scholarly journals Identification and Prevalence of Botrytis spp. from Blackberry and Strawberry Fields of the Carolinas

Plant Disease ◽  
2012 ◽  
Vol 96 (11) ◽  
pp. 1634-1637 ◽  
Author(s):  
Xingpeng Li ◽  
Dolores Fernández-Ortuño ◽  
Wenxuan Chai ◽  
Fei Wang ◽  
Guido Schnabel
Keyword(s):  
North Carolina ◽  
South Carolina ◽  
Pcr Amplification ◽  
Gray Mold ◽  
Chain Reaction ◽  
Reverse Primer ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Prevalent Species ◽  
Reference Strains

Gray mold disease of blackberry and strawberry is caused by Botrytis cinerea and B. caroliniana in the southeastern United States. In this study, methods to distinguish both species were established and their prevalence was determined in commercial blackberry and strawberry fields. Using DNA from B. cinerea and B. caroliniana reference strains, a species-differentiating polymerase chain reaction (PCR) amplification was developed that amplified G3PDH gene fragments of two different sizes depending on the species. The PCR is performed with three primers (two species-differentiating forward primers and one universal reverse primer) and amplified a 238-bp product from B. cinerea and a 536-bp fragment from B. caroliniana reference isolates. A total of 400 Botrytis isolates were collected from 6 commercial blackberry and 11 strawberry fields of the Carolinas and identified to the species level by the new PCR method. Both Botrytis spp. were identified in blackberry and strawberry fields, but B. caroliniana was less common than B. cinerea. Only 33 of 202 isolates from blackberry fields were identified as B. caroliniana, and the majority of these isolates came from two fields in South Carolina. Only 1 of 198 isolates from strawberries was identified as B. caroliniana, and this isolate was found in central North Carolina. B. cinerea but not B. caroliniana isolates sporulated on potato dextrose agar and Kings medium B. Our results show that B. cinerea and B. caroliniana coexist in at least some commercial blackberry and strawberry fields of the Carolinas, with B. cinerea being the more prevalent species.

Molecular differentiation of Trichinella spiralis, T. pseudospiralis, T. papuae and T. zimbabwensis by pyrosequencing

2013 ◽  
Vol 89 (1) ◽  
pp. 118-123 ◽  
Author(s):  
L. Sadaow ◽  
C. Tantrawatpan ◽  
P.M. Intapan ◽  
V. Lulitanond ◽  
T. Boonmars ◽  
...  
Keyword(s):  
Ribosomal Rna ◽  
Trichinella Spiralis ◽  
Large Subunit ◽  
Pcr Amplification ◽  
Epidemiological Studies ◽  
Chain Reaction ◽  
Target Region ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Zoonotic Parasites

AbstractNematodes of the genus Trichinella which infect wildlife and domestic animals show a cosmopolitan distribution. These zoonotic parasites are the aetiological agents of a severe human disease, trichinellosis. Twelve taxa are recognized in the Trichinella genus, but they cannot be identified by morphology since they are sibling species/genotypes. For epidemiological studies, it is extremely important to identify each taxon since they have different distribution areas and host ranges. In the present study, polymerase chain reaction (PCR) amplification of the mitochondrial large subunit ribosomal RNA (lsu-RNA) gene coupled with a pyrosequencing technique was developed to distinguish among four Trichinella species: Trichinella spiralis, T. pseudospiralis, T. papuae and T. zimbabwensis. A PCR method was used to amplify the lsu-RNA of Trichinella sp. larvae in mouse muscles and single larvae collected from infected muscles by digestion. The results show that the four Trichinella species can be distinguished by using 26 nucleotides in the target region and the method is sensitive enough to identify individual larvae. The pyrosequencing provides a simple, rapid and high-throughput tool for the differentiation of Trichinella species.

Characterization of trypanosome infections by polymerase chain reaction (PCR) amplification in wild tsetse flies in Cameroon

Parasitology ◽  
1998 ◽  
Vol 116 (6) ◽  
pp. 547-554 ◽  
Author(s):  
I. MORLAIS ◽  
P. GREBAUT ◽  
J. M. BODO ◽  
S. DJOHA ◽  
G. CUNY
Keyword(s):  
Polymerase Chain Reaction ◽  
Infection Rate ◽  
Forest Type ◽  
Pcr Amplification ◽  
Tsetse Flies ◽  
Microscopical Examination ◽  
Chain Reaction ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Primer Sets

The polymerase chain reaction (PCR) method was used to characterize trypanosome infections in tsetse flies from 3 sleeping sickness foci in Cameroon. The predominant tsetse species found was Glossina palpalis palpalis. An average infection rate of 12·1% was revealed by microscopical examination of 888 non-teneral tsetse flies. PCR amplification analyses for trypanosome identification were carried out on 467 flies, with primer sets specific for Trypanosoma (Trypanozoon) brucei s.l., T. (Duttonella) vivax, T. (Nannomonas) simiae and forest type T. (Nannomonas) congolense. Of 467 flies 93 were positive by microscopical analysis while PCR succeeded in identifying 89 positive flies. Of the PCR-positive flies 34 (38·2%) were negative by microscopical examination. PCR amplification, when compared to the parasitological technique, gave a higher estimate of infection rate of trypanosomes in natural tsetse populations. The PCR technique did, however, fail to identify 40·9% (38/93) of the parasitologically positive flies. The reasons for this failure are discussed. The overall prevalence of mixed infections, assessed by PCR, was 37·1%; the majority (72·7%) involved T. brucei and forest type T. congolense.

scholarly journals Primer Design and Analysis for Detection of mecA gene

2021 ◽  
Vol 5 (3) ◽  
pp. 245-253
Author(s):  
Armini Syamsidi ◽  
Nuur Aanisah ◽  
Reyhan Fiqram ◽  
Imanuel Al Jultri
Keyword(s):  
Secondary Structure ◽  
Dna Polymerase ◽  
Base Pair ◽  
Meca Gene ◽  
Chain Reaction ◽  
Base Sequences ◽  
Reverse Primer ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Forward Primer

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

Identification of Bacteroides forsythus in Subgingival Dental Plaque with the Aid of a Rapid PCR Method

1997 ◽  
Vol 76 (7) ◽  
pp. 1376-1380 ◽  
Author(s):  
J.H. Meurman ◽  
J. Wahlfors ◽  
A. Korhonen ◽  
P. Alakuijala ◽  
P. Väisänen ◽  
...  
Keyword(s):  
Dental Plaque ◽  
Subgingival Plaque ◽  
Chain Reaction ◽  
Rapid Pcr ◽  
Microbiological Methods ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Pre Treatment ◽  
Culture Positive ◽  
Positive Results

Bacteroides forsythus has been shown to be prevalent among patients with periodontitis. Conventional microbiological methods used to identify this bacterium, however, are laborious and time-consuming and are therefore not well-suited for screening purposes. We have developed a polymerase chain-reaction (PCR) method which is rapid, specific, and simple to perform and does not require other sample pre-treatment except a brief centrifugation. This method was applied to the detection of B. forsythus in subgingival plaque of 58 periodontitis patients. When compared with the results of conventional culturing, the PCR method always confirmed the culture-positive results, while none of the PCR negative samples was shown to be culture-positive. The PCR method appeared to give more than double the number of samples positive for B. forsythus than culturing (89.7% vs. 37.9%). The analysis requires less than 4 hrs to perform, and is specific only to B. forsythus and sensitive enough to detect fewer than 5 bacteria.

scholarly journals Amplification of human beta-actin gene by the reverse transcriptase-polymerase chain reaction: implications for assessment of RNA from formalin-fixed, paraffin-embedded material.

1996 ◽  
Vol 44 (10) ◽  
pp. 1205-1207 ◽  
Author(s):  
A Dakhama ◽  
V Macek ◽  
J C Hogg ◽  
R G Hegele
Keyword(s):  
Polymerase Chain Reaction ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Chain Reaction ◽  
Viral Genomes ◽  
Negative Results ◽  
Beta Actin ◽  
Target Nucleic Acid ◽  
Formalin Fixed Paraffin Embedded ◽  
Polymerase Chain

The polymerase chain reaction (PCR) is a powerful method that allows enzymatic amplification of rate target nucleic acid sequences. It has been applied to the amplification of viral genomes from paraffin-embedded pathology specimens. However, interpretation of negative results requires amplification of a housekeeping gene such as beta-actin. In the present study we used specific oligonucleotide primers previously designed to amplify both the genomic DNA and the mRNA transcript from paraffin-embedded tissue. These products have predicted sizes of 250 BP and 154 BP, respectively, but our results showed that PCR amplification only (without reverse transcription) unexpectedly generated the 154-BP product. Further investigation of the nature of this product demonstrated that it originated from the amplification of DNA, not RNA. We conclude that the 154-BP product generated by these primers cannot be exclusively considered as beta-actin RNA product and should not be used to assess successful extraction of RNA, to ascertain its integrity, or to normalize for the total amount of RNA assayed by RT-PCR from paraffin-embedded tissue.

scholarly journals A Self-Contained Portable Polymerase-Chain-Reaction System Integrated with Electromagnetic Mini-Actuators for Bi-Directional Fluid Transport

2011 ◽  
Vol 27 (3) ◽  
pp. 357-364
Author(s):  
B. T. Chia ◽  
S.-A. Yang ◽  
M.-Y. Cheng ◽  
C.-W. Lin ◽  
Y.-J. Yang
Keyword(s):  
Polymerase Chain Reaction ◽  
Fluid Transport ◽  
Point Of Care ◽  
Reaction System ◽  
Thermal Characteristics ◽  
Pcr Amplification ◽  
Chain Reaction ◽  
Rapid Temperature ◽  
Small Footprint ◽  
Polymerase Chain

ABSTRACTIn this paper, the development of a portable polymerase chain reaction (PCR) device is presented. Integrating electromagnetic mini-actuators for bi-directional fluid transport, the proposed device, whose dimension is 67mm × 66mm × 25mm, can be fully operated with a 5V DC voltage. The device consists of four major parts: A disposable channel chip in which PCR mixture is manipulated and reacted, a heater chip which generates different temperature zones for PCR reaction, a linear actuator array for pumping PCR mixture, and a circuit module for controlling and driving the system. The advantages of the device include the rapid temperature responses associated with continuous-flow-type PCR devices, as well as the programmable thermal cycling associated with chamber-type PCR devices. The thermal characteristics are measured and discussed. PCR amplification is successfully performed for the 122 bp segment of MCF-7/adr cell line. Due to its small footprint, this self-contained system potentially can be employed for point-of-care (POC) applications.

Sign in / Sign up

Export Citation Format

Share Document