scholarly journals Key factors to inoculate Botrytis cinerea in tomato plants

2014 ◽  
Vol 40 (3) ◽  
pp. 221-225 ◽  
Author(s):  
Álefe Vitorino Borges ◽  
Rodrigo Moreira Saraiva ◽  
Luiz Antonio Maffia
Keyword(s):  
Biological Control ◽  
Botrytis Cinerea ◽  
Gray Mold ◽  
Lesion Length ◽  
Key Factors ◽  
Moist Chamber ◽  
Tomato Plants ◽  
Positive Correlation

Studies addressing the biological control of Botrytis cinerea have been unsuccessful because of fails in inoculating tomato plants with the pathogen. With the aim of establishing a methodology for inoculation into stems, experiments were designed to assess: i. the aggressiveness of pathogen isolates; ii. the age at which tomato plants should be inoculated; iii. the susceptibility of tissues at different stem heights; iv. the need for a moist chamber after inoculation; and v. the effectiveness of gelatin regarding inoculum adhesion. Infection with an isolate from tomato plants that was previously inoculated into petioles and then re-isolated was successful. An isolate from strawberry plants was also aggressive, although less than that from tomato plants. Tomato plants close to flowering, at 65 days after sowing, and younger, middle and apical stem portions were more susceptible. There was positive correlation between lesion length and sporulation and between lesion length and broken stems. Lesion length and the percentage of sporulation sites were reduced by using a moist chamber and were not affected by adding gelatin to the inoculum suspension. This methodology has been adopted in studies of B. cinerea in tomato plants showing reproducible results. The obtained results may assist researchers who study the gray mold.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals SELEÇÃO IN VITRO DE FUNGOS ENDOFÍTICOS PARA O CONTROLE BIOLÓGICO DE Botrytis cinerea EM Eucalyptus benthamii

FLORESTA ◽  
2013 ◽  
Vol 43 (1) ◽  
pp. 145 ◽  
Author(s):  
José Antonio Sbravatti Junior ◽  
Celso Garcia Auer ◽  
Ida Chapaval Pimentel ◽  
Álvaro Figueredo dos Santos ◽  
Bruno Schultz
Keyword(s):  
Biological Control ◽  
Botrytis Cinerea ◽  
Fungal Endophytes ◽  
Gray Mold ◽  
Penicillium Sp ◽  
Trichoderma Sp ◽  
Forest Nurseries ◽  
Aspergillus Sp ◽  
Foliar Pathogens

   O Eucalyptus benthamii é uma das principais espécies de eucalipto plantadas na região Sul do Brasil, por sua resistência a geadas e por seu uso na produção florestal de madeira para fins energéticos. Na produção de mudas, uma das principais doenças ocorrentes em viveiros é o mofo-cinzento, causado pelo fungo Botrytis cinerea. Uma das alternativas para o controle dessa doença é o controle biológico com fungos endofíticos, os quais podem competir com os patógenos foliares de mudas de eucalipto. O objetivo deste trabalho foi isolar os fungos endofíticos provenientes de mudas de E. benthamii, identificá-los e selecioná-los para o controle de B. cinerea. Eles foram isolados do interior de tecidos vegetais desinfectados, identificados de acordo com critérios macro e micromorfológicos e classificados a partir de testes de controle biológico in vitro. Os resultados evidenciaram o potencial antagonista dos fungos Aspergillus sp., Penicillium sp. e Trichoderma sp. Nenhum desses fungos causou lesões em mudas de E. benthamii.Palavras-chave: Mofo-cinzento; eucalipto; viveiro.AbstractIn vitro selection of endophytes for biological control of Botrytis cinerea in Eucalyptus benthamii. Eucalyptus benthamii is one of the main eucalypt species planted in Southern Brazil, due to its resistance to frost and its use in the production of forest wood for energy purposes. During the production of seedlings, the main disease occurring in forest nurseries is gray-mold caused by the fungus Botrytis cinerea. One alternative for control this disease is biological control with fungal endophytes, which can compete with the foliar pathogens of eucalypt seedlings. The objective of this study was to isolate endophytic fungi from seedlings of Eucalyptus benthamii, identify and select them for B. cinerea control. These were isolated from the interior of disinfected plant tissues, identified according to macro and micromorphological criteria, and based on tests of biological control in vitro. The results revealed the potential antagonist of Aspergillus sp., Penicillium sp. and Trichoderma sp. No fungi caused lesions in E. benthamii seedlings.Keywords: Gray-mold; eucalypt; nursery.    

scholarly journals Control of Gray Mold on Tomato plants by Spraying Piper nigrum and Urtica dioica Extracts under Greenhouse Condition

2019 ◽  
Vol 60 (5) ◽  
pp. 961-971
Author(s):  
Hamed N. Ghazal ◽  
Ayyad W Al-Shahwany ◽  
Firas T. Al–Dulaimy
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
Urtica Dioica ◽  
Nano Particles ◽  
Piper Nigrum ◽  
Total Phenolic ◽  
Total Phenolic Compounds ◽  
Greenhouse Condition ◽  
Tomato Plants ◽  
Inducing Resistance

Field experimented were examined the effects of Piper nigrum and Urtica dioica extracts on the gray mold disease in tomato that caused by Botrytis cinerea. To evaluate the inducing resistance of these extracts, many treatments were sprayed on tomato leaves, including methanolic and aquatic extracts, Silver nano particles biosynthesis (AgNPs) and water as (control). The results indicated that the resistance of tomato plants was increased when tomato plant sprayed first with Methanolic P. nigrum extracts and after 4 hours sprayed with B. cinerea. Also, spraying with methanolic and aquatic AgNPs P. nigrum extract were reduced gray mold disease. These results were showed that P. nigrum AgNPs treatment reduced the gray mold of tomato leaves because of the activities of total phenolic compounds which was infected with Botrytis cinerea.

Biological control of tomato gray mold caused by Botrytis cinerea by using Streptomyces spp.

BioControl ◽  
2017 ◽  
Vol 62 (6) ◽  
pp. 793-803 ◽  
Author(s):  
Sawai Boukaew ◽  
Poonsuk Prasertsan ◽  
Claire Troulet ◽  
Marc Bardin
Keyword(s):  
Biological Control ◽  
Botrytis Cinerea ◽  
Gray Mold ◽  
Streptomyces Spp

scholarly journals Postharvest Biological Control of Botrytis cinerea on Kiwifruit by Volatiles of [Isabella] Grapes

2004 ◽  
Vol 94 (12) ◽  
pp. 1280-1285 ◽  
Author(s):  
Eleni K. Kulakiotu ◽  
Constantine C. Thanassoulopoulos ◽  
Evangelos M. Sfakiotakis
Keyword(s):  
Biological Control ◽  
Botrytis Cinerea ◽  
Inhibitory Action ◽  
Developmental Stages ◽  
Gray Mold ◽  
Biological Action ◽  
Disease Development ◽  
Vitis Labrusca ◽  
In Vivo Experiments

The potential of volatile substances emitted by ‘Isabella’ grapes (Vitis labrusca) to control gray mold (Botrytis cinerea) on ‘Hayward’ kiwifruit (Actinidia deliciosa) was studied. The closed Mariotte system was used as a bioassay method to analyze quantitatively the biological action of these volatiles on B. cinerea growth. In vivo experiments compared the effects of volatiles from ‘Isabella’ grapes versus volatiles from ‘Roditis’ grapes (V. vinifera) and a B. cinerea control on the growth and disease development of B. cinerea on kiwifruit. The effect of the volatiles on the growth of B. cinerea was tested at various temperatures and times of inoculation after the wounding of kiwifruit, as well as using various weights and developmental stages of the grapes. The ‘Isabella’ volatiles limited the incidence of infection by reducing both the inoculum density and the activity of the pathogen. The weight and developmental stage of the grapes were important in the degree of inhibitory action of the ‘Isabella’ volatiles. The inhibitory action was more pronounced at 21°C irrespective of the inoculation time after wounding. The study shows the potential for successful biological control of B. cinerea on kiwifruit by volatiles from ‘Isabella’ grapes.

Biological control of stem canker of greenhouse tomatoes caused by Botrytis cinerea

2002 ◽  
Vol 48 (6) ◽  
pp. 550-554 ◽  
Author(s):  
R S Utkhede ◽  
S Mathur
Keyword(s):  
Biological Control ◽  
Botrytis Cinerea ◽  
Stem Canker ◽  
Fruit Yield ◽  
The Other ◽  
Post Inoculation ◽  
Tomato Plants ◽  
Grey Mold ◽  
Rhodosporidium Diobovatum ◽  
Greenhouse Tomatoes

Experiments were conducted to study the effect of various chemical and biological agents on stem canker caused by Botrytis cinerea Pers.: Fr. on tomato plants grown in sawdust under near-commercial greenhouse conditions. Lesion lengths following treatment with RootShield® and strain S33 of Rhodosporidium diobovatum Newell & Hunter, applied as post-inoculation sprays, were significantly smaller than those in inoculated controls. These treatments also increased fruit yield and decreased the number of dead plants compared with inoculated controls. Decree®, Prestop®, and R. diobovatum S33, applied as sprays, prevented the occurrence of stem canker and increased fruit yield in tomato. The number of dead plants was also smaller with these treatments than with the other treatments and in inoculated controls. These results suggest that, in tomato, post-inoculation sprays of RootShield® and R. diobovatum S33 can reduce lesion lengths, and that a preventive spray of Decree®, Prestop®, and R. diobovatum S33 might prevent stem canker, under near-commercial greenhouse conditions.Key words: biological control, Botrytis cinerea, Bacillus subtilis, Rhodosporidium diobovatum, grey mold.

scholarly journals Biological control of Gray Mold Rot of Perilla Caused by Botrytis cinerea II. Formulation of Antagonistic Bacteria and Its Control Effect

2002 ◽  
Vol 8 (3) ◽  
pp. 184-188 ◽  
Author(s):  
Byung-Ju Moon ◽  
Choul-Soung Kim ◽  
Ju-Hee Song ◽  
Ju-Hee Kim ◽  
Jae-Pil Lee ◽  
...  
Keyword(s):  
Biological Control ◽  
Botrytis Cinerea ◽  
Gray Mold ◽  
Antagonistic Bacteria ◽  
Control Effect ◽  
Gray Mold Rot

scholarly journals First Report of Gray Mold Caused by Botrytis cinerea on Yellow Cosmos (Bidens sulphurea) in Brazil

Plant Disease ◽  
2011 ◽  
Vol 95 (12) ◽  
pp. 1588-1588
Author(s):  
E. Guatimosim ◽  
C. A. G. Fuga ◽  
H. J. Pinto ◽  
R. W. Barreto
Keyword(s):  
Botrytis Cinerea ◽  
Pure Culture ◽  
First Record ◽  
Gray Mold ◽  
Plant Tissues ◽  
Herbaceous Species ◽  
Moist Chamber ◽  
A Minor ◽  
Beijing China ◽  
Mycology Laboratory

Bidens sulphurea (synonym Cosmos sulphureus) (Asteraceae), commonly known as yellow cosmos, is a native herbaceous species from Mexico that is widely used as an ornamental. It has been introduced in Brazil and has escaped from gardens, becoming a minor weed in ruderal, crop and pasture areas (2). In June 2010, groups of B. sulphurea individuals were found in a garden at the locality of Piúna, municipality of Viçosa (state of Minas Gerais, Brazil), that were severely attacked by gray mold. The disease led to flower rot with dieback of infected peduncles and stems. Plant tissues became brown to grayish brown and were covered by extensive fungal sporulation; in addition, seeds were colonized and destroyed by the fungus. A hyphomycete was regularly found associated with the diseased flowers, which was readily recognized as having a morphology typical of Botrytis cinerea: conidiophores solitary, cylindrical, terminally branched, 15 to 20 μm wide, grayish to olivaceous gray, and smooth; conidiogenous cells polyblastic, subcylindrical to ampulliform, and 120 to 230 × (13-) 14 to 16 (-19) μm; conidia ellipsoid to obovoid, 8 to 12 × 6.5 to 8 (-9) μm, with a discrete hilum at the base, 1 to 2 μm, aseptate, and hyaline. The fungus was isolated in pure culture and inoculation of one isolate on healthy B. suphurea individuals was carried out with a 2.14 × 106 conidia/ml suspension, which was sprayed to runoff onto three plants bearing four to six inflorescences. All plants were left in a moist chamber for 48 h and later transferred to a bench in a greenhouse at 21 ± 3°C. Gray mold symptoms appeared after 10 days that led to rapid and complete necrosis of flowers and peduncles. Infection first appeared on the flowers but progressed downward, leading to top dieback and finally plant death (not seen in the field). Only Botrytis cinerea was obtained in isolations from diseased flowers, demonstrating the pathogenicity of the fungus. A representative sample was deposited in the UFV herbarium (VIC 31602). The only other record of Botrytis cinerea causing gray mold of B. sulphurea is from China (1,3). To our knowledge, this is the first record of Botrytis cinerea causing gray mold on B. sulphurea in Brazil. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Botany and Mycology Laboratory, ARS, UDSA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 2011. (2) H. Lorenzi and H. M. Souza. Plantas Ornamentais no Brasil. Plantarum, Nova Odessa, Brazil. 1995. (3) Z. Zhang. Flora Fungorum Sinicorum. Vol. 26. Botrytis, Ramularia. Science Press, Beijing, China. 2006.

Sign in / Sign up

Export Citation Format

Share Document