First Report of Dieback on Euonymus fortunei Caused by Cylindrocladiella parva in Germany

In August 2011, a severe shoot dieback was observed on several hundred plants of 1-year-old Euonymus fortunei cv. Emerald 'n Gold in a nursery in Lower Saxony and on a cemetery in Berlin. Single shoots or the whole plant were affected. Chocolate brown lesions around the shoots spread primarily acropetally to be followed by wilting of the shoot tip, reddish discoloration, dropping of leaves, and finally plant death. Two fungal isolates, JKI 2187 and JKI 1288, forming white mycelium on 2% malt extract agar (MEA) were obtained from symptomatic shoots. Both were identified by their morphology as Cylindrocladiella parva (P.J. Anderson) Boesewinkel (syn. Cylindrocladium parvum). After incubation for one week at 25°C in the dark, the reverse side of the colony became buff to ochreous and this was associated with development of long chains of chlamydospores. Microsclerotia and fruiting bodies were not observed. Morphological characteristics were determined on synthetic nutrient agar (SNA) after 7 days at 25°C under near-ultraviolet light. The conidiophores were penicillately branched. The stipe extensions were thick-walled with clavate to naviculate vesicles. Conidia measured 12.7 to 17.1 (14.9) × 2.2 to 3.3 (2.7) μm. The molecular studies confirmed the morphological identification. Genomic DNA was isolated from the mycelia. The rDNA internal transcribed spacer (ITS) region was amplified with the primers ITS1 and ITS4 and a part of the β-tubulin gene with the primers Bt2a and Bt2b (2). The sequences generated in this study were compared with sequences obtained from GenBank. A BLAST analysis showed that the ITS sequence had a 99% similarity with that of C. parva GenBank Accession No. AY793454 and the β-tubulin gene had a 100% similarity with AY793489. So far, pathogenicity of C. parva has been demonstrated for only a few plant species. Its pathogenicity was confirmed on grapevine (Vitis vinifera) in New Zealand (3), on common oak (Quercus robur) in Italy (4), and on eucalyptus in South Africa (1). To fulfill Koch's postulates for the pathogen on E. fortunei, the isolate JKI 2188 of C. parva was inoculated on 40 two-year-old plants of cv. Emerald 'n Gold. The leaves around one node were removed on five shoots per plant. After wounding the nodes with a needle, colonized agar plugs were placed on them. The plugs were covered with moist cellulose swabs and sealed with Parafilm. To act as negative controls, 20 plants were treated with sterile agar plugs. All the plants were incubated in a growth chamber at 21/16°C (day/night), with a day length of 12 h and a relative humidity of 90 to 100%. Seven weeks after inoculation, all inoculated plants showed symptoms identical to those of the diseased plants from which C. parva was originally isolated. The negative controls remained healthy. The strains reisolated were identical to the original isolates. To our knowledge, this is the first report of C. parva as a pathogen of Euonymus. Since 2011, there were no further reports of this disease. At present, the disease is not of economic importance. References: (1) P. W. Crous et al. Plant Pathol. 42:302, 1993. (2) N. L. Glass and G. C. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (3) E. E. Jones et al. Plant Dis 96: 144, 2012. (4) L. Scattolin and L. Monteccio. Plant Dis. 91:771, 2007.

Download Full-text

First Report of Fusarium Maize Ear Rot Caused by Fusarium kyushuense in China

Plant Disease ◽

10.1094/pdis-05-13-0558-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 279-279 ◽

Cited By ~ 2

Author(s):

J.-H. Wang ◽

H.-P. Li ◽

J.-B. Zhang ◽

B.-T. Wang ◽

Y.-C. Liao

Keyword(s):

Fusarium Species ◽

Morphological Characteristics ◽

Distilled Water ◽

Ear Rot ◽

Tubulin Gene ◽

Average Growth ◽

First Report ◽

Maize Ear Rot ◽

Maize Ear ◽

Β Tubulin

From September 2009 to October 2012, surveys to determine population structure of Fusarium species on maize were conducted in 22 provinces in China, where the disease incidence ranged from 5 to 20% in individual fields. Maize ears with clear symptoms of Fusarium ear rot (with a white to pink- or salmon-colored mold at the ear tip) were collected from fields. Symptomatic kernels were surface-sterilized (1 min in 0.1% HgCl2, and 30 s in 70% ethanol, followed by three rinses with sterile distilled water), dried, and placed on PDA. After incubation for 3 to 5 days at 28°C in the dark, fungal colonies displaying morphological characteristics of Fusarium spp. (2) were purified by transferring single spores and identified to species level by morphological characteristics (2), and DNA sequence analysis of translation elongation factor-1α (TEF) and β-tubulin genes. A large number of Fusarium species (mainly F. graminearum species complex, F. verticillioides, and F. proliferatum) were identified. These Fusarium species are the main causal agents of maize ear rot (2). Morphological characteristics of six strains from Anhui, Hubei, and Yunnan provinces were found to be identical to those of F. kyushuense (1), which was mixed with other Fusarium species in the natural infection in the field. Colonies grew fast on PDA with reddish-white and floccose mycelia. The average growth rate was 7 to 9 mm per day at 25°C in the dark. Reverse pigmentation was deep red. Microconidia were obovate, ellipsoidal to clavate, and 5.4 to 13.6 (average 8.8) μm in length. Macroconidia were straight or slightly curved, 3- to 5-septate, with a curved and acute apical cell, and 26.0 to 50.3 (average 38.7) μm in length. No chlamydospores were observed. Identity of the fungus was further investigated by sequence comparison of the partial TEF gene (primers EF1/2) and β-tubulin gene (primers T1/22) of one isolate (3). BLASTn analysis of the TEF amplicon (KC964133) and β-tubulin gene (KC964152) obtained with cognate sequences available in GenBank database revealed 99.3 and 99.8% sequence identity, respectively, to F. kyushuense. Pathogenicity tests were conducted twice by injecting 2 ml of a prepared spore suspension (5 × 105 spores/ml) into maize ears (10 per isolate of cv. Zhengdan958) through silk channel 4 days post-silk emergence under field conditions in Wuhan, China. Control plants were inoculated with sterile distilled water. The ears were harvested and evaluated 30 days post-inoculation. Reddish-white mold was observed on inoculated ears and the infected kernels were brown. No symptoms were observed on water controls. Koch's postulates were fulfilled by re-isolating the pathogen from infected kernels. F. kyushuense, first described on wheat in Japan (1), has also been isolated from rice seeds in China (4). It was reported to produce both Type A and Type B trichothecene mycotoxins (1), which cause toxicosis in animals. To our knowledge, this is the first report of F. kyushuense causing maize ear rot in China and this disease could represent a serious risk of yield losses and mycotoxin contamination in maize and other crops. The disease must be considered in existing disease management practices. References: (1) T. Aoki and K. O'Donnell. Mycoscience 39:1, 1998. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (3) F. Van Hove et al. Mycologia 103:570, 2011. (4) Z. H. Zhao and G. Z. Lu. Mycotaxon 102:119, 2007.

Download Full-text

First Report of Phytophthora syringae on Cedrus libani in Turkey

Plant Disease ◽

10.1094/pdis-09-13-0962-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 846-846 ◽

Cited By ~ 1

Author(s):

T. Doğmuş-Lehtijärvi ◽

A. G. Aday Kaya ◽

A. Lehtijärvi ◽

T. Jung

Keyword(s):

Average Length ◽

Morphological Characteristics ◽

Soil Samples ◽

Morphological Identification ◽

First Report ◽

Cedrus Libani ◽

Initial Symptoms ◽

Lebanon Cedar ◽

Forest Nurseries ◽

Β Tubulin

Cedrus libani, commonly known as Lebanon cedar, is one of the most important coniferous tree species in Turkey. Its main distribution is in the Taurus Mountains in the Mediterranean Region. The total area of pure Taurus cedar forest covers 109,440 ha in Turkey, all located in the southwestern regions of the country. Due to its drought resistance, Taurus cedar has been commonly used for afforestations in these semi-arid areas (1). In September 2011, during surveys for Phytophthora spp. in forest nurseries in Adapazari and İzmir in eastern Turkey, initial symptoms such as death of fine roots, yellowing, and wilting of Taurus cedar seedlings were observed. Soil samples were collected from 10 symptomatic C. libani seedlings and isolation tests for Phytophthora species were carried out using leaflets from young Quercus suber, Azalea sp., and Rhodendron sp. saplings as baits floated over flooded soil. Necrotic baits were blotted dry, cut into small pieces, and placed on selective PARPNH carrot agar. Out growing colonies were subcultured on carrot agar and kept at 12°C for morphological and molecular identifications (2). In total, six Pythiaceous isolates were obtained from the C. libani soil samples. The isolates were investigated using a light microscope and grouped according to their morphological characteristics (3). DNA was extracted from two representative isolates using Qiagen DNeasy Plant Mini Kit following the manufacturer's instructions. PCR amplifications and sequencing of the internal transcribed spacer (ITS) region of rDNA and the β-tubulin gene were performed using ITS1 and ITS4 and Tub1 and Tub2 primer sets (4). Sequencing of the PCR products in both directions was conducted by IonTek Inc. (Istanbul, Turkey) in an ABI PRISM automated sequencer. The obtained sequences were compared with those in the GenBank and Phytophthora database using BLAST search. On the basis of morphological features and molecular analyses, the two isolates were identified as Phytophthora syringae. Morphological characteristics on carrot agar were identical with the description of P. syringae (2). At 20°C, colonies reached 7 cm in diameter after 1 week. Sporangia were semipapillate to non-papillate, ovoid, with average length of 59 μm (SD ± 2.8) (range 58 to 70 μm). Oogonia were 38 μm (SD ± 5.4) in diameter (range 30 to 47 μm) with paragynous antheridia. The morphological identification was confirmed by sequence comparison at GenBank with 99% homology for both ITS and β-tubulin. The ITS sequences of the two isolates were deposited in GenBank with the accession nos. KF430614 and KF944377. Under-bark inoculation tests with mycelia plugs were conducted with both isolates of P. syringae at 18°C in a growth chamber on a total of six 1-year-old shoots cut from two C. libani trees. Lesions with an average length of 19 mm (SD ± 6) developed after 10 days. P. syringae was consistently re-isolated from the margins of necrotic tissues. Control shoots remained symptomless. To our knowledge, this is the first report of damage caused by P. syringae on C. libani seedlings in forest nursery in Turkey. References: (1) T. Çalışkan. Pages 109-130 in: Proceedings of Workshop “Hızlı gelişen türlerle ilgili rapor,” Ankara, Turkey, 1998. (2) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (3) T. Jung et al. Mycol. Res. 107:772, 2003. (4) L. P. N. M. Kroon et al. Fung. Genet. Biol. 41:766, 2004.

Download Full-text

First Report of Lasidiplodia theobromae and Cryptovalsa ampelina Associated with Grapevine Decline from Castilla y León, Spain

Plant Disease ◽

10.1094/pdis-93-5-0545c ◽

2009 ◽

Vol 93 (5) ◽

pp. 545-545 ◽

Cited By ~ 4

Author(s):

M. T. Martin ◽

L. Martin ◽

M. T. de-Francisco ◽

R. Cobos

Keyword(s):

Dna Sequences ◽

Morphological Characteristics ◽

Tubulin Gene ◽

Current Season ◽

First Report ◽

Grapevine Decline ◽

Eutypa Dieback ◽

Castilla Y Leon ◽

Pathogenicity Tests ◽

Β Tubulin

Symptoms of grapevine decline were surveyed. Samples from mature vines exhibiting external symptoms of Eutypa dieback and Esca were collected, as were young plants with and without external symptoms, and fungal isolations were performed. In 2007, 3-year-old grapevines (cv. Tempranillo grafted onto 110R rootstock) with low vigor, reduced foliage, and vascular streaking in the wood were observed. Small pieces of discolored wood were placed onto malt extract agar supplemented with 0.25 g/liter of chloramphenicol, incubated at 25°C, and resulting colonies were transferred to potato dextrose agar (PDA). Isolates were characterized by abundant aerial and fast-growing mycelium covering the plate surface after 3 days, mycelium became dark green. Pycnidia contained thick-walled, aseptate conidia 15 to 35 × 10 to 15 μm. Lasidiplodia theobromae was identified based on morphological characteristics (3) and confirmed by banding patterns obtained after the digestion of the 1,200-bp amplicon generated with ITS1 and NL4 primers (2) using restriction endonucleases (2). Single-spore cultures were generated and DNA sequences of the rDNA internal transcribed spacer region, partial sequence of the 5′ end of the β-tubulin gene, and a fragment of the elongation factor further confirmed the identification and revealed genetic similarity with other isolates of L. theobromae. A sequence of each fragment was deposited in GenBank with Accession Nos. EU600925, EU597297, and EU597298, respectively. Pathogenicity tests were conducted on four replicate rootstocks (110R) and 15 canes of current-season growth (cv. Tempranillo). Plants were inoculated with an agar plug containing L. theobromae; controls were treated with agar only. Grapevines were maintained in a greenhouse at 20 to 25°C. After 3 months, L. theobromae was reisolated from internal vascular lesions in 100 and 66% of inoculated rootstocks and canes, respectively. Control plants were asymptomatic and L. theobromae was not recovered. Using the same methodology, a fungus identified based on morphological characteristics in culture as Cryptovalsa ampelina (1) was isolated from grapevines (cv. Tempranillo) planted in 1987. Cultures in PDA were white to creamy white and cottony with diffuse margins. Colonies covered the 90-mm-diameter petri dish surface in 5 days. Conidia were 20 to 23 × 1 to 1.5 μm, unicellular, hyaline, and filiform. PCR amplifications of the DNA extracts of C. ampelina with Camp-1 and Camp-2R primers gave a characteristic DNA fragment of 300 bp (3) and DNA sequences of the ITS4-ITS5 amplicons (GenBank Accession No. EU597296) confirmed the identification. For the first time, the 5′ end of the β-tubulin gene was sequenced and deposited in GenBank (Accession No. EU600926). Pathogenicity tests were conducted as described above for L. theobromae. Both pathogens were examined in the same experiment. C. ampelina was reisolated from internal brown streaking lesions in 25% of the rootstocks and 33% of the canes. Control plants exhibited no symptoms. L. theobromae appeared to be a more aggressive pathogen than C. ampelina on grapevine with more internal brown streaking and greater recovery of pathogen from inoculated samples. To our knowledge, this is the first report of L. theobromae and C. ampelina causing grapevine decline in Castilla y León. References: (1) J. Luque et al. Phytopathol. Mediterr. 45:S101, 2006. (2) M. T. Martin and R. Cobos. Phytopathol. Mediterr. 46:18, 2007. (3) D. Pavlic et al. Stud. Mycol. 50:313, 2004.

Download Full-text

First Report of Penicillium polonicum Causing Blue Mold on Stored Onion (Allium cepa) in Serbia

Plant Disease ◽

10.1094/pdis-05-14-0550-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1440-1440 ◽

Cited By ~ 7

Author(s):

N. Duduk ◽

M. Vasić ◽

I. Vico

Keyword(s):

Allium Cepa ◽

Morphological Characteristics ◽

Economic Losses ◽

Morphological Identification ◽

Broad Host Range ◽

Malt Extract ◽

Conidial Suspension ◽

Blue Mold ◽

First Report ◽

Onion Bulbs

Penicillium polonicum K. Zaleski is an economically important airborne fungus with a broad host range including cereals, peanuts, onions, dried meats, citrus fruits, and yam tubers (2,4). Secondary metabolites produced by this species include harmful mycotoxins penicillic acid, verucosidin, and nephrotoxic glycopeptides, which may play a role in Balkan Endemic Nephropathy (2,5). In January 2013, decayed onion bulbs (Allium cepa L. cv. Meranto) with blue mold symptoms were found causing significant economic losses at a storage facility in Stara Pazova, Serbia, and were collected. The decayed area of the bulbs was pale yellow to light brown, and tissue was soft and watery. Bluish green sporulation was abundant on the surface and inside the bulb, between decayed scales. Two isolates (designated L1a and L4p) were obtained and further characterized using morphological and molecular methods. Colonies on potato dextrose agar (PDA), Czapek yeast autolysate agar (CYA), malt extract agar (MEA), and yeast extract sucrose agar (YES) media at 25°C after 7 days were blue green, velutinous, with clear exudate present on CYA. Colony reverse color on CYA and YES for both isolates were cream to yellow brown. The mean colony diameter on PDA for L1a was 29.89 ± 0.96 mm, and for L4p was 26 ± 0.37 mm; on CYA 32.56 ± 0.53 mm for L1a and 30.11 ± 2.42 mm for L4p; and on YES 33.86 ± 1.59 mm for L1a and 31.17 ± 1.83 mm for L4p. No growth was observed on CYA when isolates were incubated at 37°C. Conidiophores of both isolates were terverticillate, stipes were septate with smooth to finely roughened walls, and phialides were ampulliform. Conidia were globose to subglobose, smooth-walled, and borne in columns. Conidial dimensions for L4p were 2.72 to 3.82 (3.26) × 2.36 to 3.42 (2.95) μm, and for L1a were 2.87 to 4.39 (3.58) × 2.53 to 3.79 (3.16) μm (n = 50). Both isolates tested positive for the production of cyclopiazonic acid and other alkaloids, as indicated by a violet reaction for the Ehrlich test. Morphological characters of L1a and L4p were in accordance with those described for P. polonicum K. Zaleski (2). Genomic DNA was isolated using CTAB extraction method (1) and molecular identification was completed using gene specific primers for the β-tubulin locus (Bt-LEV-Up4/Bt-LEV-Lo1) via conventional PCR (3). The nucleotide sequences of amplified products (~800 bp) have been assigned to GenBank (KJ570971 and 72). MegaBLAST of obtained sequences showed a 99% similarity with several sequences of P. polonicum deposited in GenBank, which confirmed the morphological identification. Pathogenicity was tested by wound inoculation of 10 surface sanitized onion bulbs cv. Meranto with 50 μl of a 105/ml conidial suspension from isolates grown on PDA. Ten control onion bulbs were wound-inoculated with Tween-treated sterile distilled water. After 30 days incubation in plastic containers, under high humidity at 22°C, typical symptoms of blue mold developed on inoculated bulbs, while non-inoculated controls remained symptomless. Isolates recovered from inoculated bulbs showed the same morphological characteristics as the original isolates, thus completing Koch's postulates. To our knowledge, this is the first report of P. polonicum on stored onion in Serbia. Results from this study indicate that a holistic approach to control this fungus should be implemented that may include one or all of the following: increased sanitation methods to eliminate inoculum, breeding for resistant onion cultivars, and integration of additional control methods to maintain onion quality during storage. References: (1) J. P. Day and R. C. Shattock. Eur. J. Plant Pathol 103:379, 1997. (2) J. C. Frisvad and R. A. Samson. Stud. Mycol. 49:1, 2004. (3) S. N. de Jong et al. Mycol. Res. 105:658, 2001. (4) W. K. Kim et al. Mycobiology 36:217, 2008. (5) P. G. Mantle. Facta Univ. Ser. Med. Biol. 9:64, 2002.

Download Full-text

First Report of Pleurostoma richardsiae Associated with Twig and Branch Dieback of Olive Trees in Spain

Plant Disease ◽

10.1094/pdis-10-21-2127-pdn ◽

2021 ◽

Author(s):

Carla Calvo-Peña ◽

María Burgos ◽

Alba Diez-Galán ◽

Ana Ibañez ◽

Juan José R. Coque ◽

...

Keyword(s):

Its Region ◽

Olive Tree ◽

Negative Control ◽

Molecular Techniques ◽

Malt Extract ◽

Tubulin Gene ◽

First Report ◽

Olive Trees ◽

Branch Dieback ◽

Β Tubulin

Pleurostoma richardsiae has been described as an olive tree pathogen causing decline and brown wood streaking (Carlucci et al., 2013). A survey was carried out in plots under olive cultivation (Olea europaea L., cv. Picual; 10 year-old plants) at La Garrovilla, (Spain) in September 2020, in which a putative Verticillium wilt had been visually diagnosed. In Plot 1 (2.6 ha; 741 plants), 20.4% of the plants exhibited wilt, foliar browning and leaf drop, twig, and branch dieback. While the level of incidence in plots 2 (4.8 ha; 1368 plants), 3 (3.20 ha; 912 plants), and 4 (1.85 ha; 527 plants) was 25.0%, 19.5%, and 42.9% respectively, which meant for that harvest an average reduction in olive production, and an economic loss, of 30.2%. Three trees from each plot were uprooted and analyzed. Five out of 12 intriguingly showed brown streaking under the bark extending from the root system and ascending up the trunk, a symptom that is never associated with Verticillium dahliae wich does not produce necrosis and cankers in the wood (López-Escudero and Mercado-Blanco, 2011). Samples from the 5 tree trunks showing necrosis were taken to the lab and surface sterilized. Small pieces of discolored wood were placed onto malt extract agar plates containing chloramphenicol (0.25 g/L) and incubated for 21 days at 25°C in darkness. The growing fungal colonies were then transferred to potato dextrose agar (PDA). Isolates were identified by micromorphological characteristics, according to Vijaykrishna et al. (2004), as P. richardsiae. Colonies on PDA were cottony, brown with whitish edge, and produced abundantly two types of conidia: brown (spherical or subglobose), or hyaline (allantoids to cylindrical) that appeared on septated and inconspicuous phialides respectively. Identification was confirmed by amplification and sequencing of the internal transcribed spacer (ITS) region using ITS1/ITS4 primers (White et al., 1990), and partial sequencing of the β-tubulin gene using T1 (O’Donnell and Cigelnik, 1997) and Bt2b (Glass and Donaldson, 1995) primers. ITS sequence showed a 99.82% identity with that of P. richardsiae IFM51337 (CBS406.93 type strain; GenBank AB364703.1), whereas β-tubulin sequence exhibited a 99.77% identity with P. richardsiae CBS406.93 β-tubulin gene (GenBank MT501304.1). ITS and β-tubulin sequences were deposited in GenBank (MZ519916 and MZ542764 respectively). The P. richardsiae isolate has been deposited in the Spanish Type Culture Collection (CECT 21196). Pathogenicity tests were conducted on 1-year old potted olive plants cv. Picual, maintained in a growth chamber at 25ºC and 12-h dark/12-h light. Twelve plants were inoculated in a wound made in the stem with a scalpel, and mycelial plug (5 mm diameter) from 15-day-old PDA plates were inserted into the wound. Another set of 12 plants were inoculated with sterile agar plugs and used as negative control plants. Four months after inoculation, 66% of the plants inoculated with mycelia plugs, showed wilting, necrosis under the bark, or even had died. P. richardsiae was successfully reisolated from necrotic areas in 75% of the plants inoculated with mycelia plugs. A total of 10 reisolates were identified as P. richardsiae by the above molecular techniques to confirm Koch's postulates. No symptoms were observed in the negative control plants and the pathogen was not re-isolated from them either. To our knowledge, this is the first report of P. richardsiae associated with twig and branch dieback of olive trees in Spain.

Download Full-text

First Report of Neofusicoccum mediterraneum and N. australe Causing Decay in Vitis vinifera in Castilla y León, Spain

Plant Disease ◽

10.1094/pdis-03-11-0172 ◽

2011 ◽

Vol 95 (7) ◽

pp. 876-876 ◽

Cited By ~ 7

Author(s):

M. T. Martin ◽

L. Martin ◽

M. J. Cuesta

Keyword(s):

Elongation Factor ◽

Morphological Characteristics ◽

Genetic Identity ◽

Malt Extract ◽

Koch’S Postulates ◽

First Report ◽

Castilla Y Leon ◽

Agar Plug ◽

Koch's Postulates ◽

Β Tubulin

During a survey for grapevine decline, five young grapevines (cvs. Tempranillo and Viura) with low vigor and reduced foliage were collected (June and August 2009). Fungal isolations were performed from vascular and brown wood. Small pieces of brown wood were placed onto malt extract agar supplemented with 0.25 g/liter of chloramphenicol and incubated at 25°C in darkness. Five resulting colonies were transferred to potato dextrose agar (PDA). Isolates were characterized by abundant, gray, aerial mycelium that reached a radius of 45 mm after 4 days. Pycnidia induced on water agar with pine needles and UV light contained conidia that were hyaline, smooth, thin walled, fusiform, (20-) 22 to 26 (-28) × (5.5-) 6 (-6.5) μm, with granular cytoplasm. On the basis of morphological characteristics Neofusicoccum mediterraneum was suspected (1). Single-conidial cultures were generated from each isolate. DNA analyses were described in Martin and Cobos (2). Sequences of the internal transcribed spacer (ITS) region confirmed the identification and revealed 99% genetic identity with N. mediterraneum (GenBank Accession No EU040221). A sequence of the ITS fragment was deposited with Accession No. JF437919. Partial sequences of β-tubulin and 1-α elongation factor genes were amplified and deposited in the GenBank with Accession Nos. JF437921 and JF437923, showing 100 and 99% similarity to Accession Nos. GU292786 and GU251350, respectively. Pathogenicity tests were conducted with two isolates. The inoculations were carried out on a fresh wound on which an agar plug was applied; on 110R-rootstock woods of 12 young vines with N. mediterraneum and 12 other control plants were treated with agar only. Grapevines were maintained in a greenhouse at 20 to 25°C. After 4 months, N. mediterraneum was reisolated from vascular and brown tissues in 92% of inoculated plants, fulfilling Koch's postulates. Control plants were asymptomatic and N. mediterraneum was not recovered. With the same methodology, isolate Y264-21-1 reached a radius of 43 mm after 4 days at 25°C on PDA, presented colonies becoming olivaceous with a moderately dense mycelia, mat in center, and aerial around. Conidia were hyaline, fusiform, base subtruncate (19-) 23 to 26 (-31) × 5 to 6 (7.5) μm, unicellular, and smooth with granular contents. Based on these descriptions, N. australe was suspected (3). ITS sequence comparison revealed 99% genetic identity with N. australe (Accession No. FJ150697), a sequence of the fragment was deposited with Accession No. JF437920. Partial sequences of β-tubulin and 1α-elongation factor were deposited in the GenBank (Accession Nos. JF437922 and JF437924) showing 100 and 99% similarity to Accession Nos. AY615149 and GU251352, respectively. Koch's postulates were completed as described above. After 4 months, N. australe was reisolated from internal brown lesions in 92% of inoculated plants. Control plants were asymptomatic and N. australe was not recovered. The streaking length average from inoculation point for N. mediterraneum was 42 ± 22 mm and 53 ± 7 mm for N. australe. To our knowledge this is the first report of N. mediterraneum and N. australe in Castilla y León (Spain). References: (1) P. W. Crous et al. Fungal Planet 19:2, 2007. (2) M. T. Martin and R. Cobos. Phytopathol. Mediterr. 46:18, 2007. (3) B. Slippers et al. Mycologia 96:1030, 2004.

Download Full-text

First Report of Cylindrocarpon pauciseptatum Associated with Grapevine Decline from Castilla y León, Spain

Plant Disease ◽

10.1094/pdis-10-10-0750 ◽

2011 ◽

Vol 95 (3) ◽

pp. 361-361 ◽

Cited By ~ 5

Author(s):

M. T. Martin ◽

L. Martin ◽

M. J. Cuesta ◽

P. García-Benavides

Keyword(s):

Morphological Characteristics ◽

Vascular Lesions ◽

Width Ratio ◽

Morphological Identification ◽

Malt Extract ◽

Internal Transcribed Spacer Region ◽

Current Season ◽

First Report ◽

Grapevine Decline ◽

Agar Plug

During a survey for grapevine decline, 10 young grapevines (cvs. Tempranillo and Verdejo) with low vigor and little foliage were collected between June 2008 and August 2009. Small pieces of vascular and brown wood were placed onto malt extract agar supplemented with 0.25 g/liter of chloramphenicol and incubated at 25°C. Fifteen resulting colonies were transferred to potato dextrose agar in petri dishes (90 mm). Colonies with white mycelium covered the dishes after 10 days of incubation at 25°C in darkness; mycelium gradually became yellowish with some brownish aspect. Macroconida were predominantly three septate (40 to 45 to 50 × 8.6 to 9 to 9.5 μm with a length and width ratio of 4.7 to 5 to 5.4), straight, and cylindrical with both ends broadly rounded. Chlamydospora and ovoidal microconidia were observed on synthetic nutrient-poor agar (1). Cylindrocarpon pauciseptatum was not easy to distinguish from other Cylindrocarpon species based on morphological characteristics. Ribosomal internal transcribed spacer region sequences of single-spore cultures confirmed the morphological identification and revealed 100% genetic identity with other isolates of C. pauciceptatum present in GenBank (EF607090), a sequence of the fragment was deposited with Accession No. EU983277. Pathogenicity tests were conducted with two isolates. The inoculations were done on 110R rootstock wood of four different young plants and 15 detached canes of current-season growth (cv. Tempranillo). Plants were inoculated with an agar plug containing C. pauciceptatum; controls were treated with agar only. Grapevines were maintained in a greenhouse at 20 to 25°C. After 3 to 4 months, C. pauciceptatum was reisolated from brown tissues and internal vascular lesions in 45% of inoculated samples, fulfilling Koch's postulates. Control plants were asymptomatic and C. pauciceptatum was not recovered. To our knowledge, this is the first report implicating C. pauciceptatum as a cause of grapevine black foot disease in Spain with potentially significant impact on grapevine nurseries. Reference: (1) H. J. Schroers et al. Mycol. Res. 112:82, 2008.

Download Full-text

First Report of Cylindrocladium buxicola on Buxus sempervirens in Spain

Plant Disease ◽

10.1094/pdis-93-6-0670b ◽

2009 ◽

Vol 93 (6) ◽

pp. 670-670 ◽

Cited By ~ 14

Author(s):

C. Pintos Varela ◽

B. González Penalta ◽

J. P. Mansilla Vázquez ◽

O. Aguín Casal

Keyword(s):

Uv Light ◽

Malt Extract Agar ◽

Terminal Branch ◽

Malt Extract ◽

Tubulin Gene ◽

First Report ◽

Potted Plants ◽

Extract Agar ◽

Buxus Sempervirens ◽

Β Tubulin

Cylindrocladium buxicola Henricot, included in the EPPO alert list until November 2008, causes a dangerous foliar disease on Buxus spp. that has been recorded in several European countries and New Zealand (3,4). Buxus sempervirens L. (common boxwood) is one of the oldest ornamental garden plants in Europe. In September 2008, we received 10 2- to 3-year-old potted plants of B. sempervirens cv. Suffruticosa from a nursery in Galicia (northwest Spain) where ≈60% of the plants were affected and had finally defoliated. Diseased plants showed dark brown-to-black spots on the leaves and black streaks on the stems (3,4). To induce sporulation, diseased leaves and stem pieces were incubated in damp chambers at 22°C. A Cylindrocladium sp. was obtained. Four single conidial isolates were plated onto carnation leaf agar under near-UV light at 25°C for 7 days (2,3). Only conidiophores of the isolates growing on the surface of the carnation leaves were examined microscopically (1,3). Macroconidiophores were comprised of a stipe, a stipe extension, a terminal vesicle, and a penicillate arrangement of fertile branches (2). The stipe extension was septate, hyaline, and 90 to 165 × 2 to 4.5 μm (from the highest primary branch to the vesicle tip) (1) terminating in an ellipsoidal vesicle (6 to 11 μm in diameter) with a papillate apex. The widest part of the vesicle was above the middle. Primary branches were mainly aseptate or one septate (12 to 35 × 3 to 6 μm), secondary branches were aseptate (11 to 21 × 3 to 6 μm), and tertiary branches were rare. Each terminal branch produced two to five phialides (9 to 20 × 2.5 to 5 μm) that were reniform and aseptate. Conidia were cylindrical, straight, and one septate (56 to 75 × 4 to 6 μm). Chlamydospores were dark brown and aggregated to form microsclerotia. Cardinal temperatures of Cylindrocladium isolates on 2% malt extract agar ranged from 7 to 28°C (optimum 25°C). The 5′ end of the β-tubulin gene was amplified using primers T1 and Bt2b (3), and PCR products were sequenced directly and deposited in GenBank (Accession No. FJ696535). Comparison of the sequence with others available in GenBank showed 100% homology with those previously identified as C. buxicola (Accession Nos. AY078123 and AY078118). Pathogenicity of one representative isolate was confirmed by inoculating stems and leaves of four 3- to 4-year–old plants of B. sempervirens cv. Suffruticosa. Leaves were inoculated by spraying a spore suspension of the fungus (1 × 106 conidia per ml). For the stems, agar pieces of 1-week-old cultures grown on malt extract agar were placed and sealed with Parafilm. As a control, four plants were inoculated with agar malt plugs and sterile distilled water. Plants were incubated at 22°C and 95% humidity. Symptoms identical to ones previously described appeared 4 days after inoculation. C. buxicola was reisolated from inoculated plants but not from the controls. On the basis of morphological and physiological characteristics, pathogenicity, and the DNA sequencing of the β-tubulin gene, the isolates obtained from B. sempervirens were identified as C. buxicola (3). To our knowledge, this is the first report of C. buxicola on B. sempervirens in Spain. References: (1) P. W. Crous. Taxonomy and Pathology of Cylindrocladium (Calonectria) and Allied Genera. The American Phytopathological Society, St. Paul, MN, 2002. (2) P. W. Crous and M. J. Wingfield. Mycotaxon 51:341, 1994. (3) B. Henricot and A. Culham. Mycologia 94:980, 2002. (4) B. Henricot et al. Plant Pathol. 49:805, 2000.

Download Full-text

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽

10.1094/pdis-94-9-1168c ◽

2010 ◽

Vol 94 (9) ◽

pp. 1168-1168

Author(s):

R. S. Trivedi ◽

J. G. Hampton ◽

J. M. Townshend ◽

M. V. Jaspers ◽

H. J. Ridgway

Keyword(s):

New Zealand ◽

Morphological Characteristics ◽

New Taxon ◽

First Report ◽

Agar Plug ◽

Carrot Seed ◽

Agar Media ◽

Leaves And Roots ◽

Seed Crops ◽

Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Download Full-text

First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽

10.1094/pdis-08-13-0873-pdn ◽

2014 ◽

Vol 98 (6) ◽

pp. 843-843 ◽

Cited By ~ 6

Author(s):

N.-H. Lu ◽

Q.-Z. Huang ◽

H. He ◽

K.-W. Li ◽

Y.-B. Zhang

Keyword(s):

Morphological Characteristics ◽

Its Region ◽

Avicennia Marina ◽

Optical Microscope ◽

Ethanol Solution ◽

Morphological Observation ◽

Fusarium Equiseti ◽

First Report ◽

Initial Symptoms ◽

Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

Download Full-text