scholarly journals Genetic variant of <i>SPARC</i> gene and its association with growth traits in Chinese cattle

2020 ◽  
Vol 63 (1) ◽  
pp. 31-37 ◽  
Author(s):  
Danyang Zhang ◽  
Jiawei Xu ◽  
Peng Yang ◽  
Yifan Wen ◽  
Hua He ◽  
...  
Keyword(s):  
Genetic Variant ◽  
Growth Traits ◽  
Expression Level ◽  
Qinchuan Cattle ◽  
Adult Cattle ◽  
Chinese Cattle ◽  
Muscle Tissues ◽  
Selection For ◽  
Dna Pool ◽  
Sparc Expression

Abstract. SPARC is a cysteine-rich acidic secreted protein. It is a non-collagen component of bone, which is widely distributed in humans and animals and plays an important role. SPARC has been found in a variety of human cancers (breast cancer, stomach cancer, ovarian cancer, etc.) and diabetes-related research. Especially the muscle and fat metabolism are closely related. In this study, we used a DNA pool to detect a new SNP site (g.12454T > C). A total of 616 samples of four breeds of Qinchuan cattle (QC, n=176), Xianan cattle (XN, n=160), Pinan cattle (PN, n=136) and Jiaxian cattle (JX, n=144) were analyzed and identified with ARMS-PCR. In addition, we correlated SNP with growth traits and showed significant correlation with growth traits such as rump length, hip width, and body length (p<0.05). Moreover, we tested the SPARC gene expression level in different tissues belonging to XN adult cattle (n=3) and found its high expression in muscle tissues (relative to the kidney). Further, we found the SNP is able to increase the SPARC expression level in skeletal muscle (n=12). According to statistical data, this SNP site may be applied to a molecular marker of an early marker-assisted selection for early growth of beef cattle.

scholarly journals Differential Expression of ACTL8 Gene and Association Study of Its Variations with Growth Traits in Chinese Cattle

Animals ◽  
2019 ◽  
Vol 9 (12) ◽  
pp. 1068
Author(s):  
Cuicui Cai ◽  
Jiawei Xu ◽  
Yongzhen Huang ◽  
Xianyong Lan ◽  
Chuzhao Lei ◽  
...  
Keyword(s):  
Expression Profile ◽  
Growth Traits ◽  
Muscle Growth ◽  
Tissue Expression ◽  
Expression Level ◽  
Nucleotide Polymorphisms ◽  
Qinchuan Cattle ◽  
Base Level ◽  
Muscle Tissues ◽  
Tissue Expression Profile

Mutations are heritable changes at the base level of genomic DNA. Furthermore, mutations lead to genetic polymorphisms and may alter animal growth phenotypes. Our previous study found that mutations in the bovine Actin-like protein 8 (ACTL8) gene may be involved in muscle growth and development. This study explored several mutations of the ACTL8 gene and their influence on body size in Chinese beef cattle, as well as tested the tissue expression profile of the ACTL8 gene in Qinchuan cattle at different ages. Five single nucleotide polymorphisms (SNPs) (including one synonymous mutation (c.2135552895G > A)) and two insertion/deletion polymorphisms (indels) were identified in the ACTL8 gene from 1138 cattle by DNA-seq, RFLP and other methods. Then, the expression profile of the ACTL8 gene in Qinchuan cattle showed that it was expressed in heart, spleen, lung, liver, muscle, and fat tissues. Moreover, the expression level of ACTL8 was increased with cattle growth (p < 0.01). The ACTL8 mRNA expression level in kidney and muscle tissues was the highest in the calves, while lowest in the fetal stage. Overall, we showed that the mutations could act as markers in beef molecular breeding and selection of the growth traits of cattle.

scholarly journals Exploring insertions and deletions (indels) of <i>MSRB3</i> gene and their association with growth traits in four Chinese indigenous cattle breeds

2019 ◽  
Vol 62 (2) ◽  
pp. 465-475 ◽  
Author(s):  
Mingli Wu ◽  
Shipeng Li ◽  
Guoliang Zhang ◽  
Yingzhi Fan ◽  
Yuan Gao ◽  
...  
Keyword(s):  
Growth Traits ◽  
Methionine Sulfoxide ◽  
Methionine Sulfoxide Reductase ◽  
Qinchuan Cattle ◽  
Cattle Breeding ◽  
Indigenous Cattle ◽  
Insertions And Deletions ◽  
Cattle Breeds ◽  
Dna Pool ◽  
Candidate Loci

Abstract. Methionine sulfoxide reductase B3 (MSRB3) is instrumental in ossification and fat deposition, which regulate the growth and development of cattle directly. The purpose of this study was aimed to explore insertions and deletions (indels) in MSRB3 gene and investigate their association with growth traits in four indigenous cattle breeds (Luxi cattle, Qinchuan cattle, Nanyang cattle, and Jiaxian Red cattle). Four indels were identified by sequencing with DNA pool. Association analysis showed that three of them were associated with growth traits (P<0.05). For P1, the DD (deletion and deletion) genotype was significantly associated with body length of Nanyang cattle; for P6, II (insertion and insertion) and/or DD genotypes were significantly associated with enhanced growth traits of Qinchuan cattle; for P7, II genotype was significantly associated with hucklebone width of Luxi cattle. Our results demonstrated that the polymorphisms in bovine MSRB3 gene were significantly associated with growth traits, which could be candidate loci for marker-assisted selection (MAS) in cattle breeding.

scholarly journals Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat

2016 ◽  
Vol 59 (1) ◽  
pp. 91-95 ◽  
Author(s):  
H. Cai ◽  
Z. Wang ◽  
X. Lan ◽  
Y. Xu ◽  
H. Chen ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Subcutaneous Fat ◽  
Homozygous Deletion ◽  
Expression Level ◽  
Longissimus Muscle ◽  
Heterozygous Genotype ◽  
Qinchuan Cattle ◽  
Adult Cattle ◽  
Expression Levels ◽  
Functional Studies

Abstract. Visfatin, an adipokine hormone produced primarily by visceral adipose tissue in mammals, has been identified as having a crucial role in growth and development of skeletal muscle and lipids. In this research, the effects of two indel loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel: AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5) of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was prominently greater than that in calves and adult cattle (P < 0.05). The expression level of visfatin in subcutaneous fat was notably higher than that in longissimus muscle of calves and adult cattle (P < 0.05). Secondly, there were three genotypes (ins/ins, del/del and ins/del) and two genotypes (ins/del and ins/ins) detected in the 35 bp locus and 6 bp locus, respectively. Visfatin showed a minimum expression level in longissimus muscle in the homozygous deletion genotype at the 35 bp indel locus. Especially in calves, expression of visfatin was significantly greater in the heterozygous genotype than that in the homozygous insertion genotpye (P < 0.05). No statistical differences were found among visfatin expression level based on genotypes in the 6 bp indel locus (P > 0.05). Compared to heterozygous genotype, the expression level of homozygous insertion genotype was lower in longissimus muscle but greater in subcutaneous fat. These results imply that the expression levels of bovine visfatin vary with age and its indels might be putative variants mediating the expression of the bovine visfatin gene. This study provides useful information for further functional studies of bovine visfatin.

scholarly journals A novel 17 bp indel in the <i>SMAD3</i> gene alters transcription level, contributing to phenotypic traits in Chinese cattle

2016 ◽  
Vol 59 (1) ◽  
pp. 151-157 ◽  
Author(s):  
Tao Shi ◽  
Wenwen Peng ◽  
Jianyu Yan ◽  
Hanfang Cai ◽  
Xianyong Lan ◽  
...  
Keyword(s):  
Body Weight ◽  
Transforming Growth Factor Beta ◽  
Transforming Growth Factor ◽  
Growth Traits ◽  
Body Height ◽  
Phenotypic Traits ◽  
Cattle Breeding ◽  
Chinese Cattle ◽  
Chest Girth ◽  
Dna Pool

Abstract. SMAD3, the messenger of the transforming growth factor beta (TGF-β) signaling pathway, plays essential roles in myogenesis and osteogenesis and may relate to the regulation of body weight. In this study, a 17 bp indel (NC_007308: g.101893_101909insGAGGATGAGTGCTCCAG) in intron3 of the SMAD3 gene was detected in four Chinese cattle breeds (Qinchuan, Jiaxian, Nanyang and Caoyuan) by using DNA pool sequencing, and its effects on gene expression and growth traits were analyzed in Qinchuan and Caoyuan cattle. The results showed that the indel locus was significantly associated with SMAD3 transcriptional levels where II genotypes had a higher value than DD genotypes in Qinchuan (QC) cattle muscle tissue (P < 0.05). In addition, the locus was strongly associated with chest girth, chest width, rump length, hucklebone width and body weight in 2-year-old QC cattle (P < 0.05) and body weight (12 months), body height (18 months) and chest girth (18 months) in Caoyuan cattle (P < 0.5). To the best of our knowledge, this is the first evidence of the association between SMAD3 indel and cattle phenotype, and it may contribute to understanding the function of the indel, which could be a promising marker for beef cattle breeding.

Genetic Variant of MYLK4 Gene and its Association with Growth Traits in Chinese Cattle

2018 ◽  
Vol 30 (1) ◽  
pp. 30-35 ◽  
Author(s):  
Li Zheng ◽  
Gui-Min Zhang ◽  
Yan-Peng Dong ◽  
Yi-Fan Wen ◽  
Dong Dong ◽  
...  
Keyword(s):  
Genetic Variant ◽  
Growth Traits ◽  
Chinese Cattle

scholarly journals Function of the Porcine TRPC1 Gene in Myogenesis and Muscle Growth

Cells ◽  
2021 ◽  
Vol 10 (1) ◽  
pp. 147
Author(s):  
Yu Fu ◽  
Peng Shang ◽  
Bo Zhang ◽  
Xiaolong Tian ◽  
Ruixue Nie ◽  
...  
Keyword(s):  
Transient Receptor Potential ◽  
Growth Traits ◽  
Expression Profiles ◽  
Muscle Growth ◽  
Receptor Potential ◽  
Transient Receptor Potential Channel ◽  
Nucleotide Polymorphisms ◽  
Pig Breeds ◽  
Muscle Tissues ◽  
Transient Receptor

In animals, muscle growth is a quantitative trait controlled by multiple genes. Previously, we showed that the transient receptor potential channel 1 (TRPC1) gene was differentially expressed in muscle tissues between pig breeds with divergent growth traits base on RNA-seq. Here, we characterized TRPC1 expression profiles in different tissues and pig breeds and showed that TRPC1 was highly expressed in the muscle. We found two single nucleotide polymorphisms (SNPs) (C-1763T and C-1604T) in TRPC1 that could affect the promoter region activity and regulate pig growth rate. Functionally, we used RNAi and overexpression to illustrate that TRPC1 promotes myoblast proliferation, migration, differentiation, fusion, and muscle hypertrophy while inhibiting muscle degradation. These processes may be mediated by the activation of Wnt signaling pathways. Altogether, our results revealed that TRPC1 might promote muscle growth and development and plays a key role in Wnt-mediated myogenesis.

A novel SNP of PLAG1 gene and its association with growth traits in Chinese cattle

Gene ◽  
2019 ◽  
Vol 689 ◽  
pp. 166-171 ◽  
Author(s):  
Jia-Lin Zhong ◽  
Jia-Wei Xu ◽  
Jian Wang ◽  
Yi-fan Wen ◽  
Hui Niu ◽  
...  
Keyword(s):  
Growth Traits ◽  
Chinese Cattle ◽  
Novel Snp

scholarly journals Correlated Response on Growth Traits and Their Variabilities to Selection for Ovulation Rate in Rabbits Using Genetic Trends and a Cryopreserved Control Population

Animals ◽  
2021 ◽  
Vol 11 (9) ◽  
pp. 2591
Author(s):  
Rosa Peiró ◽  
Celia Quirino ◽  
Agustín Blasco ◽  
María Antonia Santacreu
Keyword(s):  
Growth Traits ◽  
Ovulation Rate ◽  
Control Population ◽  
Individual Growth ◽  
Correlated Response ◽  
Phenotypic Variance ◽  
Correlated Responses ◽  
Growth Variability ◽  
Selection For ◽  
Genetic Trends

The aim of this work was to estimate correlated responses in growth traits and their variabilities in an experiment of selection for ovulation rate during 10 generations in rabbits. Individual weight at 28 days old (IW28, kg) and at 63 days old (IW63, kg) was analyzed, as well as individual growth rate (IGR = IW63 − IW28, kg). The variability of each growth trait was calculated as the absolute value of the difference between the individual value and the mean value of their litter. Data were analyzed using Bayesian methodology. The estimated heritabilities of IW28, IW63 and IGR were low, whereas negligible heritabilities were obtained for growth variability traits. The common litter effect was high for all growth traits, around 30% of the phenotypic variance, whereas low maternal effect for all growth traits was obtained. Low genetic correlations between ovulation rate and growth traits were found, and also between ovulation rate and the variability of growth traits. Therefore, genetic trends methods did not show correlated responses in growth traits. A similar result was also obtained using a cryopreserved control population.

scholarly journals Clonal Variation and Genotype by Environment Interactions in Growth and Wood Density in Eucalyptus camaldulensis at Three Contrasting Sites in Vietnam

2010 ◽  
Vol 59 (1-6) ◽  
pp. 17-28 ◽  
Author(s):  
N. D. Kien ◽  
G. Jansson ◽  
C. Harwood ◽  
C. Almqvist
Keyword(s):  
Growth Traits ◽  
Basic Density ◽  
Eucalyptus Camaldulensis ◽  
Clonal Variation ◽  
Direct Selection ◽  
North Central ◽  
Genotype By Environment ◽  
Pilodyn Penetration ◽  
Selection For ◽  
Genotypic Correlations

AbstractA total of 172 clones of Eucalyptus camaldulensis were tested in three clonal tests in northern, north-central and southern Vietnam, with 32 of them planted across all three sites. At age 3-5 years, the clonal repeatabilities were 0.18-0.42 for growth traits, 0.71-0.78 for wood basic density and 0.56-0.66 for pilodyn penetration. Genotypic correlations between growth and density at the three sites were from -0.24 to 0.17, and did not differ significantly from zero. Genotypic correlations between sites were 0.32-0.56 for growth traits at age 3 years, and 0.72-0.88 for density and pilodyn penetration. Selection gains for breast height diameter at individual sites at a selection proportion of 5% were 22-32%, with minor effects on density. Selection for diameter at one site gave indirect responses in diameter at the other two sites that were only 40-60% of the gains obtainable from direct selection at those sites. This study shows that fast-growing E. camaldulensis clones can be selected in Vietnam with only minor effects on density. Selection for growth should be regionally based to maximize selection gain whereas clonal rankings for density will change little across regions.

Sign in / Sign up

Export Citation Format

Share Document