Abstract
Abstract 982
Poster Board I-4
Recently,Mulligan et al have reported on the strong relationship between deletion of IKZF1 and poor prognosis in pediatric acute lymphocytic leukemia (ALL) (NEJM 2009;360:470-80). This study is of significant importance as it may allow for the identification of children with poor prognosis disease not currently identifiable with standard clinical or molecular assays. Aberrant DNA methylation consists on the addition of a methyl group to a cytsosine (C) when it is followed by a guanine (G) in so-called CpG sites. Methylation of CpG rich areas (CpG islands) in the proximity of gene promoters is associated with gene silencing and is considered a functional equivalent to the physical inactivation of genes via deletions or inactivating mutations. Aberrant DNA methylation is very frequent in both adult and pediatric ALL. Indeed, CDKN2A and 2B, two genes known to be frequently methylated in ALL were also found to be deleted in Mullighan's study. Furthermore, CDKN2A has been shown to be both methylated and deleted in patients with hematological malignancies5. Therefore it is possible that aberrant methylation of IKZF1 could provide a functional alternative to its deletion in both adult and pediatric ALL. To study this issue, we analyzed the frequency of IKZF1 methylation in ALL. First using BLAT database (http://genome.brc.mcw.edu/cgi-bin/hgBlat), we established that IKZF1 contains a CpG island in the proximity of its promoter. Subsequently, we designed a set of primers for bisulfite pyrosequencing analysis of IKZF1 methylation (forward primer sequence was GTTATTGTGAAAGAAAGTTGGGAAGAG in positions -116 to -89 from the transcription start site; reverse primer was CCTCCCCCCCAAACTAAAATAC in position +29 to +7 from the start site; and the sequencing primer was AGTTAGTAGGATATTTTAATAAGTG from -78 to -53). Annealing temperature was 59 °C. Conditions for bisulfite conversion of DNA and pyrosequencing have been previously reported. Using these conditions and primers, we first analyzed a battery of 21 leukemia cell lines (Molt4, Jurkat, PEER, T-ALL1, CEM, J-TAG, B-JAB, RS4, ALL1, REH, Raji, Ramos, K562, BV173, HL60, NB4, THP1, U937, OCI-AML3, HEL, KBM5R) of different origins. As negative controls, we used DNA extracted from peripheral blood mononuclear cells from healthy donors and as positive controls SssI treated DNA. None of the cell lines or controls had evidence of DNA methylation of IKZF1 (median 1.53%, range 0.94 to 1.76). By convention, a sample is considered to be methylated if the percent of methylation is above 10 to 15%. Despite the fact that it is extremely unlikely to find DNA methylation in absence of evidence of methylation in cell lines, we decided to analyze the methylation status of IKZF1 in two different cohorts of patients with ALL. The first cohort consisted of a group of pediatric patients (N=20) previously reported by us (Leuk Res 2005;29:881-5). Median methylation was 2.8% (range 1.5 to 11.4). The second cohort of consisted of 17 patients. Median age was 33 years (range 8 to 66); 12 patients (70%) had pre-B/B phenotype, 4 (23%) were female and 14 (82%) had complex cytogenetics. Median methylation was 1.3%, range 0.38 to 2.3%. Our data indicates that functional inactivation of IKZF1 via aberrant DNA methylation is probably a very rare phenomenon in ALL. This data has implications for our understanding of the prognostic role of IZFZ1 in ALL and for future testing of IKZF1 inactivation in this disease.
Disclosures:
No relevant conflicts of interest to declare.
Aberrant DNA methylation of the Src kinase Hck, but not of Lyn, in Philadelphia chromosome negative acute lymphocytic leukemia
