scholarly journals Development ofPhasmarhabditis hermaphrodita(and members of thePhasmarhabditisgenus) as new genetic model nematodes to study the genetic basis of parasitism

2018 ◽  
Vol 93 (3) ◽  
pp. 319-331 ◽  
Author(s):  
P. Andrus ◽  
R. Rae
Keyword(s):  
Natural Variation ◽  
Genetic Basis ◽  
Genetic Model ◽  
Forward Genetics ◽  
Growth Media ◽  
Natural Conditions ◽  
Free Living ◽  
C Elegans ◽  
Genetic Mechanisms ◽  
The Uk

AbstractThe genetic mechanisms of how free-living nematodes evolved into parasites are unknown. Current genetic model nematodes (e.g.Caenorhabditis elegans) are not well suited to provide the answer, and mammalian parasites are expensive and logistically difficult to maintain. Here we propose the terrestrial gastropod parasitePhasmarhabditis hermaphroditaas a new alternative to study the evolution of parasitism, and outline the methodology of how to keepP. hermaphroditain the lab for genetic experiments. We show thatP. hermaphrodita(and several otherPhasmarhabditisspecies) are easy to isolate and identify from slugs and snails from around the UK. We outline how to make isogenic lines using ‘semi-natural’ conditions to reduce in-lab evolution, and how to optimize growth using nematode growth media (NGM) agar and naturally isolated bacteria. We show thatP. hermaphroditais amenable to forward genetics and thatuncandsmamutants can be generated using formaldehyde mutagenesis. We also detail the procedures needed to carry out genetic crosses. Furthermore, we show natural variation within ourPhasmarhabditiscollection, with isolates displaying differences in survival when exposed to high temperatures and pH, which facilitates micro and macro evolutionary studies. In summary, we believe that this genetically amenable parasite that shares many attributes withC. elegansas well as being in Clade 5, which contains many animal, plant and arthropod parasites, could be an excellent model to understand the genetic basis of parasitism in the Nematoda.

scholarly journals Phasmarhabditis hermaphrodita – a new model to study the genetic evolution of parasitism

Nematology ◽  
2017 ◽  
Vol 19 (4) ◽  
pp. 375-387 ◽  
Author(s):  
Robbie Rae
Keyword(s):  
Molecular Mechanisms ◽  
Phylogenetic Position ◽  
Genomic Comparison ◽  
Free Living ◽  
New Model ◽  
C Elegans ◽  
Genetic Mechanisms ◽  
Facultative Parasite ◽  
Evolutionary Emergence ◽  
Phasmarhabditis Hermaphrodita

The evolutionary genetic mechanisms that are responsible for the transition of free-living nematodes to parasites are unknown and current nematode models used to study this have limitations. The gastropod parasitePhasmarhabditis hermaphroditacould be used as a new model to dissect the molecular mechanisms involved in the evolution of parasitism.Phasmarhabditis hermaphroditais a facultative parasite of slugs and snails that, likeCaenorhabditis elegansandPristionchus pacificus, can also be maintained easily under laboratory conditions.Phasmarhabditis hermaphroditaandPhasmarhabditisspecies are easy to isolate from the wild and have been found around the world. The phylogenetic position ofPhasmarhabditisis ideal for genomic comparison with other clade 9 species such asC. elegansandP. pacificus, as well as mammalian and insect parasites. These attributes could makeP. hermaphroditaan excellent choice of model to study the evolutionary emergence of parasitism.

scholarly journals Recombinant DNA resources for the comparative genomics ofAncylostoma ceylanicum

2016 ◽  
Author(s):  
Wadim J. Kapulkin ◽  
Adriana Magalska ◽  
Ewa Janecka ◽  
Arkadiusz Ciesielski ◽  
Malgorzata Lobocka ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Developmental Stages ◽  
Recombinant Dna ◽  
Genomic Library ◽  
Genetic Model ◽  
Model Organism ◽  
General Interest ◽  
Ancylostoma Ceylanicum ◽  
Free Living ◽  
C Elegans

AbstractWe describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm,Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5‘-linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematodeC. elegansandA. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organismC. elegansand closely related parasitic species. We discuss the potential and relevance ofAncylostoma ceylanicumdata and resources generated by the recombinant DNA approach.

scholarly journals Natural variation in the irld gene family affects insulin/IGF signaling and starvation resistance

2021 ◽  
Author(s):  
Amy K Webster ◽  
Rojin Chitrakar ◽  
Maya Powell ◽  
Jingxian Chen ◽  
Kinsey Fisher ◽  
...  
Keyword(s):  
Nervous System ◽  
Gene Family ◽  
Natural Variation ◽  
Genetic Basis ◽  
Egf Receptor ◽  
Complex Trait ◽  
Starvation Resistance ◽  
C Elegans ◽  
Sensory Nervous System ◽  
Igf Signaling

Starvation resistance is a fundamental, disease-relevant trait, but the genetic basis of its natural variation is unknown. We developed a synthetic population-sequencing approach to measure starvation resistance for many wild C. elegans strains simultaneously. We identified three quantitative trait loci with variants in 16 insulin/EGF receptor-like domain (irld) family members. We show that four irld genes affect starvation resistance by regulating insulin/IGF signaling. We propose that IRLD proteins bind insulin-like peptides to modify signaling in the sensory nervous system thereby affecting organismal physiology. This work demonstrates efficacy of using population sequencing to dissect a complex trait, identifies irld genes that regulate insulin/IGF signaling, and shows that an expanded gene family modifies a deeply conserved signaling pathway to affect a fitness-proximal trait.

scholarly journals From QTL to gene: C. elegans facilitates discoveries of the genetic mechanisms underlying natural variation

2021 ◽  
Author(s):  
Kathryn S. Evans ◽  
Marijke H. van Wijk ◽  
Patrick T. McGrath ◽  
Erik C. Andersen ◽  
Mark G. Sterken
Keyword(s):  
Natural Variation ◽  
C Elegans ◽  
Genetic Mechanisms

scholarly journals Contextualizing genetic risk score for disease screening and rare variant discovery

2021 ◽  
Vol 12 (1) ◽  
Author(s):  
Dan Zhou ◽  
Dongmei Yu ◽  
Jeremiah M. Scharf ◽  
Carol A. Mathews ◽  
Lauren McGrath ◽  
...  
Keyword(s):  
Complex Traits ◽  
Genetic Basis ◽  
Clinical Decision Making ◽  
Genetic Risk Score ◽  
Sufficient Conditions ◽  
Clinical Decision ◽  
Generative Models ◽  
Variant Discovery ◽  
Models Of Disease ◽  
The Uk

AbstractStudies of the genetic basis of complex traits have demonstrated a substantial role for common, small-effect variant polygenic burden (PB) as well as large-effect variants (LEV, primarily rare). We identify sufficient conditions in which GWAS-derived PB may be used for well-powered rare pathogenic variant discovery or as a sample prioritization tool for whole-genome or exome sequencing. Through extensive simulations of genetic architectures and generative models of disease liability with parameters informed by empirical data, we quantify the power to detect, among cases, a lower PB in LEV carriers than in non-carriers. Furthermore, we uncover clinically useful conditions wherein the risk derived from the PB is comparable to the LEV-derived risk. The resulting summary-statistics-based methodology (with publicly available software, PB-LEV-SCAN) makes predictions on PB-based LEV screening for 36 complex traits, which we confirm in several disease datasets with available LEV information in the UK Biobank, with important implications on clinical decision-making.

scholarly journals Shifts in morphology, gene expression, and selection underlie web loss in Hawaiian Tetragnatha spiders

2021 ◽  
Vol 21 (1) ◽  
Author(s):  
Cory A. Berger ◽  
Michael S. Brewer ◽  
Nobuaki Kono ◽  
Hiroyuki Nakamura ◽  
Kazuharu Arakawa ◽  
...  
Keyword(s):  
Genetic Basis ◽  
Adaptive Traits ◽  
Deep Time ◽  
Selective Pressures ◽  
Silk Production ◽  
Silk Glands ◽  
Genetic Mechanisms ◽  
Orb Web ◽  
Short Time ◽  
Web Building

Abstract Background A striking aspect of evolution is that it often converges on similar trajectories. Evolutionary convergence can occur in deep time or over short time scales, and is associated with the imposition of similar selective pressures. Repeated convergent events provide a framework to infer the genetic basis of adaptive traits. The current study examines the genetic basis of secondary web loss within web-building spiders (Araneoidea). Specifically, we use a lineage of spiders in the genus Tetragnatha (Tetragnathidae) that has diverged into two clades associated with the relatively recent (5 mya) colonization of, and subsequent adaptive radiation within, the Hawaiian Islands. One clade has adopted a cursorial lifestyle, and the other has retained the ancestral behavior of capturing prey with sticky orb webs. We explore how these behavioral phenotypes are reflected in the morphology of the spinning apparatus and internal silk glands, and the expression of silk genes. Several sister families to the Tetragnathidae have undergone similar web loss, so we also ask whether convergent patterns of selection can be detected in these lineages. Results The cursorial clade has lost spigots associated with the sticky spiral of the orb web. This appears to have been accompanied by loss of silk glands themselves. We generated phylogenies of silk proteins (spidroins), which showed that the transcriptomes of cursorial Tetragnatha contain all major spidroins except for flagelliform. We also found an uncharacterized spidroin that has higher expression in cursorial species. We found evidence for convergent selection acting on this spidroin, as well as genes involved in protein metabolism, in the cursorial Tetragnatha and divergent cursorial lineages in the families Malkaridae and Mimetidae. Conclusions Our results provide strong evidence that independent web loss events and the associated adoption of a cursorial lifestyle are based on similar genetic mechanisms. Many genes we identified as having evolved convergently are associated with protein synthesis, degradation, and processing, which are processes that play important roles in silk production. This study demonstrates, in the case of independent evolution of web loss, that similar selective pressures act on many of the same genes to produce the same phenotypes and behaviors.

scholarly journals Caenorhabditis elegans as an in vivo Model to Assess Amphetamine Tolerance

2021 ◽  
pp. 1-9
Author(s):  
Dayana Torres Valladares ◽  
Sirisha Kudumala ◽  
Murad Hossain ◽  
Lucia Carvelli
Keyword(s):  
Caenorhabditis Elegans ◽  
Molecular Mechanisms ◽  
Drugs Of Abuse ◽  
Genetic Model ◽  
In Vivo Model ◽  
C Elegans ◽  
Hyperactivity Disorder ◽  
In Vitro Data

Amphetamine is a potent psychostimulant also used to treat attention deficit/hyperactivity disorder and narcolepsy. In vivo and in vitro data have demonstrated that amphetamine increases the amount of extra synaptic dopamine by both inhibiting reuptake and promoting efflux of dopamine through the dopamine transporter. Previous studies have shown that chronic use of amphetamine causes tolerance to the drug. Thus, since the molecular mechanisms underlying tolerance to amphetamine are still unknown, an animal model to identify the neurochemical mechanisms associated with drug tolerance is greatly needed. Here we took advantage of a unique behavior caused by amphetamine in <i>Caenorhabditis elegans</i> to investigate whether this simple, but powerful, genetic model develops tolerance following repeated exposure to amphetamine. We found that at least 3 treatments with 0.5 mM amphetamine were necessary to see a reduction in the amphetamine-induced behavior and, thus, to promote tolerance. Moreover, we found that, after intervals of 60/90 minutes between treatments, animals were more likely to exhibit tolerance than animals that underwent 10-minute intervals between treatments. Taken together, our results show that <i>C. elegans</i> is a suitable system to study tolerance to drugs of abuse such as amphetamines.

scholarly journals Natural variation in yolk fatty acids, but not androgens, predicts offspring fitness in a wild bird

2021 ◽  
Vol 18 (1) ◽  
Author(s):  
Lucia Mentesana ◽  
Martin N. Andersson ◽  
Stefania Casagrande ◽  
Wolfgang Goymann ◽  
Caroline Isaksson ◽  
...  
Keyword(s):  
Fatty Acids ◽  
Polyunsaturated Fatty Acids ◽  
Maternal Effects ◽  
Natural Variation ◽  
De Novo ◽  
Natural Populations ◽  
Egg Laying ◽  
Interactive Effects ◽  
Free Living ◽  
Offspring Fitness

Abstract Background In egg-laying animals, mothers can influence the developmental environment and thus the phenotype of their offspring by secreting various substances into the egg yolk. In birds, recent studies have demonstrated that different yolk substances can interactively affect offspring phenotype, but the implications of such effects for offspring fitness and phenotype in natural populations have remained unclear. We measured natural variation in the content of 31 yolk components known to shape offspring phenotypes including steroid hormones, antioxidants and fatty acids in eggs of free-living great tits (Parus major) during two breeding seasons. We tested for relationships between yolk component groupings and offspring fitness and phenotypes. Results Variation in hatchling and fledgling numbers was primarily explained by yolk fatty acids (including saturated, mono- and polyunsaturated fatty acids) - but not by androgen hormones and carotenoids, components previously considered to be major determinants of offspring phenotype. Fatty acids were also better predictors of variation in nestling oxidative status and size than androgens and carotenoids. Conclusions Our results suggest that fatty acids are important yolk substances that contribute to shaping offspring fitness and phenotype in free-living populations. Since polyunsaturated fatty acids cannot be produced de novo by the mother, but have to be obtained from the diet, these findings highlight potential mechanisms (e.g., weather, habitat quality, foraging ability) through which environmental variation may shape maternal effects and consequences for offspring. Our study represents an important first step towards unraveling interactive effects of multiple yolk substances on offspring fitness and phenotypes in free-living populations. It provides the basis for future experiments that will establish the pathways by which yolk components, singly and/or interactively, mediate maternal effects in natural populations.

Sign in / Sign up

Export Citation Format

Share Document