Phthalate catabolic gene cluster is linked to the angular dioxygenase gene in Terrabacter sp. strain DBF63

2003 ◽  
Vol 61 (1) ◽  
pp. 44-54 ◽  
Author(s):  
H. Habe ◽  
M. Miyakoshi ◽  
J. Chung ◽  
K. Kasuga ◽  
T. Yoshida ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Catabolic Gene ◽  
Dioxygenase Gene ◽  
Angular Dioxygenase

scholarly journals A Novel Angular Dioxygenase Gene Cluster Encoding 3-Phenoxybenzoate 1′,2′-Dioxygenase in Sphingobium wenxiniae JZ-1

2014 ◽  
Vol 80 (13) ◽  
pp. 3811-3818 ◽  
Author(s):  
Chenghong Wang ◽  
Qing Chen ◽  
Rui Wang ◽  
Chao Shi ◽  
Xin Yan ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Heme Iron ◽  
Transcriptional Level ◽  
Content Type ◽  
Type Iv ◽  
Reductase Gene ◽  
Wide Range ◽  
Dioxygenase Gene ◽  
Sphingomonas Wittichii ◽  
Angular Dioxygenase

ABSTRACTSphingobium wenxiniaeJZ-1 utilizes a wide range of pyrethroids and their metabolic product, 3-phenoxybenzoate, as sources of carbon and energy. A mutant JZ-1 strain, MJZ-1, defective in the degradation of 3-phenoxybenzoate was obtained by successive streaking on LB agar. Comparison of the draft genomes of strains JZ-1 and MJZ-1 revealed that a 29,366-bp DNA fragment containing a putative angular dioxygenase gene cluster (pbaA1A2B) is missing in strain MJZ-1. PbaA1, PbaA2, and PbaB share 65%, 52%, and 10% identity with the corresponding α and β subunits and the ferredoxin component of dioxin dioxygenase fromSphingomonas wittichiiRW1, respectively. Complementation ofpbaA1A2Bin strain MJZ-1 resulted in the active 3-phenoxybenzoate 1′,2′-dioxygenase, but the enzyme activity inEscherichia coliwas achieved only through the coexpression ofpbaA1A2Band a glutathione reductase (GR)-type reductase gene,pbaC, indicating that the 3-phenoxybenzoate 1′,2′-dioxygenase belongs to a type IV Rieske non-heme iron aromatic ring-hydroxylating oxygenase system consisting of a hetero-oligomeric oxygenase, a [2Fe-2S]-type ferredoxin, and a GR-type reductase. ThepbaCgene is not located in the immediate vicinity ofpbaA1A2B. 3-Phenoxybenzoate 1′,2′-dioxygenase catalyzes the hydroxylation in the 1′ and 2′ positions of the benzene moiety of 3-phenoxybenzoate, yielding 3-hydroxybenzoate and catechol. Transcription ofpbaA1A2BandpbaCwas induced by 3-phenoxybenzoate, but the transcriptional level ofpbaCwas far less than that ofpbaA1A2B, implying the possibility that PbaC may not be the only reductase that can physiologically transfer electrons to PbaA1A2B in strain JZ-1. Some GR-type reductases from other sphingomonad strains could also transfer electrons to PbaA1A2B, suggesting that PbaA1A2B has a low specificity for reductase.

Characterization of a protocatechuate catabolic gene cluster in Rhodococcus ruber OA1 involved in naphthalene degradation

2015 ◽  
Vol 66 (1) ◽  
pp. 469-478 ◽  
Author(s):  
Chao Li ◽  
Chunyang Zhang ◽  
Guanling Song ◽  
Hong Liu ◽  
Guihua Sheng ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Rhodococcus Ruber ◽  
Catabolic Gene ◽  
Naphthalene Degradation

scholarly journals Gentisate 1,2-dioxygenase, in the third naphthalene catabolic gene cluster of Polaromonas naphthalenivorans CJ2, has a role in naphthalene degradation

Microbiology ◽  
2011 ◽  
Vol 157 (10) ◽  
pp. 2891-2903 ◽  
Author(s):  
Hyo Jung Lee ◽  
Jeong Myeong Kim ◽  
Se Hee Lee ◽  
Minjeong Park ◽  
Kangseok Lee ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Transcriptional Analysis ◽  
Catabolic Gene ◽  
Wild Type ◽  
High Sequence Identity ◽  
The Third ◽  
Naphthalene Degradation ◽  
Knockout Mutants ◽  
Gentisate Pathway ◽  
High Level

Polaromonas naphthalenivorans strain CJ2 metabolizes naphthalene via the gentisate pathway and has recently been shown to carry a third copy of gentisate 1,2-dioxygenase (GDO), encoded by nagI3, within a previously uncharacterized naphthalene catabolic gene cluster. The role of this cluster (especially nagI3) in naphthalene metabolism of strain CJ2 was investigated by documenting patterns in regulation, transcription and enzyme activity. Transcriptional analysis of wild-type cells showed the third cluster to be polycistronic and that nagI3 was expressed at a relatively high level. Individual knockout mutants of all three nagI genes were constructed and their influence on both GDO activity and cell growth was evaluated. Of the three knockout strains, CJ2ΔnagI3 showed severely diminished GDO activity and grew slowest on aromatic substrates. These observations are consistent with the hypothesis that nagI3 may prevent toxic intracellular levels of gentisate from accumulating in CJ2 cells. All three nagI genes from strain CJ2 were cloned into Escherichia coli: the nagI2 and nagI3 genes were successfully overexpressed. The subunit mass of the GDOs were ~36–39 kDa, and their structures were deduced to be dimeric. The K m values of NagI2 and NagI3 were 31 and 10 µM, respectively, indicating that the higher affinity of NagI3 for gentisate may protect the wild-type cells from gentisate toxicity. These results provide clues for explaining why the third gene cluster, particularly the nagI3 gene, is important in strain CJ2. The organization of genes in the third gene cluster matched that of clusters in Polaromonas sp. JS666 and Leptothrix cholodnii SP-6. While horizontal gene transfer (HGT) is one hypothesis for explaining this genetic motif, gene duplication within the ancestral lineage is equally valid. The HGT hypothesis was discounted by noting that the nagI3 allele of strain CJ2 did not share high sequence identity with its homologues in Polaromonas sp. JS666 and L. cholodnii SP-6.

scholarly journals PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

2015 ◽  
Vol 81 (23) ◽  
pp. 8084-8092 ◽  
Author(s):  
Minggen Cheng ◽  
Kai Chen ◽  
Suhui Guo ◽  
Xing Huang ◽  
Jian He ◽  
...  
Keyword(s):  
Binding Site ◽  
Gene Cluster ◽  
Transcriptional Start Site ◽  
Transcriptional Activator ◽  
Transcriptional Regulators ◽  
Mobility Shift ◽  
Content Type ◽  
Dnase I Footprinting ◽  
Dioxygenase Gene ◽  
Mobility Shift Assay

ABSTRACTThe 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2Bcluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed inSphingobium wenxiniaestrain JZ-1Tby its substrate 3-PBA. In this study, we identified a transcriptional activator of thepbaA1A2Bcluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 inSphingomonassp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of thepbaA1A2Bcluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component genepbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in thepbaA1A2Bpromoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators.

A catabolic gene cluster for anaerobic benzoate degradation in methanotrophic microbial Black Sea mats

2005 ◽  
Vol 28 (4) ◽  
pp. 287-294 ◽  
Author(s):  
Michael Kube ◽  
Alfred Beck ◽  
Anke Meyerdierks ◽  
Rudolf Amann ◽  
Richard Reinhardt ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Black Sea ◽  
Catabolic Gene ◽  
Benzoate Degradation

scholarly journals Cloning and Functional Analysis of Aniline Dioxygenase Gene Cluster, fromFrateuriaSpecies ANA-18, That Metabolizes Anilineviaanortho-Cleavage Pathway of Catechol

2003 ◽  
Vol 67 (11) ◽  
pp. 2351-2358 ◽  
Author(s):  
Shuichiro MURAKAMI ◽  
Teruhiko HAYASHI ◽  
Tetsuya MAEDA ◽  
Shinji TAKENAKA ◽  
Kenji AOKI
Keyword(s):  
Functional Analysis ◽  
Gene Cluster ◽  
Dioxygenase Gene

scholarly journals Autoregulation of hpdR and its effect on CDA biosynthesis in Streptomyces coelicolor

Microbiology ◽  
2010 ◽  
Vol 156 (9) ◽  
pp. 2641-2648 ◽  
Author(s):  
Haihua Yang ◽  
Yang An ◽  
Linqi Wang ◽  
Shuli Zhang ◽  
Yue Zhang ◽  
...  
Keyword(s):  
Gene Cluster ◽  
Promoter Region ◽  
Streptomyces Coelicolor ◽  
Binding Activity ◽  
Catabolic Gene ◽  
Mobility Shift ◽  
S1 Nuclease ◽  
Dna Binding Activity ◽  
Electrophoretic Mobility Shift Assays ◽  
Positive Effect

HpdR, an IclR-family regulator in Streptomyces coelicolor, is a substrate-dependent repressor for the tyrosine catabolic gene hppD. In this study, S1 nuclease protection assays revealed that hpdR is subject to a negative autoregulation. Purified HpdR showed specific DNA-binding activity for the promoter region of hpdR, indicating that the autoregulation of hpdR is performed directly. The disruption of hpdR led to reduced production of CDA by S. coelicolor J1501, suggesting a positive effect of hpdR on CDA biosynthesis. Electrophoretic mobility shift assays showed that HpdR specifically bound to the promoter region of hmaS (SCO3229 in the CDA gene cluster), encoding 4-hydroxymandelic acid synthase. Disruption of hmaS in J1501 abolished CDA production. It is possible that hpdR regulates CDA biosynthesis by controlling the transcription of hmaS.

scholarly journals Plasmid-Borne Genes Code for an Angular Dioxygenase Involved in Dibenzofuran Degradation by Terrabacter sp. Strain YK3

2002 ◽  
Vol 68 (8) ◽  
pp. 3716-3723 ◽  
Author(s):  
Toshiya Iida ◽  
Yuki Mukouzaka ◽  
Kaoru Nakamura ◽  
Toshiaki Kudo
Keyword(s):  
Blot Hybridization ◽  
Southern Blot Hybridization ◽  
Pcr Primers ◽  
Alpha Subunit ◽  
Beta Subunits ◽  
The Novel ◽  
Southern Blot Hybridization Analysis ◽  
Angular Dioxygenation ◽  
Dioxygenase Gene ◽  
Angular Dioxygenase

ABSTRACT The genes responsible for angular dioxygenation of dibenzofuran in actinomycetes were cloned by using a degenerate set of PCR primers designed by using conserved sequences of the dioxygenase alpha subunit genes. One sequence of alpha subunit genes was commonly amplified from four dibenzofuran-utilizing actinomycetes: Terrabacter sp. strains YK1 and YK3, Rhodococcus sp. strain YK2, and Microbacterium sp. strain YK18. A 5.2-kb PstI fragment encoding the alpha and beta subunits of the terminal dioxygenase, ferredoxin, and ferredoxin reductase (designated dfdA1 to dfdA4, respectively) was cloned from the large circular plasmid pYK3 isolated from Terrabacter sp. strain YK3. We confirmed that transcription of the dfdA1 gene was induced by dibenzofuran in Terrabacter sp. strain YK3. Southern blot hybridization analysis revealed that this type of dioxygenase gene is distributed among diverse dibenzofuran-utilizing actinomycetes. However, genes homologous to dfdA1 were not detected in dibenzofuran utilization-deficient mutants of Terrabacter, Rhodococcus, and Microbacterium species. When the dfdA1 to dfdA4 genes were introduced into a non-dibenzofuran-degrading mutant of Rhodococcus sp. strain YK2, strain YK2-RD2, which had spontaneously lost the gene homologous to dfdA1, the ability to degrade dibenzofuran was restored. Analysis of the breakdown products indicated that DfdA has angular dioxygenase activity. This dfdA transformant degraded several aromatic compounds, indicating that the novel angular dioxygenase possesses broad substrate specificity.

Sign in / Sign up

Export Citation Format

Share Document