scholarly journals Recombinant DNA resources for the comparative genomics ofAncylostoma ceylanicum

2016 ◽  
Author(s):  
Wadim J. Kapulkin ◽  
Adriana Magalska ◽  
Ewa Janecka ◽  
Arkadiusz Ciesielski ◽  
Malgorzata Lobocka ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Developmental Stages ◽  
Recombinant Dna ◽  
Genomic Library ◽  
Genetic Model ◽  
Model Organism ◽  
General Interest ◽  
Ancylostoma Ceylanicum ◽  
Free Living ◽  
C Elegans

AbstractWe describe the construction and initial characterization of genomic resources (a set of recombinant DNA libraries, representing in total over 90,000 independent plasmid clones), originating from the genome of a hamster adapted hookworm,Ancylostoma ceylanicum. First, with the improved methodology, we generated sets of SL1 (5‘-linker - GGTTAATTACCCAAGTTTGAG), and captured cDNAs from two different hookworm developmental stages: pre-infective L3 and parasitic adults. Second, we constructed a small insert (2-10kb) genomic library. Third, we generated a Bacterial Artificial Chromosome library (30-60kb). To evaluate the quality of our libraries we characterized sequence tags on randomly chosen clones and with first pass screening we generated almost a hundred novel hookworm sequence tags. The sequence tags detected two broad classes of genes: i. conserved nematode genes and ii. putative hookworm-specific proteins. Importantly, some of the identified genes encode proteins of general interest including potential targets for hookworm control. Additionally, we identified a syntenic region in the mitochondrial genome, where the gene order is shared between the free-living nematodeC. elegansandA. ceylanicum. Our results validate the use of recombinant DNA resources for comparative genomics of nematodes, including the free-living genetic model organismC. elegansand closely related parasitic species. We discuss the potential and relevance ofAncylostoma ceylanicumdata and resources generated by the recombinant DNA approach.

scholarly journals Alzheimer’s disease-relevant tau modifications selectively impact neurodegeneration and mitophagy in a novel C. elegans single-copy transgenic model

2020 ◽  
Author(s):  
Sanjib Guha ◽  
Sarah Fischer ◽  
Gail VW Johnson ◽  
Keith Nehrke
Keyword(s):  
Alzheimer’S Disease ◽  
Alzheimer's Disease ◽  
Genetic Model ◽  
Neurodegenerative Disorder ◽  
Model Organism ◽  
Single Copy ◽  
Mitochondrial Stress ◽  
C Elegans ◽  
Touch Receptor Neurons ◽  
New Perspective

ABSTRACTBackgroundA defining pathological hallmark of the progressive neurodegenerative disorder Alzheimer’s disease (AD) is the accumulation of misfolded tau with abnormal post-translational modifications (PTMs). These include phosphorylation at Threonine 231 (T231) and acetylation at Lysine 274 (K274) and at Lysine 281 (K281). Although tau is recognized to play a central role in pathogenesis of AD, the precise mechanisms by which these abnormal PTMs contribute to the neural toxicity of tau is unclear.MethodsHuman 0N4R tau (wild type) was expressed in touch receptor neurons of the genetic model organism C. elegans through single-copy gene insertion. Defined mutations were then introduced into the single-copy tau transgene through CRISPR-Cas9 genome editing. These mutations included T231E and T231A, to mimic phosphorylation and phospho-ablation of a commonly observed pathological epitope, respectively, and K274/281Q, to mimic disease-associated lysine acetylation. Stereotypical touch response assays were used to assess behavioral defects in the transgenic strains as a function of age, and genetically-encoded fluorescent biosensors were used to measure the morphological dynamics and turnover of touch neuron mitochondria.ResultsUnlike existing tau overexpression models, C. elegans single-copy expression of tau did not elicit overt pathological phenotypes at baseline. However, strains expressing disease associated PTM-mimetics (T231E and K274/281Q) exhibited reduced touch sensation and morphological abnormalities that increased with age. In addition, the PTM-mimetic mutants lacked the ability to engage mitophagy in response to mitochondrial stress.ConclusionsLimiting the expression of tau results in a genetic model where pathological modifications and age result in evolving phenotypes, which may more closely resemble the normal progression of AD. The finding that disease-associated PTMs suppress compensatory responses to mitochondrial stress provides a new perspective into the pathogenic mechanisms underlying AD.

scholarly journals Calcineurin homologous proteins regulate the membrane localization and activity of sodium/proton exchangers in C. elegans

2016 ◽  
Vol 310 (3) ◽  
pp. C233-C242 ◽  
Author(s):  
Erik Allman ◽  
Qian Wang ◽  
Rachel L. Walker ◽  
Molly Austen ◽  
Maureen A. Peters ◽  
...  
Keyword(s):  
Genetic Model ◽  
Expression Patterns ◽  
Critical Role ◽  
Model Organism ◽  
Loss Of Function ◽  
Homologous Proteins ◽  
Relative Significance ◽  
C Elegans ◽  
Fluorescent Tags

Calcineurin B homologous proteins (CHP) are N-myristoylated, EF-hand Ca2+-binding proteins that bind to and regulate Na+/H+ exchangers, which occurs through a variety of mechanisms whose relative significance is incompletely understood. Like mammals, Caenorhabditis elegans has three CHP paralogs, but unlike mammals, worms can survive CHP loss-of-function. However, mutants for the CHP ortholog PBO-1 are unfit, and PBO-1 has been shown to be required for proton signaling by the basolateral Na+/H+ exchanger NHX-7 and for proton-coupled intestinal nutrient uptake by the apical Na+/H+ exchanger NHX-2. Here, we have used this genetic model organism to interrogate PBO-1's mechanism of action. Using fluorescent tags to monitor Na+/H+ exchanger trafficking and localization, we found that loss of either PBO-1 binding or activity caused NHX-7 to accumulate in late endosomes/lysosomes. In contrast, NHX-2 was stabilized at the apical membrane by a nonfunctional PBO-1 protein and was only internalized following its complete loss. Additionally, two pbo-1 paralogs were identified, and their expression patterns were analyzed. One of these contributed to the function of the excretory cell, which acts like a kidney in worms, establishing an alternative model for testing the role of this protein in membrane transporter trafficking and regulation. These results lead us to conclude that the role of CHP in Na+/H+ exchanger regulation differs between apical and basolateral transporters. This further emphasizes the importance of proper targeting of Na+/H+ exchangers and the critical role of CHP family proteins in this process.

scholarly journals Chromatin accessibility dynamics reveal novel functional enhancers in C. elegans

2016 ◽  
Author(s):  
Aaron C. Daugherty ◽  
Robin Yeo ◽  
Jason D. Buenrostro ◽  
William J. Greenleaf ◽  
Anshul Kundaje ◽  
...  
Keyword(s):  
Transcription Factor ◽  
Developmental Stages ◽  
Model Organism ◽  
High Sensitivity ◽  
Chromatin Accessibility ◽  
Chromatin Dynamics ◽  
C Elegans ◽  
Crucial Component ◽  
Organismal Development

AbstractChromatin accessibility, a crucial component of genome regulation, has primarily been studied in homogeneous and simple systems, such as isolated cell populations or early-development models. Whether chromatin accessibility can be assessed in complex, dynamic systems in vivo with high sensitivity remains largely unexplored. In this study, we use ATAC-seq to identify chromatin accessibility changes in a whole animal, the model organism C. elegans, from embryogenesis to adulthood. Chromatin accessibility changes between developmental stages are highly reproducible, recapitulate histone modification changes, and reveal key regulatory aspects of the epigenomic landscape throughout organismal development. We find that over 5,000 distal non-coding regions exhibit dynamic changes in chromatin accessibility between developmental stages, and could thereby represent putative enhancers. When tested in vivo, several of these putative enhancers indeed drive novel cell-type-and temporal-specific patterns of expression. Finally, by integrating transcription factor binding motifs in a machine learning framework, we identify EOR-1 as a unique transcription factor that may regulate chromatin dynamics during development. Our study provides a unique resource for C. elegans, a system in which the prevalence and importance of enhancers remains poorly characterized, and demonstrates the power of using whole organism chromatin accessibility to identify novel regulatory regions in complex systems.

scholarly journals Caenorhabditis elegans Infrared-Based Motility Assay Identified New Hits for Nematicide Drug Development

2019 ◽  
Vol 6 (1) ◽  
pp. 29 ◽  
Author(s):  
Gastón Risi ◽  
Elena Aguilera ◽  
Enrique Ladós ◽  
Gonzalo Suárez ◽  
Inés Carrera ◽  
...  
Keyword(s):  
Caenorhabditis Elegans ◽  
Model Organism ◽  
Proof Of Concept ◽  
Free Living ◽  
C Elegans ◽  
Nematode Parasites ◽  
Automated Assay ◽  
Free Living Nematode ◽  
Vertebrate Model ◽  
Electronegative Atom

Nematode parasites have a profound impact on humankind, infecting nearly one-quarter of the world’s population, as well as livestock. There is a pressing need for discovering nematicides due to the spread of resistance to currently used drugs. The free-living nematode Caenorhabditis elegans is a formidable experimentally tractable model organism that offers key advantages in accelerating nematicide discovery. We report the screening of drug-like libraries using an overnight high-throughput C. elegans assay, based on an automated infrared motility reader. As a proof of concept, we screened the “Pathogen Box” library, and identical results to a previous screen using Haemonchus contortus were obtained. We then screened an in-house library containing a diversity of compound families. Most active compounds had a conjugation of an unsaturation with an electronegative atom (N, O, or S) and an aromatic ring. Importantly, we identified symmetric arylidene ketones and aryl hydrazine derivatives as novel nematicides. Furthermore, one of these compounds, (1E,2E)-1,2-bis(thiophen-3-ylmethylene)hydrazine, was active as a nematicide at 25 µm, but innocuous to the vertebrate model zebrafish at 50 µm. Our results identified novel nematicidal scaffolds and illustrate the value of C. elegans in accelerating nematicide discovery using a nonlabor-intensive automated assay that provides a simple overnight readout.

scholarly journals Tauopathy-associated tau modifications selectively impact neurodegeneration and mitophagy in a novel C. elegans single-copy transgenic model

2020 ◽  
Vol 15 (1) ◽  
Author(s):  
Sanjib Guha ◽  
Sarah Fischer ◽  
Gail V. W. Johnson ◽  
Keith Nehrke
Keyword(s):  
Genetic Model ◽  
Neurodegenerative Disorder ◽  
Model Organism ◽  
Single Copy ◽  
Neuronal Morphology ◽  
Mitochondrial Morphology ◽  
Mitochondrial Stress ◽  
C Elegans ◽  
Touch Receptor Neurons ◽  
New Perspective

Abstract Background A defining pathological hallmark of the progressive neurodegenerative disorder Alzheimer’s disease (AD) is the accumulation of misfolded tau with abnormal post-translational modifications (PTMs). These include phosphorylation at Threonine 231 (T231) and acetylation at Lysine 274 (K274) and at Lysine 281 (K281). Although tau is recognized to play a central role in pathogenesis of AD, the precise mechanisms by which these abnormal PTMs contribute to the neural toxicity of tau is unclear. Methods Human 0N4R tau (wild type) was expressed in touch receptor neurons of the genetic model organism C. elegans through single-copy gene insertion. Defined mutations were then introduced into the single-copy tau transgene through CRISPR-Cas9 genome editing. These mutations included T231E, to mimic phosphorylation of a commonly observed pathological epitope, and K274/281Q, to mimic disease-associated lysine acetylation – collectively referred as “PTM-mimetics” – as well as a T231A phosphoablation mutant. Stereotypical touch response assays were used to assess behavioral defects in the transgenic strains as a function of age. Genetically-encoded fluorescent biosensors were expressed in touch neurons and used to measure neuronal morphology, mitochondrial morphology, mitophagy, and macro autophagy. Results Unlike existing tau overexpression models, C. elegans single-copy expression of tau did not elicit overt pathological phenotypes at baseline. However, strains expressing disease associated PTM-mimetics (T231E and K274/281Q) exhibited reduced touch sensation and neuronal morphological abnormalities that increased with age. In addition, the PTM-mimetic mutants lacked the ability to engage neuronal mitophagy in response to mitochondrial stress. Conclusions Limiting the expression of tau results in a genetic model where modifications that mimic pathologic tauopathy-associated PTMs contribute to cryptic, stress-inducible phenotypes that evolve with age. These findings and their relationship to mitochondrial stress provides a new perspective into the pathogenic mechanisms underlying AD.

Take a Walk to the Wild Side of Caenorhabditis elegans-Pathogen Interactions

2021 ◽  
Vol 85 (2) ◽  
Author(s):  
Leah J. Radeke ◽  
Michael A. Herman
Keyword(s):  
Innate Immunity ◽  
Caenorhabditis Elegans ◽  
Recent Work ◽  
Genetic Model ◽  
Model Organism ◽  
Bacterial Pathogen ◽  
Content Type ◽  
Microbiome Composition ◽  
C Elegans ◽  
Functional Studies

SUMMARY Microbiomes form intimate functional associations with their hosts. Much has been learned from correlating changes in microbiome composition to host organismal functions. However, in-depth functional studies require the manipulation of microbiome composition coupled with the precise interrogation of organismal physiology—features available in few host study systems. Caenorhabditis elegans has proven to be an excellent genetic model organism to study innate immunity and, more recently, microbiome interactions. The study of C. elegans-pathogen interactions has provided in depth understanding of innate immune pathways, many of which are conserved in other animals. However, many bacteria were chosen for these studies because of their convenience in the lab setting or their implication in human health rather than their native interactions with C. elegans. In their natural environment, C. elegans feed on a variety of bacteria found in rotting organic matter, such as rotting fruits, flowers, and stems. Recent work has begun to characterize the native microbiome and has identified a common set of bacteria found in the microbiome of C. elegans. While some of these bacteria are beneficial to C. elegans health, others are detrimental, leading to a complex, multifaceted understanding of bacterium-nematode interactions. Current research on nematode-bacterium interactions is focused on these native microbiome components, both their interactions with each other and with C. elegans. We will summarize our knowledge of bacterial pathogen-host interactions in C. elegans, as well as recent work on the native microbiome, and explore the incorporation of these bacterium-nematode interactions into studies of innate immunity and pathogenesis.

scholarly journals Retroviral origins of theCaenorhabditis elegansorphan gene F58H7.5

2016 ◽  
Author(s):  
Wadim J Kapulkin
Keyword(s):  
Genetic Model ◽  
Genetic Research ◽  
Model Organism ◽  
Endogenous Retrovirus ◽  
Long Terminal Repeats ◽  
Orphan Gene ◽  
C Elegans ◽  
Infection Event ◽  
New Gene ◽  
Genome Scale

AbstractThis work describes the results of the genome-scale analysis of endogenous retrovirus insertions in twoC. elegansisolates: the prototype N2 (Bristol) and CB4856 (Hawaii). In total thirteen, identification of potentially replication competent, endogenous retroviral elements is described. Ten elements were identified as conserved between N2 and CB4856 by the reciprocal match of paired LTRs. The description focuses on the particular endogenous retrovirus insertion wich is identified on the proximal arm of the chromosome IV (located at positions IV: 912,948 – 921,658 and IV: 899,767 – 908,485 of the N2 and CB4856 respectively). In both isolates the inserted provirus is flanked by the predicted long terminal repeats (LTR)s of the length of 415 bp and of identical sequence. Provided the absolute LTR sequence identity this particular provirus represents insertion acquired prior to split from the common ancestor, suggesting this insertion event is evolutionary recent. The identified insertion of the endogenous retrovirus embeds the orphan gene F58H7.5, specific toC. eleganslineage. This unprecedented example establishes that in the evolutionary pastC. elegans, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.ImportanceThis work describes the retroviral origins ofC. elegansorphan gene F58H7.5. Presented work implies that in the evolutionary past theC. eleganshave acquired new gene as a result of the infection event.C. elegansis presently regarded as genetic model organism widely used in genetic research. The genome ofC. eleganshave been sequenced nearly 20 years ago. This unprecedented example establishes that in the evolutionary past C. elegans genome, had acquired the gene of the retroviral origins presumably via mechanisms involving the RNA intermediate.

scholarly journals Caenorhabditis elegans: nature and nurture gift to nematode parasitologists

Parasitology ◽  
2017 ◽  
Vol 145 (8) ◽  
pp. 979-987 ◽  
Author(s):  
Gustavo Salinas ◽  
Gastón Risi
Keyword(s):  
Animal Model ◽  
Caenorhabditis Elegans ◽  
Parasitic Nematode ◽  
Model Organism ◽  
Parasitic Nematodes ◽  
Free Living ◽  
C Elegans ◽  
Free Living Nematode ◽  
Basic Biology ◽  
Nature And Nurture

AbstractThe free-living nematode Caenorhabditis elegans is the simplest animal model organism to work with. Substantial knowledge and tools have accumulated over 50 years of C. elegans research. The use of C. elegans relating to parasitic nematodes from a basic biology standpoint or an applied perspective has increased in recent years. The wealth of information gained on the model organism, the use of the powerful approaches and technologies that have advanced C. elegans research to parasitic nematodes and the enormous success of the omics fields have contributed to bridge the divide between C. elegans and parasite nematode researchers. We review key fields, such as genomics, drug discovery and genetics, where C. elegans and nematode parasite research have convened. We advocate the use of C. elegans as a model to study helminth metabolism, a neglected area ready to advance. How emerging technologies being used in C. elegans can pave the way for parasitic nematode research is discussed.

scholarly journals Development ofPhasmarhabditis hermaphrodita(and members of thePhasmarhabditisgenus) as new genetic model nematodes to study the genetic basis of parasitism

2018 ◽  
Vol 93 (3) ◽  
pp. 319-331 ◽  
Author(s):  
P. Andrus ◽  
R. Rae
Keyword(s):  
Natural Variation ◽  
Genetic Basis ◽  
Genetic Model ◽  
Forward Genetics ◽  
Growth Media ◽  
Natural Conditions ◽  
Free Living ◽  
C Elegans ◽  
Genetic Mechanisms ◽  
The Uk

AbstractThe genetic mechanisms of how free-living nematodes evolved into parasites are unknown. Current genetic model nematodes (e.g.Caenorhabditis elegans) are not well suited to provide the answer, and mammalian parasites are expensive and logistically difficult to maintain. Here we propose the terrestrial gastropod parasitePhasmarhabditis hermaphroditaas a new alternative to study the evolution of parasitism, and outline the methodology of how to keepP. hermaphroditain the lab for genetic experiments. We show thatP. hermaphrodita(and several otherPhasmarhabditisspecies) are easy to isolate and identify from slugs and snails from around the UK. We outline how to make isogenic lines using ‘semi-natural’ conditions to reduce in-lab evolution, and how to optimize growth using nematode growth media (NGM) agar and naturally isolated bacteria. We show thatP. hermaphroditais amenable to forward genetics and thatuncandsmamutants can be generated using formaldehyde mutagenesis. We also detail the procedures needed to carry out genetic crosses. Furthermore, we show natural variation within ourPhasmarhabditiscollection, with isolates displaying differences in survival when exposed to high temperatures and pH, which facilitates micro and macro evolutionary studies. In summary, we believe that this genetically amenable parasite that shares many attributes withC. elegansas well as being in Clade 5, which contains many animal, plant and arthropod parasites, could be an excellent model to understand the genetic basis of parasitism in the Nematoda.

In vitro activity of Cameroonian and Ghanaian medicinal plants on parasitic (Onchocerca ochengi) and free-living (Caenorhabditis elegans) nematodes

2010 ◽  
Vol 85 (3) ◽  
pp. 304-312 ◽  
Author(s):  
D. Ndjonka ◽  
C. Agyare ◽  
K. Lüersen ◽  
B. Djafsia ◽  
D. Achukwi ◽  
...  
Keyword(s):  
Caenorhabditis Elegans ◽  
Medicinal Plants ◽  
Model Organism ◽  
Anthelmintic Activity ◽  
Aqueous Extracts ◽  
Free Living ◽  
C Elegans ◽  
Nematode Parasites ◽  
Onchocerca Ochengi

AbstractEthanolic and aqueous extracts of selected medicinal plants from Cameroon and Ghana were assessed for their in vitro anthelmintic activity by using the bovine filarial parasite Onchocerca ochengi and the free living nematode Caenorhabditis elegans, a model organism for research on nematode parasites. Worms were incubated in the presence of different concentrations of extracts and inhibitory effects were monitored at different time points. Among the extracts used in this study, ethanolic extracts of Anogeissus leiocarpus, Khaya senegalensis, Euphorbia hirta and aqueous extracts from Annona senegalensis and Parquetina nigrescens affected the growth and survival of C. elegans and O. ochengi significantly. The mortality was concentration dependent with an LC50 ranging between 0.38 and 4.00 mg/ml for C. elegans (after 72 h) and between 0.08 and 0.55 mg/ml for O. ochengi after a 24 h incubation time. Preliminary phytochemical screenings on these extracts revealed the presence of flavonoids, alkaloids, saponins, carbohydrates and tannins in the extracts. Accordingly, application of A. leiocarpus, K. senegalensis, E. hirta and A. senegalensis extracts could provide alternatives in the control of helminthic infections.

Sign in / Sign up

Export Citation Format

Share Document