scholarly journals Indels within the bovine visfatin gene affect its mRNA expression in longissimus muscle and subcutaneous fat

2016 ◽  
Vol 59 (1) ◽  
pp. 91-95 ◽  
Author(s):  
H. Cai ◽  
Z. Wang ◽  
X. Lan ◽  
Y. Xu ◽  
H. Chen ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Subcutaneous Fat ◽  
Homozygous Deletion ◽  
Expression Level ◽  
Longissimus Muscle ◽  
Heterozygous Genotype ◽  
Qinchuan Cattle ◽  
Adult Cattle ◽  
Expression Levels ◽  
Functional Studies

Abstract. Visfatin, an adipokine hormone produced primarily by visceral adipose tissue in mammals, has been identified as having a crucial role in growth and development of skeletal muscle and lipids. In this research, the effects of two indel loci (35 bp indel: AC_000161.1: g. 20540–20541 Ins ACTGGAATTCTAGTTTAAAAATTGCTACTAATGAA located in intron 4; 6 bp indel: AC_000161.1: g. 25873–25878 Del: TAAAAA located in intron 5) of the visfatin gene on mRNA expression levels were studied by means of real-time quantitative PCR (qPCR) in longissimus muscle and subcutaneous fat from 95 Qinchuan cattle. Firstly, visfatin expression level in longissimus muscle of fetal cattle was prominently greater than that in calves and adult cattle (P < 0.05). The expression level of visfatin in subcutaneous fat was notably higher than that in longissimus muscle of calves and adult cattle (P < 0.05). Secondly, there were three genotypes (ins/ins, del/del and ins/del) and two genotypes (ins/del and ins/ins) detected in the 35 bp locus and 6 bp locus, respectively. Visfatin showed a minimum expression level in longissimus muscle in the homozygous deletion genotype at the 35 bp indel locus. Especially in calves, expression of visfatin was significantly greater in the heterozygous genotype than that in the homozygous insertion genotpye (P < 0.05). No statistical differences were found among visfatin expression level based on genotypes in the 6 bp indel locus (P > 0.05). Compared to heterozygous genotype, the expression level of homozygous insertion genotype was lower in longissimus muscle but greater in subcutaneous fat. These results imply that the expression levels of bovine visfatin vary with age and its indels might be putative variants mediating the expression of the bovine visfatin gene. This study provides useful information for further functional studies of bovine visfatin.

scholarly journals Effect of Breed on Transcriptional and Protein Expression of Lipogenic Enzymes in Tail and Subcutaneous Adipose Tissue from Two Grazing Breeds of Lambs

Animals ◽  
2019 ◽  
Vol 9 (2) ◽  
pp. 64
Author(s):  
María Gallardo ◽  
Luis Arias-Darraz ◽  
Juan Cárcamo
Keyword(s):  
Fatty Acid ◽  
Protein Expression ◽  
Mrna Expression ◽  
Fatty Acid Synthase ◽  
Regulatory Element ◽  
Subcutaneous Fat ◽  
Human Consumption ◽  
Meat Industry ◽  
Lipogenic Enzymes ◽  
Expression Levels

This experiment was carried out to determine the effect of breed on mRNA and protein expression levels of lipogenic enzymes acetyl-CoA carboxylase α (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase 1 (SCD1) plus sterol regulatory element binding transcription factor 1c (SREBP1c) in the subcutaneous fat (SCF) from the back of the animal, and tail fat (TF) of both Chilota and Suffolk Down lambs grazing Calafatal. Eight Chilota and six Suffolk Down 2-month-old male lambs were allocated to graze a “Calafatal”, a typical secondary succession of Chiloé Archipelago, Chile. After 62 d, lambs were slaughtered according to Chile’s meat industry standards. Fatty acid profile, RT-qPCR, and Western blot analyses from SCF and TF samples were performed. Although the mRNA expression levels of ACC, FAS, SCD1 and SREBP1c in SCF did not differ significantly between breeds (p > 0.05), a trend to higher mRNA expression of FAS and SREBP1c in TF from Chilota lambs was observed (p = 0.06). On the other hand, FAS levels in SCF were higher in Chilota than in Suffolk Down lambs (p < 0.02), although Suffolk Down showed higher fat contents and saturated fatty acid (SFA) proportions than Chilota lambs (p < 0.01). The FAS protein expression in TF was similar in both breeds (p > 0.05). Although the fat content was higher in Suffolk Down than in Chilota lambs (p < 0.01), the SFA proportions were similar in both breeds. Finally, it can be concluded that although mRNA expression of enzymes was similar in both breeds, there were differences in some protein levels in the SCF, partially related with the fatty acid profiles, thus affecting the selection of lamb breed either for human consumption or experimental purposes.

Changes in the Messenger RNA Expression of Toll-Like Receptors 2 and 4 in Healthy Infants According to Age

2018 ◽  
Vol 35 (06) ◽  
pp. 583-588 ◽  
Author(s):  
Ilaria Galliano ◽  
Maria Garro ◽  
Andrea Savino ◽  
Paolo Manzoni ◽  
Valentina Daprà ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Messenger Rna ◽  
Microbial Colonization ◽  
Expression Level ◽  
Messenger Rnas ◽  
Toll Like Receptors ◽  
Expression Levels ◽  
Healthy Infants ◽  
Wide Range ◽  
Median Expression

Background Toll-like receptors (TLRs) are potentially useful indicators of several pediatric disease states. Here, we explore the mechanisms by which inflammation is regulated by interactions between microbiota and the host. Little data are available regarding the expression of TLRs in postnatal healthy infants. TLR 2 and TLR4 are extracellular TLRs that act as innate immune receptors by recognizing a wide range of endogenous ligands and microorganisms. Methods The aim of this study was to use real-time polymerase chain reaction to investigate the expression of the messenger RNAs (mRNAs) of TLR2 and TLR4 in blood samples obtained from healthy full-term infants and toddlers. Results We analyzed the mRNA expression levels of TLRs in 88 healthy term children separated according to age. The median expression level of TLR2 was 1.49 ± 1.10 arbitrary units (AU) (n = 25) in infants younger than 3 months, 0.67 ± 0.72 AU (n = 25) in infants aged between 3 and 12 months, and 0.03 ± 0.02 AU (n= 38) in infants older than 12 months. The median expression level of TLR4 was 1.25 ± 0.79 AU (n = 25) in infants younger than 3 months, 0.75 ± 0.54 AU (n = 25) in infants aged 3 to 12 months, and 0.44 ± 0.28 AU (n = 38) in infants older than 12 months. There was difference in the mRNA expression level of TLR2 and TLR4 between infants aged 0 to 3 and 3 to 12 months and those aged more than 1 year (p < 0.0001 and p < 0.0001, respectively) Conclusion We found that the expression levels of TLR2 and TLR4 were associated with age. In particular, we observed that their expression increased during the suckling period and then clearly decreased once the infants reached 1 year of age (p < 0.001). These findings could be related to microbial colonization and the immune system.

scholarly journals Neudesin Neurotrophic Factor Promotes Bovine Preadipocyte Differentiation and Inhibits Myoblast Myogenesis

Animals ◽  
2019 ◽  
Vol 9 (12) ◽  
pp. 1109 ◽  
Author(s):  
Xiaotong Su ◽  
Yaning Wang ◽  
Anqi Li ◽  
Linsen Zan ◽  
Hongbao Wang
Keyword(s):  
Adipose Tissue ◽  
Protein Expression ◽  
Mrna Expression ◽  
Neurotrophic Factor ◽  
Muscle Development ◽  
Expression Patterns ◽  
Marker Genes ◽  
Qinchuan Cattle ◽  
Preadipocyte Differentiation ◽  
Expression Levels

Neudesin neurotrophic factor (NENF) is a secreted protein that is essential in multiple biological processes, including neural functions, adipogenesis, and tumorigenesis. In our previous study, NENF was significantly inhibited in the bovine adipocytes-myoblasts co-culture system. However, studies on NENF regulation of bovine muscle development and involvement in the cross-talk between adipose tissue and skeletal muscle have not been reported. Hence, the aim of this study was to clarify the functional roles of NENF in bovine preadipocytes and myoblasts. Real-time quantitative PCR (RT-qPCR) was performed to examine the spatial expression patterns of NENF in different tissues, and the results showed that NENF was highly expressed in the muscle of four-day-old and 24-month-old Qinchuan cattle. Compared with four-day-old Qinchuan cattle, the expression level of NENF was significantly up-regulated in 24-month-old bovine adipose tissue. To explore the roles of NENF in bovine myoblast and preadipocyte differentiation, small interfering RNA (siRNA) targeting the NENF gene were transfected into bovine preadipocytes and myoblasts to knock down the expression of the NENF gene. The results showed that the knockdown of NENF in differentiating adipocytes attenuated lipid accumulation, decreased the mRNA expression of adipogenic key marker genes PPARγ, CEBPα, CEBPβ, FASN, and SCD1, and decreased the protein expression of PPARγ, CEBPα, and FASN. The formation of myotubes was significantly accelerated, and the mRNA expression levels of myogenic marker genes MYOD1, MYF5, MYF6, MEF2A, MEF2C, and CKM, and the protein expression levels of MYOD1, MYF6, MEF2A, and CKM were up-regulated in myoblasts where NENF was knocked down. In short, the knockdown of NENF inhibited preadipocyte differentiation and promoted myoblast myogenesis.

Plasma TS mRNA expression as a potential predictive biomarker for pemetrexed and raltitrexed in gastric cancer.

2012 ◽  
Vol 30 (15_suppl) ◽  
pp. e21034-e21034
Author(s):  
Baorui Liu ◽  
Jie Shen ◽  
Hao Wang ◽  
Jia Wei ◽  
Lixia Yu ◽  
...  
Keyword(s):  
Gastric Cancer ◽  
Mrna Expression ◽  
Predictive Biomarker ◽  
Chemotherapeutic Agents ◽  
Water Soluble ◽  
Expression Level ◽  
Mrna Levels ◽  
Expression Levels ◽  
In Vitro Chemosensitivity

e21034 Background: Plasma mRNA opens up new investigational opportunities and has great potential for use in disease and treatment assessment. Pemetrexed and raltitrexed are novel water-soluble quinazoline folate analogues and act as direct and specific TS inhibitors. Although TS expression levels detected in tumor have shown potential in predicting sensitivity to those two chemotherapeutic agents, current knowledge is limited on the role of plasma TS mRNA as a predictive biomarker. The aim of this study was to investigate the association between plasma TS mRNA expression and in vitro chemosensitivity to pemetrexed and raltitrexed in gastric cancer. Methods: 150 freshly-removed gastric tumor specimens and corresponding blood samples before surgery were collected. Pemetrexed and raltitrexed sensitivity was determined by histoculture drug response assay (HDRA) procedures. Plasma and tumor TS mRNA expression level were determined by quantitative RT-PCR. Results: A significant correlation was observed between plasma and tumor TS mRNA expression levels (rho=0.665, P<0.001). Plasma TS expression level was negatively correlated with in vitro sensitivity to pemetrexed and raltitrexed in gastric cancer (pemetrexed-sensitive sub-group: 0.90, 95% CI: 0.66-1.16; pemetrexed-resistant sub-group: 1.82, 95% CI: 1.38-2.26, P<0.001; raltitrexed-sensitive sub-group: 0.91, 95% CI: 0.64-1.22; raltitrexed-resistant sub-group: 1.62, 95% CI: 1.06-2.17, P=0.013). There was no significant association between clinical characteristics and plasma TS mRNA levels or in vitro chemosensitivity. Conclusions: Our results indicated that plasma TS mRNA expression could be a prominent predictive biomarker for raltitrexed in gastric cancer, enabling the development of ‘‘real-time’’ individualized chemotherapy while tumor progression.

scholarly journals Th2 cytokine bias induced by silver nanoparticles in peripheral blood mononuclear cells of common bottlenose dolphins (Tursiops truncatus)

PeerJ ◽  
2018 ◽  
Vol 6 ◽  
pp. e5432 ◽  
Author(s):  
Wen-Ta Li ◽  
Lei-Ya Wang ◽  
Hui-Wen Chang ◽  
Wei-Cheng Yang ◽  
Chieh Lo ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Mononuclear Cells ◽  
Bottlenose Dolphins ◽  
Expression Level ◽  
Mrna Expression Level ◽  
Expression Levels ◽  
Th2 Cytokine ◽  
Tnf Α ◽  
Ifn Γ ◽  
Mrna Expression Levels

Background Silver nanoparticles (AgNPs) have been widely used in many commercial products due to their excellent antibacterial ability. The AgNPs are released into the environment, gradually accumulate in the ocean, and may affect animals at high trophic levels, such as cetaceans and humans, via the food chain. Hence, the negative health impacts caused by AgNPs in cetaceans are of concern. Cytokines play a major role in the modulation of immune system and can be classified into two types: Th1 and Th2. Th1/Th2 balance can be evaluated by the ratios of their polarizing cytokines (i.e., interferon [IFN]-γ/Interleukin [IL]-4), and animals with imbalanced Th1/Th2 response may become more susceptible to certain kinds of infection. Therefore, the present study evaluated the in vitro cytokine responses of cetacean peripheral blood mononuclear cells (cPBMCs) to 20 nm citrate-AgNPs (C-AgNP20) by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Methods Blood samples were collected from six captive common bottlenose dolphins (Tursiops truncatus). The cPBMCs were isolated and utilized for evaluating the in vitro cytokine responses. The cytokines evaluated included IL-2, IL-4, IL-10, IL-12, interferon (IFN)-γ, and tumor necrosis factor (TNF)-α. The geometric means of two housekeeping genes (HKGs), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β2-microglobulin (B2M), of each sample were determined and used to normalize the mRNA expression levels of target genes. Results The ratio of late apoptotic/necrotic cells of cPBMCs significantly increased with or without concanavalin A (ConA) stimulation after 24 h of 10 µg/ml C-AgNP20 treatment. At 4 h of culture, the mRNA expression level of IL-10 was significantly decreased with 1 µg/ml C-AgNP20 treatment. At 24 h of culture with 1 µg/ml C-AgNP20, the mRNA expression levels of all cytokines were significantly decreased, with the exceptions of IL-4 and IL-10. The IFN-γ/IL-4 ratio was significantly decreased at 24 h of culture with 1 µg/ml C-AgNP20 treatment, and the IL-12/IL-4 ratio was significantly decreased at 4 or 24 h of culture with 0.1 or 1 µg/ml C-AgNP20 treatment, respectively. Furthermore, the mRNA expression level of TNF-α was significantly decreased by 1 µg/ml C-AgNP20 after 24 h of culture. Discussion The present study demonstrated that the sublethal dose of C-AgNP20 (≤1 µg/ml) had an inhibitory effect on the cytokine mRNA expression levels of cPBMCs with the evidence of Th2 cytokine bias and significantly decreased the mRNA expression level of TNF-α. Th2 cytokine bias is associated with enhanced immunity against parasites but decreased immunity to intracellular microorganisms. TNF-α is a contributing factor for the inflammatory response against the infection of intracellular pathogens. In summary, our data indicate that C-AgNP20 suppresses the cellular immune response and thereby increases the susceptibility of cetaceans to infection by intracellular microorganisms.

An Integrated Analysis of The Prognosis And Immune Cell Infiltration of ITGB Superfamily Members In Gastric Cancer

2021 ◽  
Author(s):  
Chuan-hong Li ◽  
Lei Meng ◽  
Zhang-ming Chen ◽  
Wan-nian Sui ◽  
Pei-feng Chen ◽  
...  
Keyword(s):  
Gastric Cancer ◽  
T Cells ◽  
Cell Adhesion ◽  
Mrna Expression ◽  
Cell Lines ◽  
Survival Data ◽  
Expression Patterns ◽  
Expression Level ◽  
Integrated Analysis ◽  
Expression Levels

Abstract Background:Members of the integrin β superfamily(ITGBs) have been shown to be aberrantly expressed in various human cancers and involved in tumorigenesis and progression. However, the diverse expression patterns and prognostic values of the entire ITGB family members in gastric cancer(GC) has not been systematically investigated.Methods:In the current study, Oncomine, GEPIA, Kaplan Meier plotter, TIMER, GeneMANIA, STRING and Metascape database were employed to explore the transcriptional and survival data of ITGB superfamily members in GC. Moreover, we confirmed the mRNA expression levels of ITGB superfamily members in GC cell lines by qRT-PCR.Results:The mRNA expression level of ITGB1/2/4/5/8 was upregulated in GC, while the expression level of ITGB7 was downregulated. Higher expression of ITGB2/7 was significantly associated with the tumor stage of patients with GC. However, we found that the expression level of ITGB1/2/4/5/6/7/8 was remarkably increased in GC cell lines compared to stomach normal cell lines, while ITGB3 expression was decreased in the former than in the latter. Meanwhile,higher expression levels of ITGB2/6/7 were closely correlated with better overall clinical survival (OS) and recurrence-free survival (RFS) in GC patients, while higher ITGB3/4/5 expression were strongly associated with poorer OS and RFS.We also discovered that the functions of ITGBs and their adjacent genes are mainly related to protein complexes involved in cell adhesion. the functions of ITGBs and their adjacent proteins are mainly related to focal adhesion, cell adhesion molecules, proteoglycans in cancer, small cell lung cancer, rap1 signaling pathway, IgA production by intestinal immune network, and microRNAs in cancer.In addition, the expression of ITGBs was significantly correlated with the infiltration of multiple immune cells, including B cells, CD8+ T cells, CD4+ T cells, neutrophils, macrophages, and dendritic cells.Conclusions:Our results suggested that abnormal expression of ITGBs plays a key role in the progression of GC and that ITGBs may be potential prognostic biomarkers and therapeutic targets for GC.

scholarly journals Relationship between the mRNA expression levels of calpains 1/2 and proteins involved in cytoskeleton remodeling

Acta Naturae ◽  
2020 ◽  
Vol 12 (1) ◽  
pp. 110-113
Author(s):  
Gelena V. Kakurina ◽  
Elena S. Kolegova ◽  
Elena E. Shashova ◽  
Olga V. Cheremisina ◽  
Evgeniy L. Choynzonov ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Cancer Progression ◽  
Expression Level ◽  
Actin Binding ◽  
Published Data ◽  
Cytoskeletal Reorganization ◽  
Expression Levels ◽  
Cytoskeleton Remodeling ◽  
The Relationship ◽  
Mrna Expression Levels

Remodeling of the cytoskeleton underlies various cellular processes, including those associated with metastasis. The role of the proteases and proteins involved in cytoskeletal reorganization is being actively studied. However, there are no published data on the relationship between the mRNA expression levels of calpains 1/2 (CAPN 1/2) and the proteins associated with cytoskeleton remodeling. Therefore, the purpose of our study was to establish the relationship between the mRNA expression levels of CAPN 1/2 and the proteins involved in cytoskeletal reorganization, such as cell motility markers (SNAI1, VIM, and RND3) and actin-binding proteins (CFN1, PFN1, EZR, FSCN1, and CAP1) using the model of laryngeal/laryngopharyngeal squamous cell carcinoma (LC). The gene expression level was determined by reverse transcriptase real-time PCR and calculated using the 2-Ct method in paired tissue samples of 44 patients with LC (T1-4N0-2M0). The patients were divided into two groups: those with low and those with high CAPN 1/2 expression levels. It was found that metastasis in LC patients was associated with decreased expression levels of VIM and CAP1, and increased levels of CAPN1. A high level of CAPN2 was accompanied by a high expression level of EZR, indicating the activation of invasion processes. The results obtained need to be confirmed in further studies using a larger sample of patients and target genes. Our study is important in elucidating the mechanisms that underlie cancer progression and metastasis, a development that could subsequently open the way to a search for new prognostic and predictive markers of laryngeal/laryngopharyngeal cancer progression.

scholarly journals The Variants at APOA1 and APOA4 Contribute to the Susceptibility of Schizophrenia With Inhibiting mRNA Expression in Peripheral Blood Leukocytes

2021 ◽  
Vol 8 ◽  
Author(s):  
Yao Fan ◽  
Jun Gao ◽  
Yinghui Li ◽  
Xuefei Chen ◽  
Ting Zhang ◽  
...  
Keyword(s):  
Mrna Expression ◽  
Peripheral Blood ◽  
Apolipoprotein A1 ◽  
Expression Level ◽  
Transcript Variant ◽  
Antipsychotic Treatment ◽  
Peripheral Blood Leukocytes ◽  
Blood Leukocytes ◽  
Close Link ◽  
Expression Levels

Objective: Abnormal lipid metabolism has a close link to the pathophysiology of schizophrenia (SZ). This study mainly aimed to evaluate the association of variants at apolipoprotein A1 (APOA1) and APOA4 with SZ in a Chinese Han population.Methods: The rs5072 of APOA1 and rs1268354 of APOA4 were examined in a case–control study involving 2,680 patients with SZ from the hospital and 2,223 healthy controls screened by physical examination from the community population. The association was estimated with the odds ratio (OR) and 95% confidence intervals (95% CIs) by logistic regression. The APOA1 and APOA4 messenger RNA (mRNA) in peripheral blood leukocytes were measured by real-time PCR and compared between SZ cases and controls. Serum apoA1 levels were detected by turbidimetric inhibition immunoassay and high-density lipoprotein cholesterol (HDL-C) levels were detected by the homogeneous method.Results: Both of the rs5072 of APOA1 and rs1268354 of APOA4 had statistically significant associations with SZ. After adjustment for age and sex, ORs (95% CIs) of the additive model of rs5072 and rs1268354 were 0.82 (0.75–0.90) and 1.120 (1.03–1.23), and p-values were 3.22 × 10−5 and 0.011, respectively. The association of rs5072 with SZ still presented statistical significance even after Bonferroni correction (p-value×6). SZ patients during the episode presented lower levels of apoA1, HDL-C, mRNA of APOA1 common variants and transcript variant 4, and APOA4 mRNA than controls (p &lt; 0.01) while SZ patients in remission showed a significantly decreased APOA1 transcript variant 3 expression level and increased APOA4 mRNA expression level (p &lt; 0.01). mRNA expression levels of APOA1 transcript variant 4 significantly increased with the variations of rs5072 in SZ during the episode (ptrend = 0.017). After the SZ patients received an average of 27.50 ± 9.90 days of antipsychotic treatment, the median (interquartile) of serum apoA1 in the SZ episode significantly increased from 1.03 (1.00.1.20) g/L to 1.08 (1.00.1.22) g/L with the p-value of 0.044.Conclusion: Our findings suggest that the genetic variations of APOA1 rs5072 and APOA4 rs1268354 contribute to the susceptibility of SZ, and the expression levels of APOA1 and APOA4 mRNA of peripheral blood leukocytes decreased in SZ patients during the episode while APOA4 increased after antipsychotic treatment.

XXYLT1 Methylation Contributes to the Occurrence of Lung Adenocarcinoma

2020 ◽  
Author(s):  
Hui Zeng ◽  
ying wang ◽  
ying wang ◽  
yongjun zhang
Keyword(s):  
Dna Methylation ◽  
Lung Adenocarcinoma ◽  
Mrna Expression ◽  
Methylation Status ◽  
Additional Research ◽  
Expression Level ◽  
Methylation Data ◽  
Expression Levels ◽  
Male Patients ◽  
Cancer Tissues

Abstract Objective: This study aimed to observe the methylation levels and mRNA expression of XXYLT1 and to further analyze their possible correlation with the risk of lung adenocarcinoma. Methods: Thirty patients with lung adenocarcinoma (fifteen men and fifteen women) were recruited in this study. Cancer tissues and para-carcinoma tissues were obtained from each of the patients. The expression levels of XXYLT1 mRNA were determined, and the DNA methylation status was analyzed by MassARRAY Spectrometry. The methylation data of individual units were generated by EpiTyper v1.0.5 software. Results: Among the male patients, the expression level of XXYLT1 mRNA was significantly higher in the para-carcinoma tissues compared to the cancer tissues. Meanwhile, among the male patients, the methylation rates of three CpG units (CpG_23, CpG_25, and CpG_60.61.62.63.64.65) within the XXYLT1 gene were lower in the para-carcinoma tissues compared to the cancer tissues.Conclusions: Our results show that XXYLT1 mRNA was down-regulated and methylation rates were increased in lung adenocarcinoma tissues than in para-carcinoma tissues. These suggested that methylation of XXYLT1 may have significance in the pathogenesis of lung adenocarcinoma. Additional research is required to elucidate this aspect.

Sign in / Sign up

Export Citation Format

Share Document