Fish: Hearing, Lateral Lines (Mechanisms, Role in Behavior, Adaptations to Life Underwater)

Abstract Bursaphelenchus chengi sp. n. is described and illustrated. Dauer juveniles were isolated from imported wood packaging materials from Taiwan to Nanjing Port, China. Bursaphelenchus chengi sp. n. was reared and maintained on Petri dish cultures of the fungus Botrytis cinerea. The new species is characterised by the medium body size in both sexes, the presence of only two incisures in the lateral field and the robust and strongly curved spicules. The spicule lamina is angular distally, the rostrum digitate and the condylus rounded. The tail is arcuate with a pointed terminus. The bursa is usually truncate with the posterior margin indented in some specimens or rounded with a fine axial point. Females have a small vulval flap formed by a short extension of the cuticle of the anterior lip, and a conical tail that gradually tapers to an almost straight or slightly recurved, pointed or rounded terminus. Because of the presence of two lateral lines, similar spicule shape, tapering female tail and the presence of a small vulval flap, B. chengi sp. n. should be grouped in the abietinus-group sensu Braasch. together with B. abietinus, B. antoniae, B. hellenicus, B. hylobianum and B. rainulfi. ITS-RFLP profiles support the proposal of the new species, and phylogenetic analysis of the 28S rDNA D2/D3 domain sequence places it close to B. antoniae and other species of the abietinus-group.

Download Full-text

ПОБУДОВА МАТЕМАТИЧНОЇ МОДЕЛІ СКЛАДНОГО РУХУ ФЛАКОНІВ НА ЛІНІЯХ РОЗЛИВУ ЛІКІВ ФАРМАЦЕВТИЧНОЇ ПРОМИСЛОВОСТІ

Medical Informatics and Engineering ◽

10.11603/mie.1996-1960.2010.4.146 ◽

2012 ◽

Author(s):

N. О. Kravets

Keyword(s):

Mathematical Model ◽

Experimental Evaluation ◽

Theoretical Dependence ◽

Complex Product ◽

Lateral Lines ◽

Calculation Results ◽

The Mathematical Model

The mathematical model of the complex product motion along the lateral lines at the plate conveyers of the bottle lines is presented in the artcle. The experimental evaluation of the gained theoretical dependence is suggested. The calculation results coordinate well with the modelling and experiment resuls.

Download Full-text

Theoretical basis and significance of the variance of discharge as a bidimensional variable for the design of lateral lines of micro-irrigation

Scientia Agricola ◽

10.1590/s0103-90162009000400021 ◽

2009 ◽

Vol 66 (4) ◽

pp. 563-569

Author(s):

Euro Roberto Detomini ◽

Brendan Power ◽

José Antônio Frizzone

Keyword(s):

Independent Random Variable ◽

Theoretical Basis ◽

Systems Design ◽

Statistical Design ◽

Random Variable ◽

Point Of View ◽

Soil Slope ◽

Irrigation Systems ◽

Lateral Lines ◽

Micro Irrigation

In order to support the theoretical basis and contribute to the improvement of educational capability issues relating to irrigation systems design, this point of view presents an alternative deduction of the variance of the discharge as a bidimensional and independent random variable. Then a subsequent brief application of an existing model is applied for statistical design of laterals in micro-irrigation. The better manufacturing precision of emitters allows lengthening a lateral for a given soil slope, although this does not necessarily mean that the statistical uniformity throughout the lateral will be more homogenous.

Download Full-text

First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽

10.1094/pdis-02-14-0119-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1019-1019 ◽

Cited By ~ 2

Author(s):

Y. F. Wang ◽

S. Xiao ◽

Y. K. Huang ◽

X. Zhou ◽

S. S. Zhang ◽

...

Keyword(s):

Morphological Characteristics ◽

Severe Infection ◽

Original Description ◽

First Record ◽

Vegetable Crops ◽

Species Identity ◽

Fujian Province ◽

First Report ◽

Lateral Lines ◽

Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

ANÁLISE DA DISTRIBUIÇÃO DA CARGA HIDRÁULICA E VAZÃO NA UNIDADE OPERACIONAL DE UM SISTEMA DE IRRIGAÇÃO LOCALIZADA

Irriga ◽

10.15809/irriga.2007v12n4p481-491 ◽

2007 ◽

Vol 12 (4) ◽

pp. 481-491

Author(s):

Francisco F. N. Marcussi ◽

João Carlos Cury Saad ◽

Saulo A. de Souza ◽

Carlos E. A. G. Barreto

Keyword(s):

Operational Research ◽

Irrigation System ◽

Hydraulic Head ◽

System Management ◽

Lateral Lines ◽

System 2 ◽

Head Pressure ◽

Lower Discharge ◽

Discharge Distribution ◽

Operational Unit

ANÁLISE DA DISTRIBUIÇÃO DA CARGA HIDRÁULICA E VAZÃO NA UNIDADE OPERACIONAL DE UM SISTEMA DE IRRIGAÇÃO LOCALIZADA Francisco F. N. Marcussi1; João C. C. Saad2; Saulo A. de Souza1; Carlos E. A. G. Barreto11Escola de Engenharia de São Carlos, Universidade de São Paulo, São Carlos, SP, [email protected] de Engenharia Rural, Faculdade de Ciências Agronômicas, Universidade Estadual Paulista, Botucatu, SP 1 RESUMO As diferentes possibilidades de combinações de uniformidade de emissão na unidade operacional, de um sistema de irrigação localizada, com a declividade do terreno, favorecem a ocorrência de várias configurações no sistema de irrigação, por consecutivo de diferentes distribuições de carga hidráulica, vazão e de manejo do sistema. Atenta-se para o problema do dimensionamento do sistema, nesse sentido, da verificação da distribuição de pressão e vazão, na unidade operacional, após o mesmo ser implantado. Este trabalho teve por objetivo verificar a uniformidade de pressão e vazão na linha de derivação e nas linhas laterais com microaspersores, em dados obtidos por pesquisa operacional. Os resultados permitem averiguar que independente da declividade analisada, quanto maior é a uniformidade de emissão calculada para a linha de derivação no projeto, maior é sua uniformidade de pressão. Já os resultados de vazão nos emissores da unidade operacional, embora diferentes frente às três lâminas de irrigação testadas, mostram uma variação constante entre o ponto de maior vazão e o de menor vazão. UNITERMOS: irrigação, pressão e uniformidade de emissão. MARCUSSI, F.F.N.; SAAD, J.C.C.; SOUZA, S.A.; BARRETO, C.E.A.G. ANALYSIS OF LOAD HYDRAULIC UNIFORMITY AND DISCHARGE IN THE OPERATIONAL UNIT OF AN IRRIGATION SYSTEM 2 ABSTRACT The different combination possibilities of emission uniformity and field slope within the operational unities of localized irrigation systems favor the occurrence of some configurations in the irrigation system, and consequently different hydraulic head distributions, discharge and system management. After the system has been implanted, it is necessary to verify pressure and discharge distribution in the operational unit. This work objective was to verify pressure and discharge uniformity on derivation line and lateral lines with micro sprinkle in data gotten from operational research. The results allow to check that despite analyzed declivity; the higher the emission uniformity calculated for the line of derivation in the project is, the higher its pressure uniformity is. Previously the results of discharge in the emitters of the operational unit showed a constant variation entering the point of higher discharge and lower discharge , even though differently from the three tested irrigation blades.KEYWORDS: Irrigation, hydraulic head, pressure uniformity.

Download Full-text

Predator avoidance ability of juvenile chinook salmon (Oncorhynchus tshawytscha) subjected to sublethal exposures of gas-supersaturated water

Canadian Journal of Fisheries and Aquatic Sciences ◽

10.1139/f96-326 ◽

1997 ◽

Vol 54 (4) ◽

pp. 757-764 ◽

Cited By ~ 5

Author(s):

M G Mesa ◽

J J Warren

Keyword(s):

Chinook Salmon ◽

Predator Avoidance ◽

Oncorhynchus Tshawytscha ◽

Control Fish ◽

Dissolved Gas ◽

Juvenile Chinook Salmon ◽

Unexposed Control ◽

Lateral Lines ◽

Gill Filaments ◽

Juvenile Chinook

To assess the effects of gas bubble trauma (GBT) on the predator avoidance ability of juvenile chinook salmon (Oncorhynchus tshawytscha), we created groups of fish that differed in prevalence and severity of gas emboli in their lateral lines, fins, and gills by exposing them to 112% total dissolved gas (TDG) for 13 days, 120% TDG for 8 h, or 130% TDG for 3.5 h. We subjected exposed and unexposed control fish simultaneously to predation by northern squawfish (Ptychocheilus oregonensis) in water of normal gas saturation in 6, 18, and 10 tests using prey exposed to 112, 120, and 130% TDG, respectively. Only fish exposed to 130% TDG showed a significant increase in vulnerability to predation. The signs of GBT exhibited by fish sampled just prior to predator exposure were generally more severe in fish exposed to 130% TDG, which had the most extensive occlusion of the lateral line and gill filaments with gas emboli. Fish exposed to 112% TDG had the most severe signs of GBT in the fins. Our results suggest that fish showing GBT signs similar to those of our fish exposed to 130% TDG, regardless of their precise exposure history, may be more vulnerable to predation.

Download Full-text

Three-dimensional multi-source localization of underwater objects using convolutional neural networks for artificial lateral lines

Journal of The Royal Society Interface ◽

10.1098/rsif.2019.0616 ◽

2020 ◽

Vol 17 (162) ◽

pp. 20190616 ◽

Cited By ~ 2

Author(s):

Ben J. Wolf ◽

Jos van de Wolfshaar ◽

Sietse M. van Netten

Keyword(s):

Neural Network ◽

Source Localization ◽

Fluid Velocity ◽

Three Dimensional ◽

Sensory System ◽

Three Dimensions ◽

Hydrodynamic Theory ◽

Multiple Sources ◽

Combined System ◽

Lateral Lines

This research focuses on the signal processing required for a sensory system that can simultaneously localize multiple moving underwater objects in a three-dimensional (3D) volume by simulating the hydrodynamic flow caused by these objects. We propose a method for localization in a simulated setting based on an established hydrodynamic theory founded in fish lateral line organ research. Fish neurally concatenate the information of multiple sensors to localize sources. Similarly, we use the sampled fluid velocity via two parallel lateral lines to perform source localization in three dimensions in two steps. Using a convolutional neural network, we first estimate a two-dimensional image of the probability of a present source. Then we determine the position of each source, via an automated iterative 3D-aware algorithm. We study various neural network architectural designs and different ways of presenting the input to the neural network; multi-level amplified inputs and merged convolutional streams are shown to improve the imaging performance. Results show that the combined system can exhibit adequate 3D localization of multiple sources.

Download Full-text