◽  
First Report ◽  
Relationship Analysis ◽  
Final Population ◽  
Stylet Length

Longan (Dimocarpus longan Lour.) is a subtropical fruit, widely grown in China, Taiwan, and Southeast Asia. Longan has a high commercial value, US$242,200 of dried longan fruits are exported to the United States from Taiwan every year (Wang et al. 2010). A soil sample from a longan orchard located in Changhua County, Taiwan (24.0162657, 120.529-1457) was collected in June 2019. Sheathoid nematodes were the dominant species in this sample and over 40 adult individuals per 100 g soil were found. In December 2019, sheathoid nematodes were collected again from the same tree and processed for identification by morphological and molecular characteristics. Nematodes were extracted using the modified Baermann funnel method (Wu et al. 2010) for 24 h. The morphometric data from fifteen females with variant tail types were taken. All individuals had a closely sheath, lip region set off with two annuli, stylet frequently slightly dorsally curved with rounded knobs, no vulval flaps, tail narrowing to a broadly rounded terminus, or tapering to a truncate end, anus situated 3-4 annuli posterior to the vulva. The body length = 552 μm (483 to 616 μm), body width at mid-body = 34.02 μm (27.75 to 40.03 μm), a = 15.93 (14.73 to 18.87), b = 4.65 (4.04 to 5.06), V% = 91.57 (86.74 to 92.56), stylet length = 66.66 μm (63.51 to 69.6 μm), tail length = 28.48 μm (23.56 to 37.45 μm), ring number 114 to 130, Rs = 14 to 19, Roes = 22 to 28, RV = 9 to 13, Ran = 5 to 9 and RVan = 3 to 4. Since the stylet length were less than 70μm, they are more fitted to be Hemicriconemoides litchi (Van den Berg et al. 2015). DNA samples extracted using VIAGEN® DirectPCR lysis buffer from single females (n = 10) were processed to amplify the 28S D2-D3 expansion segment and the ITS region using primers sets D2A and D3B, TW81 and AB28, respectively (Van den Berg et al. 2014). The D2-D3 region of the nematodes collected in this study (MT-539384) shared 99% similarity with several H. litchi sequences deposited in the GenBank database (e.g. KP192481, KF856540), and the ITS region (MT556011) also shared 99% similarity with several H. litchi sequences (e.g. KP192482, GQ354786). Therefore, based on morphological, molecular data and phylogenetic relationship analysis (Nguyen et al. 2020) the nematodes from the Longan orchard were determined to be H. litchi. To measure the reproductive factor (Rf), 60 sheathoid nematodes (57 females and three males) recovered from Baermann extraction were inoculated onto root systems of a longan tree in a 15-cm-d pot filled with sterilized soil. One hundred and sixty eight days after inoculation, three 100 cm3 subsamples of soil from the pot were processed as mentioned previously, and the average number was 48/100 cm3 of soil. The final population was approximately 768 nematodes per 1600 cm3 of soil with the Rf value of 12.8 confirming Longan as a host, although no symptoms were observed. The DNA from three individuals in the three subsamples with variant tail types were used to obtain D2-D3 and ITS region sequences, and confirmed the species as H. litchi. Hemicriconemoides spp. is associated with root malformation and nutrient deficiencies on agricultural fruit trees (Milne et al. 1971; McSorley et al. 1980); however, aboveground evidence of damage may not become immediately obvious and the importance of sheathoid nematodes is easily overlooked (Chen et al. 2011). This is the first report of H. litchi as a parasite of longan tree in Taiwan.

scholarly journals First Report of the Sting Nematode Belonolaimus longicaudatus on Soybean in Delaware

Plant Disease ◽  
2010 ◽  
Vol 94 (1) ◽  
pp. 133-133 ◽  
Author(s):  
Z. A. Handoo ◽  
A. M. Skantar ◽  
R. P. Mulrooney
Keyword(s):  
South Carolina ◽  
Body Length ◽  
Gulf Coast ◽  
Ribosomal Subunit ◽  
Tail Length ◽  
The Body ◽  
Internal Transcribed Spacer Region ◽  
Lateral Field ◽  
Belonolaimus Longicaudatus ◽  
Length Range

In late July of 2005, several, large, irregular areas of severely chlorotic, stunted, and dead soybean plants were observed in two fields of soybean (Glycine max), 8.05 km apart, in sandy soil (94% sand, 2% silt, and 4% clay) in southwestern Sussex County, DE. The grower also had observed stunted corn the previous year in the same areas and thought the fields had a fertility problem. The morphology of adults and molecular analyses of the juveniles isolated from soil samples established the identity of the species as the sting nematode, Belonolaimus longicaudatus (1–4). The population density was 216 nematodes per 250 cm3 of soil. Morphological characters used for identification included female body, stylet and tail length, shape of head, stylet knobs, tail and tail terminus, number of lines in the lateral field, and vulva percentage in relation to body length. The male characters critical for identification were the following: body, stylet, spicule, and gubernaculum length; shape of head and stylet knobs; and number of lines in the lateral field. Measurements of females (n = 5) included body length (range = 2,035 to 2,120 μm, mean = 2,073.7, standard deviation [SD] = 37.0), stylet (117.0 to 127.5, 123.4, 4.5), V% (48.4 to 52.3, 50.6, 1.5), and tail (109 to 140, 120, 14.2). The lateral field had one incisure. Shape of head, stylet knobs, and tail were also consistent with B. longicaudatus. Males (n = 4) were characterized by the body length (range = 1,500 to 2,070 μm, mean = 1,753.3, SD = 290.2), stylet (117.0 to 127.5, 121.5, 5.4), spicules (41 to 50, 47, 5.2), and gubernaculum (17.0 to 18.5, 17.8, 0.8). Molecular diagnosis as B. longicaudatus was confirmed by sequencing two ribosomal DNA markers from three juveniles. Sequence of the internal transcribed spacer region ITS1 and 2 (GenBank Accession No. GQ896549) from this population was 99% identical to Florida isolate BlCi6 (DQ672368), and the 28S large ribosomal subunit D2-D3 expansion region (GQ896548) was 99% identical to Florida isolate BlCi4 (DQ672344). A high degree of similarity (>98%) was also shared by several other B. longicaudatus sequences (1). This detection represents a new state record in Delaware for B. longicaudatus. Since this detection in 2005, there have been no new reports of other observations of sting nematode or spread from these two fields tilled by the same farm operator in Delaware. Elsewhere, B. longicaudatus is known to occur in subtropical regions of the lower coastal plain, from Virginia to Florida and along the Gulf Coast into Texas. On the east coast, USDA Nematode Collection records document this nematode from Florida, Georgia, New Jersey, and South Carolina. Within Delaware, another sting nematode species, Belonolaimus maritimus, was detected on American beachgrass (Ammophila breviligulata) and bitter panicgrass (Panicum amarum var. amarulum) from Fenwick Island, near the Maryland border. Sting nematodes have also been reported in Burlington County, NJ. References: (1) U. Gozel et al. Nematropica 36:155, 2006. (2). H.-R. Han et al. Nematropica 36:37, 2006. (3) G. J. Rau. Proc. Helminthol. Soc. Wash. 25:95, 1958. (4) G. J. Rau. Proc. Helminthol. Soc. Wash. 30:119, 1963.

Nothotylenchus persicus n. sp. (Nematoda: Anguinidae) from Kermanshah province, Iran

Nematology ◽  
2016 ◽  
Vol 18 (1) ◽  
pp. 29-37 ◽  
Author(s):  
Mehrab Esmaeli ◽  
Ramin Heydari ◽  
Pablo Castillo ◽  
Juan E. Palomares-Rius
Keyword(s):  
New Species ◽  
Body Length ◽  
Phylogenetic Analyses ◽  
Tail Length ◽  
Rrna Gene ◽  
28S Rrna ◽  
Lateral Field ◽  
Female Tail ◽  
Molecular Studies ◽  
A New Species

A new species of the genus Nothotylenchus, N. persicus n. sp. was collected around the roots of grapevine and is described and illustrated herein based on morphological and molecular studies. The new species is characterised by a body length of 776-900 μm, delicate stylet 5-6 μm long, six lines in the lateral field, post-vulval uterine sac short, 10-18 μm long, female tail elongate-conoid with pointed terminus, and bursa covering 40-45% of tail length. Morphologically, N. persicus n. sp. appears closer to four known species of the genus, namely: N. hexaglyphus, N. affinis, N. medians and N. taylori. The results of phylogenetic analyses based on sequences of D2-D3 expansion region of 28S rRNA gene confirmed the close molecular relationship between N. persicus n. sp. and other anguinids, but Nothotylenchus claded separately from Ditylenchus species.

scholarly journals First Report of the Cyst Nematode (Heterodera filipjevi) on Wheat in Henan Province, China

Plant Disease ◽  
2010 ◽  
Vol 94 (10) ◽  
pp. 1262-1262 ◽  
Author(s):  
D. L. Peng ◽  
W. X. Ye ◽  
H. Peng ◽  
X. C. Gu
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The United States ◽  
Henan Province ◽  
Universal Primers ◽  
Heterodera Avenae ◽  
Molecular Characteristics ◽  
Cyst Nematodes ◽  
Lateral Field ◽  
First Report

During a survey for cereal cyst nematodes from May to June of 2009, cyst nematodes were detected in four wheat-growing areas (Liying, Xuchang, Weihui, and Yanjing) of Henan Province, China. The main wheat cultivar affected was Wenmai No.4. Almost 5.3 million ha of winter wheat are grown in Henan Province and 73% of the fields surveyed were found to be infested with Heterodera avenae (2). The affected wheat fields had stunted patches. Stunted seedlings had chlorotic or necrotic lower leaves, few or no tillers, and bushy, light brown roots leading to typical witches'-broom symptoms resulting from increased rootlet emergence at the nematode invasion sites. Individual roots had a knotted appearance. Cyst nematodes obtained from soil samples and plant samples at these four locations differed from those of H. avenae and had uniform morphological and molecular characteristics. Cysts were lemon shaped and bifenestrate, with an underbridge and strongly developed bullae. The lateral field of second-stage juveniles (J2) consisted of four incisures. These characteristics indicated that the four populations were H. filipjevi, a member of the ‘H. avenae Group’ of cereal cyst nematodes (1). Key morphological features were determined for cysts and J2. Cysts (n = 15) had the following characteristics, in addition to those described above: light brown color; bifenestrate vulval cone with horseshoe-shaped fenestrate; body length (not including the neck) ranged from 690 to 790 μm (mean of 750 μm); body width ranged from 410 to 640 μm (mean of 540 μm); neck length ranged from 86 to 100 μm (mean of 96 μm); fenestrate length of 59 to 70 μm (mean of 67.7 μm) and width of 31.3 to 36.7 μm (mean of 35.2 μm); underbridge length from 59 to 71 μm (mean of 68 μm); and vulval slit from 6.9 to 8.6 μm (mean of 7.9 μm). J2 (n = 10) had the following characteristics: body length ranged from 540 to 580 μm (mean of 550 μm); stylet length from 22.5 to 24.5 μm (mean of 23.5 μm) with anchor-shaped basal knobs; tail length of 52.5 to 62.5 μm (mean of 57.7 μm); and hyaline terminal tail ranged from 32 to 39 μm (mean of 33.8 μm). The tail had a sharp terminus. Amplification of the rDNA-internal transcribed spacer (ITS) region with primers TW81 and AB28 yielded a PCR fragment of 1,054 bp (3). Amplification of the D2/D3 fragments of the 28S RNA with universal primers D2A (5′-ACA AGT ACC GTG AGG GAA AGT TG-3′) and D3B (5′-TCG GAA GGA ACC AGC TAC TA-3′) yielded a PCR fragment of 782 bp. Digestion patterns of the ITS PCR fragments with AluI, CfoI, HifI, SatI, PstI, RsaI, TaqI, and Tru9I showed restriction profiles identical to that of H. filipjevi (3,4). Four ITS sequences (GU083595, GU083596, HM147944, and HM147945) and four D2D3 sequences (GU083592, GU083593, GU083594, and GU083597) from nematode samples collected in Liying, Xuchang, Weihui, and Yanjing, respectively, were submitted to GenBank. These sequences exhibited 99.4% similarity with that of H. filipjevi isolates from Germany (AY148400), Italy (AY347922), Russia (AY148401), Spain (AY148399), Tadzhikistan (AY148402), Turkey (AY148398 and AY148397), the United Kingdom (AY148403 and AF274399), and the United States (GU079654). To our knowledge, this is the first report of H. filipjevi in China. References: (1) Z. A. Handoo. J. Nematol. 34:250. 2002. (2) D. L. Peng et al. Proc. 1st Workshop Internat. Cereal Cyst Nemat. Initiative, Antalya Turkey, p. 29, 2009. (3) S. A. Subbotin et al. Nematology 1:195, 1999. (4) G. Yan and R. W. Smiley. Phytopathology 100:216, 2010.

Sign in / Sign up

Export Citation Format

Share Document