The Effect of Octapeptide Repeats on Prion Folding and Misfolding

Misfolding of prion protein (PrP) into amyloid aggregates is the central feature of prion diseases. PrP has an amyloidogenic C-terminal domain with three α-helices and a flexible tail in the N-terminal domain in which multiple octapeptide repeats are present in most mammals. The role of the octapeptides in prion diseases has previously been underestimated because the octapeptides are not located in the amyloidogenic domain. Correlation between the number of octapeptide repeats and age of onset suggests the critical role of octapeptide repeats in prion diseases. In this study, we have investigated four PrP variants without any octapeptides and with 1, 5 and 8 octapeptide repeats. From the comparison of the protein structure and the thermal stability of these proteins, as well as the characterization of amyloids converted from these PrP variants, we found that octapeptide repeats affect both folding and misfolding of PrP creating amyloid fibrils with distinct structures. Deletion of octapeptides forms fewer twisted fibrils and weakens the cytotoxicity. Insertion of octapeptides enhances the formation of typical silk-like fibrils but it does not increase the cytotoxicity. There might be some threshold effect and increasing the number of peptides beyond a certain limit has no further effect on the cell viability, though the reasons are unclear at this stage. Overall, the results of this study elucidate the molecular mechanism of octapeptides at the onset of prion diseases.

Download Full-text

Catalytic effectiveness of human aldose reductase. Critical role of C-terminal domain.

Journal of Biological Chemistry ◽

10.1016/s0021-9258(19)36783-3 ◽

1992 ◽

Vol 267 (29) ◽

pp. 20965-20970

Author(s):

K.M. Bohren ◽

C.E. Grimshaw ◽

K.H. Gabbay

Keyword(s):

Aldose Reductase ◽

Critical Role ◽

Terminal Domain

Download Full-text

Expression, Purification, and Characterization of (R)-Sulfolactate Dehydrogenase (ComC) from the Rumen MethanogenMethanobrevibacter milleraeSM9

Archaea ◽

10.1155/2017/5793620 ◽

2017 ◽

Vol 2017 ◽

pp. 1-6

Author(s):

Yanli Zhang ◽

Linley R. Schofield ◽

Carrie Sang ◽

Debjit Dey ◽

Ron S. Ronimus

Keyword(s):

Biosynthetic Pathway ◽

Critical Role ◽

Reduction Reaction ◽

Coenzyme M ◽

Purification And Characterization ◽

The Third ◽

Optimal Activity ◽

Methyl Coenzyme M Reductase

(R)-Sulfolactate dehydrogenase (EC 1.1.1.337), termed ComC, is a member of an NADH/NADPH-dependent oxidoreductase family of enzymes that catalyze the interconversion of 2-hydroxyacids into their corresponding 2-oxoacids. The ComC reaction is reversible and in the biosynthetic direction causes the conversion of (R)-sulfolactate to sulfopyruvate in the production of coenzyme M (2-mercaptoethanesulfonic acid). Coenzyme M is an essential cofactor required for the production of methane by the methyl-coenzyme M reductase complex. ComC catalyzes the third step in the first established biosynthetic pathway of coenzyme M and is also involved in methanopterin biosynthesis. In this study, ComC fromMethanobrevibacter milleraeSM9 was cloned and expressed inEscherichia coliand biochemically characterized. Sulfopyruvate was the preferred substrate using the reduction reaction, with 31% activity seen for oxaloacetate and 0.2% seen forα-ketoglutarate. Optimal activity was observed at pH 6.5. The apparentKMfor coenzyme (NADH) was 55.1 μM, and for sulfopyruvate, it was 196 μM (for sulfopyruvate theVmaxwas 93.9 μmol min−1 mg−1andkcatwas 62.8 s−1). The critical role of ComC in two separate cofactor pathways makes this enzyme a potential means of developing methanogen-specific inhibitors for controlling ruminant methane emissions which are increasingly being recognized as contributing to climate change.

Download Full-text

Molecular basis of the dual role of the Mlh1-Mlh3 endonuclease in MMR and in meiotic crossover formation

Proceedings of the National Academy of Sciences ◽

10.1073/pnas.2022704118 ◽

2021 ◽

Vol 118 (23) ◽

pp. e2022704118

Author(s):

Jingqi Dai ◽

Aurore Sanchez ◽

Céline Adam ◽

Lepakshi Ranjha ◽

Giordano Reginato ◽

...

Keyword(s):

Meiotic Recombination ◽

Molecular Basis ◽

Crystal Packing ◽

Critical Role ◽

Holliday Junctions ◽

Dual Roles ◽

Terminal Domain ◽

C Terminus ◽

Meiotic Crossover

In budding yeast, the MutL homolog heterodimer Mlh1-Mlh3 (MutLγ) plays a central role in the formation of meiotic crossovers. It is also involved in the repair of a subset of mismatches besides the main mismatch repair (MMR) endonuclease Mlh1-Pms1 (MutLα). The heterodimer interface and endonuclease sites of MutLγ and MutLα are located in their C-terminal domain (CTD). The molecular basis of MutLγ’s dual roles in MMR and meiosis is not known. To better understand the specificity of MutLγ, we characterized the crystal structure of Saccharomyces cerevisiae MutLγ(CTD). Although MutLγ(CTD) presents overall similarities with MutLα(CTD), it harbors some rearrangement of the surface surrounding the active site, which indicates altered substrate preference. The last amino acids of Mlh1 participate in the Mlh3 endonuclease site as previously reported for Pms1. We characterized mlh1 alleles and showed a critical role of this Mlh1 extreme C terminus both in MMR and in meiotic recombination. We showed that the MutLγ(CTD) preferentially binds Holliday junctions, contrary to MutLα(CTD). We characterized Mlh3 positions on the N-terminal domain (NTD) and CTD that could contribute to the positioning of the NTD close to the CTD in the context of the full-length MutLγ. Finally, crystal packing revealed an assembly of MutLγ(CTD) molecules in filament structures. Mutation at the corresponding interfaces reduced crossover formation, suggesting that these superstructures may contribute to the oligomer formation proposed for MutLγ. This study defines clear divergent features between the MutL homologs and identifies, at the molecular level, their specialization toward MMR or meiotic recombination functions.

Download Full-text

Protein Fibrillar Nanopolymers: Molecular-Level Insights into Their Structural, Physical and Mechanical Properties

Biophysical Reviews and Letters ◽

10.1142/s1793048015300029 ◽

2015 ◽

Vol 10 (03) ◽

pp. 135-156 ◽

Cited By ~ 3

Author(s):

Valeriya M. Trusova

Keyword(s):

Protein Misfolding ◽

Amyloid Fibrils ◽

Molecular Level ◽

Physical And Mechanical Properties ◽

Present Contribution ◽

Wide Range ◽

Generic Class ◽

Protein Fibril

Amyloid fibrils represent a generic class of mechanically strong and stable biomaterials with extremely advantageous properties. Although amyloids were initially associated only with severe neurological disorders, the role of these structures nowadays is shifting from health debilitating to highly beneficial both in biomedical and technological aspects. Intensive involvement of fibrillar assemblies into the wide range of pathogenic and functional processes strongly necessitate the molecular level characterization of the structural, physical and elastic features of protein nanofibrils. In the present contribution, we made an attempt to highlight the up-to-date progress in the understanding of amyloid properties from the polymer physics standpoint. The fundamental insights into protein fibril behavior are essential not only for development of therapeutic strategies to combat the protein misfolding disorders but also for rational and precise design of novel biodegradable protein-based nanopolymers.

Download Full-text

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

Microbiology ◽

10.1099/mic.0.049213-0 ◽

2011 ◽

Vol 157 (9) ◽

pp. 2670-2680 ◽

Cited By ~ 19

Author(s):

Iria Uhía ◽

Beatriz Galán ◽

Francisco Javier Medrano ◽

José Luis García

Keyword(s):

Mycobacterium Smegmatis ◽

Transcription Start ◽

Promoter Regions ◽

Degradative Pathway ◽

Terminal Domain ◽

Heterologous System ◽

Highly Hydrophobic ◽

Extension Analysis

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-β-hydroxysteroid dehydrogenase (3-β HSDMS) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 5′ untranslated region (5′UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the −5 and −35 positions with respect to the transcription start site. This region overlaps with the −10 and −35 boxes of the P5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P5228 –β-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism.

Download Full-text

The Chlamydia-Secreted Protease CPAF Promotes Chlamydial Survival in the Mouse Lower Genital Tract

Infection and Immunity ◽

10.1128/iai.00280-16 ◽

2016 ◽

Vol 84 (9) ◽

pp. 2697-2702 ◽

Cited By ~ 15

Author(s):

Zhangsheng Yang ◽

Lingli Tang ◽

Lili Shao ◽

Yuyang Zhang ◽

Tianyuan Zhang ◽

...

Keyword(s):

Genital Tract ◽

Chlamydial Infection ◽

Critical Role ◽

Content Type ◽

Lower Genital Tract ◽

Successful Infection ◽

Multiple Strains

Despite the extensivein vitrocharacterization of CPAF (chlamydialprotease/proteasome-likeactivityfactor), its role in chlamydial infection and pathogenesis remains unclear. We now report that aChlamydia trachomatisstrain deficient in expression of CPAF (L2-17) is no longer able to establish a successful infection in the mouse lower genital tract following an intravaginal inoculation. The L2-17 organisms were cleared from the mouse lower genital tract within a few days, while a CPAF-sufficientC. trachomatisstrain (L2-5) survived in the lower genital tract for more than 3 weeks. However, both the L2-17 and L2-5 organisms maintained robust infection courses that lasted up to 4 weeks when they were directly delivered into the mouse upper genital tract. The CPAF-dependent chlamydial survival in the lower genital tract was confirmed in multiple strains of mice. Thus, we have demonstrated a critical role of CPAF in promotingC. trachomatissurvival in the mouse lower genital tracts. It will be interesting to further investigate the mechanisms of the CPAF-dependent chlamydial pathogenicity.

Download Full-text

Molecular insights into regulation of JAK2 in myeloproliferative neoplasms

Blood ◽

10.1182/blood-2015-01-621110 ◽

2015 ◽

Vol 125 (22) ◽

pp. 3388-3392 ◽

Cited By ~ 39

Author(s):

Olli Silvennoinen ◽

Stevan R. Hubbard

Keyword(s):

Molecular Characterization ◽

Human Disease ◽

Molecular Mechanisms ◽

Myeloproliferative Neoplasms ◽

Critical Role ◽

Hematologic Malignancies ◽

Janus Kinase ◽

Constitutive Activation

Abstract The critical role of Janus kinase-2 (JAK2) in regulation of myelopoiesis was established 2 decades ago, but identification of mutations in the pseudokinase domain of JAK2 in myeloproliferative neoplasms (MPNs) and in other hematologic malignancies highlighted the role of JAK2 in human disease. These findings have revolutionized the diagnostics of MPNs and led to development of novel JAK2 therapeutics. However, the molecular mechanisms by which mutations in the pseudokinase domain lead to hyperactivation of JAK2 and clinical disease have been unclear. Here, we describe recent advances in the molecular characterization of the JAK2 pseudokinase domain and how pathogenic mutations lead to constitutive activation of JAK2.

Download Full-text

Isolation and Characterization of Cryptococcus neoformans Spores Reveal a Critical Role for Capsule Biosynthesis Genes in Spore Biogenesis

Eukaryotic Cell ◽

10.1128/ec.00352-08 ◽

2009 ◽

Vol 8 (4) ◽

pp. 595-605 ◽

Cited By ~ 60

Author(s):

Michael R. Botts ◽

Steven S. Giles ◽

Marcellene A. Gates ◽

Thomas R. Kozel ◽

Christina M. Hull

Keyword(s):

Cryptococcus Neoformans ◽

Fungal Pathogens ◽

Critical Role ◽

Spore Formation ◽

Yeast Cells ◽

Isolation And Characterization ◽

Specific Configuration ◽

First Time

ABSTRACT Spores are essential particles for the survival of many organisms, both prokaryotic and eukaryotic. Among the eukaryotes, fungi have developed spores with superior resistance and dispersal properties. For the human fungal pathogens, however, relatively little is known about the role that spores play in dispersal and infection. Here we present the purification and characterization of spores from the environmental fungus Cryptococcus neoformans. For the first time, we purified spores to homogeneity and assessed their morphological, stress resistance, and surface properties. We found that spores are morphologically distinct from yeast cells and are covered with a thick spore coat. Spores are also more resistant to environmental stresses than yeast cells and display a spore-specific configuration of polysaccharides on their surfaces. Surprisingly, we found that the surface of the spore reacts with antibodies to the polysaccharide glucuronoxylomannan, the most abundant component of the polysaccharide capsule required for C. neoformans virulence. We explored the role of capsule polysaccharide in spore development by assessing spore formation in a series of acapsular strains and determined that capsule biosynthesis genes are required for proper sexual development and normal spore formation. Our findings suggest that C. neoformans spores may have an adapted cell surface that facilitates persistence in harsh environments and ultimately allows them to infect mammalian hosts.

Download Full-text

GPIHBP1 C89F Neomutation and Hydrophobic C-Terminal Domain G175R Mutation in Two Pedigrees with Severe Hyperchylomicronemia

The Journal of Clinical Endocrinology & Metabolism ◽

10.1210/jc.2011-1444 ◽

2011 ◽

Vol 96 (10) ◽

pp. E1675-E1679 ◽

Cited By ~ 49

Author(s):

Sybil Charrière ◽

Noël Peretti ◽

Sophie Bernard ◽

Mathilde Di Filippo ◽

Agnès Sassolas ◽

...

Keyword(s):

Critical Role ◽

Phenotypic Expression ◽

Missense Mutations ◽

Terminal Domain ◽

Apoa5 Gene ◽

Key Enzyme ◽

History Of ◽

Functional Consequences ◽

Signal Peptide Polymorphism

Abstract Context: GPIHBP1 is a new endothelial binding site for lipoprotein lipase (LPL), the key enzyme for intravascular lipolysis of triglyceride-rich lipoproteins (TGRL). We have identified two new missense mutations of the GPIHBP1 gene, C89F and G175R, by systematic sequencing in a cohort of 376 hyperchylomicronemic patients without mutations on the LPL, APOC2, or APOA5 gene. Objective: Phenotypic expression and functional consequences of these two mutations were studied. Design: We performed clinical and genotypic studies of probands and their families. GPIHBP1 functional alterations were studied in CHO pgsA-745 transfected cells. Results: Probands are an adult with a homozygous G175R mutation and a child with a hemizygous C89F neomutation and a deletion of the second allele. C89F mutation was associated with a C14F signal peptide polymorphism on the same haplotype. Both patients had resistant hyperchylomicronemia, low LPL activity, and history of acute pancreatitis. In CHO pgsA-745 cells, both G175R and C14F variants reduce the expression of GPIHBP1 at the cell surface. C89F mutation is responsible for a drastic LPL-binding defect to GPIHBP1. C14F may further potentiate C89F effect. Conclusions: The emergence of hyperchylomicronemia in the generation after a neomutation further establishes a critical role for GPIHBP1 in TGRL physiopathology in humans. Our results highlight the crucial role of C65-C89 disulfide bond in LPL binding by GPIHBP1 Ly6 domain. Furthermore, we first report a mutation of the hydrophobic C-terminal domain that impairs GPIHBP1 membrane targeting.

Download Full-text