scholarly journals First report of squash vein yellowing virus naturally infecting butternut squash (Cucurbita moschata) in Texas

Plant Disease ◽  
2021 ◽  
Author(s):  
Regina Nicole Hernandez ◽  
Thomas Isakeit ◽  
Maher Al Rwahnih ◽  
Rick Hernandez ◽  
Olufemi Joseph Alabi
Keyword(s):  
Nucleic Acid ◽  
High Throughput Sequencing ◽  
Composite Sample ◽  
Cucurbita Moschata ◽  
Total Nucleic Acid ◽  
Cdna Synthesis ◽  
First Report ◽  
Two Samples ◽  
Hidalgo County ◽  
Yellowing Virus

Virus diseases are major constraints to the production of cucurbits in the Texas Lower Rio Grande Valley. In September 2020, a ~8.1 ha butternut squash (Cucurbita moschata) field in Hidalgo County, Texas, was observed with virus-like symptoms of vein yellowing, leaf curl, mosaic, and foliar chlorosis. The proportion of plants with virus-like symptoms in this field was estimated at 30% and seven samples (symptomatic = 5; non-symptomatic = 2) were collected randomly for virus diagnosis. Initially, equimolar mixtures of total nucleic acid extracts (Dellaporta et. al. 1983) from two symptomatic samples from this field and extracts from 12 additional symptomatic samples from six other fields across south and central Texas was used to generate one composite sample for diagnosis by high throughput sequencing (HTS). The TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina) was used to construct cDNA library from the composite sample, which was then sequenced on the Illumina NextSeq 500 platform. More than 26 million single-end HTS reads (75 nt each) were obtained and their bioinformatic analyses (Al Rwahnih et al. 2018) revealed several virus-like contigs belonging to different species (data not shown). Among them, 6 contigs that ranged in length from 429 to 3,834 nt shared 96 to 100% identities with isolates of squash vein yellowing virus (SqVYV), genus Ipomovirus, family Potyviridae. To confirm the HTS results, total nucleic acid extracts from the cucurbit samples from all seven fields (n = 46) were used for cDNA synthesis with random hexamers and the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio). A 1-μL aliquot of cDNA was used in 12.5-μL PCR reaction volumes with PrimeSTAR GXL DNA Polymerase (Takara Bio) and two pairs of SqVYV-specific primers designed based on the HTS derived contigs. The primer pairs SqYVV-v4762: 5′-CTGGATTCTGCTGGAAGATCA & SqYVV-c5512: 5′-CCACCATTAAGGCCATCAAAC and SqYVV-v8478: 5′-TTTCTGGGCAAACAAACATGG & SqYVV-c9715: 5′-TTCAGCGACGTCAAGTGAG targeted ~0.75 kb and ~1.2 kb fragments of the cylindrical inclusion (CI) and the complete coat protein (CP) gene sequences of SqVYV, respectively. The expected DNA band sizes were obtained only from the five symptomatic butternut squash samples from the Hidalgo Co. field. Two amplicons per primer pair from two samples were cloned into pJET1.2/Blunt vector (Life Technologies) and bidirectionally Sanger sequenced, generating 753 nt partial CI specific sequences (MW584341-342) and 1,238 nt that encompassed the complete CP (MW584343-344) of SqVYV. In pairwise comparisons, the partial CI sequences shared 100% nt/aa identity with each other and 98-99% nt/aa identity with corresponding sequences of SqVYV isolate IL (KT721735). The CP cistron of TX isolates shared 100% nt/aa identity with each other and 90-98% nt (97-100% aa) identities with corresponding sequences of several SqVYV isolates in GenBank, with isolates IL (KT721735) and Florida (EU259611) being at the high and low spectrum of nt/aa identity values, respectively. This is the first report of SqVYV in Texas, naturally occurring in butternut squash. SqVYV was first discovered in Florida (Adkins et al. 2007) and subsequently reported from few other states in the U.S. (Adkins et al. 2013; Egel and Adkins 2007; Batuman et al. 2015), Puerto Rico (Acevedo et al. 2013), and locations around the world. The finding shows an expansion of the geographical range of SqVYV and adds to the repertoire of cucurbit-infecting viruses in Texas. Further studies are needed to determine the prevalence of SqVYV in Texas cucurbit fields and an assessment of their genetic diversity.

scholarly journals First report of Cucurbit chlorotic yellows virus infecting cantaloupe (Cucumis melo L.) in Texas

Plant Disease ◽  
2021 ◽  
Author(s):  
Regina Nicole Hernandez ◽  
Thomas Isakeit ◽  
Maher Al Rwahnih ◽  
Rick Hernandez ◽  
Olufemi Joseph Alabi
Keyword(s):  
Nucleic Acid ◽  
Coat Protein ◽  
Cucumis Melo ◽  
Composite Sample ◽  
Acid Extraction ◽  
Total Nucleic Acid ◽  
First Report ◽  
Chlorotic Mottle ◽  
Cucumis Melo L ◽  
Cucurbit Chlorotic Yellows Virus

Texas is a major producer of cucurbits such as cantaloupe (Cucumis melo L.), but outbreaks of virus-like diseases often adversely affect yields. Little is known about the identity of the causal or associated viruses. During studies conducted in fall 2020 to explore the virome of cucurbit fields in Texas, a commercial cantaloupe field (~4.1 ha) in Cameron County was observed with virus-like symptoms of interveinal chlorotic mottle and foliar chlorosis and disease incidence was estimated at 100%. Virus-like symptoms including mosaic and leaf curl were also observed in six additional fields across five south and central Texas counties of Atascosa, Hidalgo, Fort Bend, Frio, and Wharton. Forty-six plants, which included 32 symptomatic and 14 non-symptomatic, were sampled from these fields for virus diagnosis and each sample was subjected to total nucleic acid extraction according to Dellaporta et. al. (1983). Initially, equal amounts of nucleic acids from 14 symptomatic plants (two/field) were pooled into one composite sample for preliminary diagnosis by high throughput sequencing (HTS). The cDNA library obtained from the composite sample with a TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina) was sequenced on the Illumina NextSeq 500 platform, generating ~26.3 M single-end HTS reads (75 nucleotides [nt] each). Analyses of the reads according to Al Rwahnih et al. (2018) revealed several virus-like contigs; among them 23 contigs (206 to 741 nt) shared 98 to 100% nt identities to isolates of cucurbit chlorotic yellows virus (CCYV), genus Crinivirus, family Closteroviridae. Three pairs of CCYV-specific primers were designed from the HTS contigs with primers CCYV-v1330: 5′-AGTCCCTTACCCTGAGATGAA/CCYV-c2369: 5′-CGGAGCATTCGACAACTGAATA targeting ~1 kb fragment of the ORF1a (RNA1), primers CCYV-v4881: 5′-ATAAGGCGGCGACCTAATC/CCYV-c5736: 5′-GATCACTTGACCATCTCCTTCT targeting a ~0.9 kb fragment encompassing the coat protein (CP) cistron of CCYV (RNA2), and primers CCYV-v6362: 5′-CACCTCTTCCAGAACCAGTTAAA/CCYV-c7423: 5′-TGGGAACAACTTATTTCTCCTAGC targeting ~1 kb spanning partial minor coat protein (CPm) and p26 sequences (RNA2). Total nucleic acid extracts of each of the 46 samples from the seven fields were tested by two-step reverse transcription polymerase chain reaction using all three CCYV-specific primer pairs and they yielded amplicons of expected sizes from all five symptomatic cantaloupe samples from the Cameron County field and one additional symptomatic butternut squash sample from a field in Hidalgo County. The DNA bands from three randomly chosen cantaloupe samples were cloned and sequenced as previously described (Oke et al. 2020). In pairwise comparisons, the obtained 1,040 nt ORF1a (MW584332-334), 753 nt complete CP (MW584335-337), and 1,062 nt CPm/p26 (MW584338-340) gene specific sequences from the three samples shared 100% nt identity with each other, and 99-100% nt identities with corresponding RNA1 (AB523788) and RNA2 (AB523788) sequences of the exemplar isolate of CCYV. This is the first report of CCYV in Texas, thus expanding the current geographical range of the virus in the U.S. that includes California (Wintermantel et al. 2019) and Georgia (Kavalappara et al. 2021). The abundance of whiteflies of the Bemisia tabaci species complex in south Texas and other major U.S. cucurbit production areas presents additional challenges to virus disease management.

scholarly journals First Report of Strawberry necrotic shock virus in China

Plant Disease ◽  
2011 ◽  
Vol 95 (9) ◽  
pp. 1198-1198 ◽  
Author(s):  
L. Li ◽  
H. Yang
Keyword(s):  
Nucleic Acid ◽  
Home Garden ◽  
Tobacco Streak Virus ◽  
Chinese Isolate ◽  
Streak Virus ◽  
Total Nucleic Acid ◽  
Rt Pcr ◽  
Viral Pathogen ◽  
First Report ◽  
Strawberry Vein Banding Virus

Strawberry necrotic shock virus (SNSV) is an economically important viral pathogen that infects Fragaria and Rubus spp. SNSV was first identified in the 1950s and early studies indicated that SNSV was a strain of Tobacco streak virus (TSV). Recently, it was shown that SNSV was a distinct virus based on molecular characterization (2). Currently, SNSV is a tentative member of the Ilarvirus genus in the Bromoviridae family. In 2008, a small sampling survey for SNSV was done in Heilongjiang Province of China, and 15 strawberry samples were collected from symptomless strawberries in a home garden that had more than 5 years of strawberry cultivation history. Total nucleic acid was extracted from strawberry leaflets by modified cetyltrimethylammoniumbromide methods (3). Reverse transcription (RT)-PCR was operated with the published primer pair CPbeg F/CPend R (2). Amplified DNA fragments with the predicted size were obtained only in one strawberry sample, which was further cloned and sequenced. The sequence (GenBank Accession No. HQ830017) was closely related and highly homologous (89.7 to 98.5% identity) to that of viral isolates (GenBank Accession Nos. AY363228-AY363242) from Fragaria and Rubus spp. Phylogenetic analysis based on nucleotide sequence of the coat protein gene was done with the neighbor-joining method of MEGA 4.0 software. The result showed that all the isolates of SNSV fell into two distinct clades. The Chinese isolate formed one small clade with Japanese isolate 1291. The isolate was also transmitted to Chenopodium quinoa by mechanical inoculation in the greenhouse, and the symptom of chlorotic mottling could be found in C. quinoa and detected by RT-PCR. To determine whether the sample was infected by other strawberry viruses, RT-PCR assays with the published primer pairs SVBVdeta/SVBVdetb, SMoVdeta/SMoVdetb, and SMYEVdeta/SMYEVdetb were also performed for detection of Strawberry vein banding virus, Strawberry mottle virus, and Strawberry mild yellow edge virus using total nucleic acid extracted from the SNSV-positive sample as a template (1). The result indicated that it had been also infected by Strawberry mild yellow edge virus, although no visible symptoms were observed. To our knowledge, this is the first report of SNSV in strawberry in China. Additional work is needed to elucidate the biological characterization and significance of the finding. References: (1) J. R. Thompson et al. J. Virol. Methods 111:85, 2003. (2) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (3) H. Y. Yang et al. Acta Hortic. 764:127, 2007.

Comparative Analysis of Three Different Total Nucleic Acid Extraction Protocols for the Diagnosis of Geminiviruses in Squash (Cucurbita moschata)

2011 ◽  
Vol 160 (1) ◽  
pp. 19-25
Author(s):  
Eduardo J. Hernández ◽  
Floribeth Mora-Umaña ◽  
Federico Albertazzi ◽  
James P. Karkashian ◽  
Pilar Ramírez
Keyword(s):  
Comparative Analysis ◽  
Nucleic Acid ◽  
Acid Extraction ◽  
Cucurbita Moschata ◽  
Total Nucleic Acid ◽  
Nucleic Acid Extraction

scholarly journals First report of grapevine virus H (GVH) in grapevine in Greece

Plant Disease ◽  
2021 ◽  
Author(s):  
Polina Panailidou ◽  
Leonidas Lotos ◽  
Chrysoula-Lyto Sassalou ◽  
E. Gagiano ◽  
Gerhard Pietersen ◽  
...  
Keyword(s):  
Sanger Sequencing ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Virus Genome ◽  
Composite Sample ◽  
Grapevine Virus ◽  
Northern Greece ◽  
Total Rna ◽  
First Report ◽  
The Usa

Grapevine virus H (GVH) is a member of the genus Vitivirus in the family Betaflexiviridae (subfamily Trivirinae, order Tymovirales) that infects grapevine (Candresse et al., 2018). GVH was first identified in a symptomless grapevine of an unknown cultivar from Portugal in 2018 (Candresse et al. 2018), and since then the virus has been reported only from California (Diaz‑Lara et al. 2019). Several vitiviruses have been detected in Greek vineyards (Avgelis and Roubos 2000; Dovas and Katis 2003a; 2003b; Panailidou et al. 2019; Lotos et al. 2020), but no information was available on the presence of GVH. In the fall of 2020, in order to investigate the virome of a commercial vineyard of the cultivar Assyrtiko in northern Greece, a composite sample was made of leaves and petioles from nine vines exhibiting leafroll disease symptoms. Total RNA was extracted from the composite sample according to the protocol of White et al. (2008) and subjected to rRNA depletion, library construction (TruSeq Stranded Total RNA kit), and high-throughput sequencing (HTS) in a NovaSeq6000 platform (Illumina Inc.) at Macrogen (Korea). The resulting ~42 million 101-nt paired-end reads were analyzed in Geneious Prime 2020, and the assembled de novo contigs were subjected to a local BLASTn search, which revealed the presence of 18 grapevine infecting viruses and viroids, among which also a GVH-like contig (GeA-9). GeA-9 was 7,404 nucleotides (nt) long, covering 99.4% of the full virus genome and shared 98.2 % nt identity with a GVH isolate from the USA (MN716768). To confirm the presence of GVH, the nine samples of the cultivar Assyrtiko, used initially to produce the composite sample for HTS analysis, were tested individually by RT-PCR, using the primers GVH_F_2504 (5’-CTGCTTCGCTGAACATATGC-3’) and GVH_R_2835 (5’-ATCATTRTGATCGAGAGAGTAGTG-3’) that amplify a 331-nt segment of ORF1. GVH was detected in five out of the nine tested samples and one of these was reamplified and subjected to Sanger sequencing. The fragment of ORF1 obtained by Sanger sequencing (MW460005) was 97.5% identical to the nucleotide sequence of the corresponding GVH-like de novo contig (GeA-9) from HTS analysis and it shared 97.2% nt identity with GVH sequences reported from Portugal and USA, respectively (NC_040545 and MN716768), confirming the presence of GVH in the tested samples. This is the first report of GVH in grapevine in Greece, thus further increasing the number of vitiviruses known to infect Greek vineyards and also expanding the number of geographic locations in which GVH is recorded so far.

scholarly journals First Report of Cucumber vein yellowing virus in Spain

Plant Disease ◽  
2001 ◽  
Vol 85 (3) ◽  
pp. 336-336 ◽  
Author(s):  
I. M. Cuadrado ◽  
D. Janssen ◽  
L. Velasco ◽  
L. Ruiz ◽  
E. Segundo
Keyword(s):  
Total Nucleic Acid ◽  
Accession Number ◽  
Rt Pcr ◽  
Specific Primers ◽  
First Report ◽  
Vein Clearing ◽  
Acquisition Period ◽  
Greenhouse Cucumber ◽  
And Control ◽  
Yellowing Virus

In the autumn of 2000, an outbreak of a disease caused considerable losses in greenhouse cucumber crops in Almeria (Spain). Infected plants showed vein clearing followed by chlorosis in leaves and yellow/green chlorotic spots on fruits. These symptoms as well as the presence of Bemisia tabaci in the crops suggested the possible involvement of Cucumber vein yellowing virus (CVYV), a proposed member of the Potiviridae family, which was first described in 1960 in Cucumis spp. from Israel (1). B. tabaci populations and leaves from cucumber plants were collected from the greenhouses and analyzed by RT-PCR using specific primers (CV(+): 5′-AGCTAGCGCGTATGGGGTGAC-3′; CV(-): 5′-GCGCCGCAAGTGCAA-ATAAAT-3′) that we designed based on the partial sequence published for CVYV (2). Total nucleic acid extracts from both B. tabaci individuals and the collected plants yielded amplification products of the expected size (449 bp), which were cloned and sequenced (Genebank accession number AJ301640). The sequence was 95.6% identical to that previously reported for CVYV. Nonviruliferous B. tabaci whiteflies were given a 24-h acquisition period on symptomatic leaves and then placed in groups of 15 insects on each of 10 healthy cucumber plants at the 4 leaf-stage for a 24-h inoculation period. Inoculated and control plants were analyzed 1 week later and the infection with CVYV was confirmed (10/10) by RT-PCR. Doublestranded RNA extractions from field-collected samples and from plants inoculated under controlled conditions suggested that no dsRNA formation was associated with the infection. This is the first report of CVYV in Spain. References: (1) S. Cohen and F. E. Nitzany. Phytopathol. Medit. 1:44, 1960. (2) H. Lecoq et al. J. Gen. Virol. 81:2289, 2000.

scholarly journals First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica

Plant Disease ◽  
2005 ◽  
Vol 89 (10) ◽  
pp. 1130-1130 ◽  
Author(s):  
R. W. Hammond ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez
Keyword(s):  
Costa Rica ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Nucleotide Sequence Analysis ◽  
Cucurbita Moschata ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Two Samples

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5′ GAGCGCCGCACAAGTCATC 3′ and CYHSPR 5′ TACCGCCACCAAAGTCATACATTA 3′) of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5′ GGCTGGCAACATGGAAACTGA 3′ and MYVR 5′ CTGAAAAGGCGATGAACTA TTGTG 3′) were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

scholarly journals First report of Cherry virus F infecting Japanese plum in Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
Yeonhwa Jo ◽  
Hoseong Choi ◽  
Jin Kyong Cho ◽  
Won Kyong Cho
Keyword(s):  
Czech Republic ◽  
High Throughput Sequencing ◽  
Prunus Avium ◽  
De Novo ◽  
Protein Database ◽  
Specific Primers ◽  
The Czech Republic ◽  
First Report ◽  
Japanese Plum ◽  
Leaf Spots

Cherry virus F (CVF) is a tentative member of the genus Fabavirus in the family Secoviridae, consisting of two RNA segments (Koloniuk et al. 2018). To date, CVF has been documented in only sweet cherry (Prunus avium) in the Czech Republic (Koloniuk et al. 2018), Canada, and Greece. In May 2014, we collected leaf samples from four symptomatic (leaf spots and dapple fruits) and two asymptomatic Japanese plum cultivars (Sun and Gadam) grown in an orchard in Hoengseong, South Korea, to identify viruses and viroids infecting plum trees. Total RNA from individual plum trees was extracted using two commercial kits: Fruit-mate for RNA Purification Kit (Takara, Shiga, Japan) and RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). We generated six mRNA libraries from the six different plum cultivars for RNA-sequencing using the TruSeq RNA Library Preparation Kit v2 (Illumina, CA, U.S.A.) as described previously (Jo et al. 2017). The mRNA libraries were paired-end (2 X 100 bp) sequenced with a HiSeq 2000 system (Macrogen, Seoul, Korea). The raw sequence reads were de novo assembled by Trinity program v. 2.8.6, with default parameters (Haas et al. 2013). The assembled contigs were subjected to BLASTX search against the non-redundant protein database in NCBI. Of the two asymptomatic cultivars, the transcriptome of asymptomatic plum cv. Gadam contained five contigs specific to CVF. Two and three contigs were specific to CVF RNA1 (2,571 reads, coverage 42.15%) and RNA2 (2,025 reads, coverage 53.04%), respectively. The size of these five contigs ranged from 241 to 5,986 bp. Contigs of 5,986 and 3,867 bp in length, referred to as CVF isolate Gadam RNA1 (GenBank MN896996) and RNA2 (GenBank MN896995), respectively, were subjected to BLASTP search against NCBI’s non-redundant protein database. The results showed that the polyprotein sequences of RNA1 and RNA2 shared 95.3% and 93.11% amino acid identities with isolates SwC-H_1a from the Czech Republic (GenBank acc. no. AWB36326) and Stac-3B_c8 from Canada (AZZ10055), respectively. To confirm the infection of CVF in cv. Gadam, RT-PCR was conducted using CVF RNA1-specific primers designed based on the CVF reference genome sequences (MH998210 and MH998216), including 5’-CCACCAAATAGGCAAGAGGTCAC-3’ (position 3190–3212) and 5’-CACAATCACCATCAATGGTCTCTGC-3’ (position 3742–3766), and CVF RNA2-specific primers, including 5’-CTGCTTTATGATGCTAGACATCAAGATG-3’ (position 1015–1042) and 5’-ACAATAGGCATGCTCATCTCAACCTC-3’ (position 1594–1619). We amplified 577-bp RNA1-specific and 605-bp RNA2-specific amplicons that were cloned and then performed Sanger sequencing. Sequencing of the cloned amplicons for isolate Gadam RNA1 (GenBank MN896993) and RNA2 (GenBank MN896994) revealed values of 99.48% and 99.17% nucleotide identity to that of RNA1 and RNA2 determined by high-throughput sequencing, respectively. Additionally, we tested five plants for each of the six plum cultivars grown in the same orchard. The detection of CVF was carried out through PCR using the primers and protocol described above. Of the 30 trees, CVF was detected in three trees of cv. Gadam by both primer pairs. To our knowledge, this is the first report of CVF infecting Japanese plum and the first report of the virus in Korea. However, its prevalence in other Prunus species, including apricot, European plum, and peach, should be further elucidated.

scholarly journals First Report of Okra yellow mosaic Mexico virus in Okra in the United States

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 924-924 ◽  
Author(s):  
C. Hernandez-Zepeda ◽  
T. Isakeit ◽  
A. Scott ◽  
J. K. Brown
Keyword(s):  
United States ◽  
The United States ◽  
Full Length ◽  
Bipartite Begomoviruses ◽  
Economic Losses ◽  
Growth Stages ◽  
First Report ◽  
Total Dna ◽  
Hidalgo County ◽  
Whitefly Vector

During the okra growing season from August to November of 2009, symptoms reminiscent of geminivirus infection were observed on 75% of ‘Green Emerald’ Abelmoschus esculentus (L.) Moench, plants in a 0.2-km2 field in Hidalgo County, TX. Visible symptoms consisted of irregular yellow patches on leaves, distinctive yellow borders on leaf edges, and chlorosis of subsequently developing leaves. The whitefly vector of begomoviruses, Bemisia tabaci (Genn.), infested okra plants in the early growth stages during late July 2009. Total DNA was isolated from the leaves of three symptomatic okra plant samples (1) and used as the PCR template to amplify a 575-bp fragment of the coat protein gene (CP) using the universal begomovirus primers AV494 and AC1048 (2). PCR products of the expected size were cloned into the pGEM-T Easy (Promega, Madison, WI) and sequenced using the universal M13F and M13 R primers. ClustalV alignment indicated 99 to 100% shared nucleotide (nt) identity, and BLAST analysis revealed that the closest relative was Okra yellow mosaic Mexico virus - Tetekalitla (OkYMMV) (GenBank Accession No. EF591631) at 98%. To amplify the full-length DNA-A and a possible cognate DNA-B component, one plant that was positive by CP-PCR and DNA sequencing was selected for further analysis. Total DNA from this plant was used as template for a second detection method that consisted of rolling circle amplification (RCA) using the TempliPhi 100 Amplification System (GE Healthcare). RCA is a non-sequence-specific approach that permits amplification of circular DNA. The RCA products were linearized to release unit length ~2.6 kb DNA-A and DNA-B components using BamHI, and EcoRI, respectively. These products were cloned into pGEM3zf+ (Promega) and sequenced using M13F and M13 R primers and then by primer walking (>300 base overlap). Full-length DNA-A and DNA-B components were obtained, respectively, at 2,613 bp (GenBank Accession No. HM035059) and 2,594 bp (GenBank Accession No HM035060). Alignment of the DNA-A component using ClustalV (MegAlign, DNASTAR, Madison, WI) with begomoviral sequences available in GenBank indicated that it was 99% identical to OkYMMV DNA-A (GenBank Accession No. DQ022611). The closest relative to the DNA-B component (ClustalV) was Sida golden mosaic virus (SiGMV) (GenBank Accession No. AJ250731) at 73%. The nt identity of the 172-nt ‘common region’ present in the DNA-A and DNA-B components was 99%, and the iterons (predicted Rep binding motif) were identical for the two components, indicating that they are a cognate pair. The genome organization was typical of other New World bipartite begomoviruses. The economic losses due to infection by this virus could not be determined because an early freeze killed the plants. Hidalgo County is adjacent to Tamaulipas, Mexico, where ~50 km2 of okra are grown and the whitefly vector is also present. The identification of OkYMMV based on two independent detection methods, and the presence of begomovirus-like symptoms together with the whitefly vector, provide robust evidence for the association of OkYMMV-TX with diseased okra plants. To our knowledge, this is the first report of OkYMMV-TX infecting okra crops in Texas and in the continental United States. References: (1) J. J. Doyle and J. L. Doyle. Focus 12:13, 1990. (2) S. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Fragaria chiloensis cryptic virus, Fragaria chiloensis latent virus, Strawberry mild yellow edge virus, Strawberry necrotic shock virus, and Strawberry pallidosis associated virus in Single and Mixed Infections in Strawberry in Central Mexico

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 1002-1002 ◽  
Author(s):  
L. Silva-Rosales ◽  
M. N. Vázquez-Sánchez ◽  
V. Gallegos ◽  
M. L. Ortiz-Castellanos ◽  
R. Rivera-Bustamante ◽  
...  
Keyword(s):  
Viral Infections ◽  
The United States ◽  
Latent Virus ◽  
Nucleotide Sequencing ◽  
Mixed Infections ◽  
Cryptic Virus ◽  
First Report ◽  
Detection And Identification ◽  
Two Samples ◽  
Fragaria Chiloensis

For phytosanitary purposes, the prevalence and incidence of viruses found in strawberry production within a centralized breeding program was investigated in Abasolo and Irapuato Counties, Guanajuato State, Mexico. Single and mixed infections of Strawberry mottle virus (SMoV) and Strawberry crinkle virus (SCV) were originally reported in the area (3), and subsequently, Strawberry latent ringspot virus (SLRSV) was also found (4). Samples of strawberry plants showing viral symptoms: stunting, mild chlorosis and reddening, occasional wrinkled, curled, and deformed leaves that may exhibit mottling, and chlorotic spots, forming a putative virus complex were collected in April and December 2007 and July and December 2008. The detection and identification of viruses reported in the United States, the country of origin of most of the imported plantlets, was carried out with sets of primers for 11 viruses, through reverse transcription (RT)-PCR (developed by Robert Martin and Ioannis Tzanetakis in Corvallis, OR). The endogenous NADH 2 subunit was employed to test the quality of the RNA extracted. Amplification conditions were: 40 cycles of 1 min at each temperature, denaturation at 95°C, annealing at 50°C for Strawberry necrotic shock virus (SNSV); 52°C for Strawberry mild yellow edge virus (SMYEV); 55°C for Fragaria chiloensis latent virus (FClLV), Strawberry pallidosis associated virus (SPaV), Fragaria chiloensis cryptic virus (FClCV), and SMoV; and 58°C for SCV and NADH dehydrogenase, followed by a final extension at 72°C of 5 min after completion of the 40 cycles. The cloning and nucleotide sequencing of amplified fragments revealed the presence of seven viral species in 40 samples collected. These were FClLV, SCV, SMoV, SNSV, SPaV, and SMYEV, which were allocated GenBank accession numbers of JQ629412, JQ629413, JQ629414, JQ629415, JQ629416, and JQ629417, respectively. Strawberry UC-4 and UC-10 (1,2) were planted as indicators of viral infections on an experimental plot. All seven viruses were detected in single or mixed infections. SMoV was the most commonly found in combination with other viruses. Out of 40 samples, 35 were positive for the presence of viruses and six had single infections, of which five had SMoV and one had SPaV. The remaining 29 samples had mixed infections with two or more viruses in a total of 22 combinations. The combination of FCICV + SMoV was present in five samples, whereas the combination of SMoV + SMYEV was in two samples. All other samples had two and up to six different viruses per plant. SMoV was detected in 26 out of the 40 samples tested. SNSV and FClCV were detected in 14 samples. SMYEV was present in 13 samples. SCV was present in nine samples, whereas SPaV and FClLV were found in eight samples each. To the best of our knowledge, this is the first report of FClLV, FClCV, SNSV, SMYEV, and SPaV in Mexico. References: (1) N. W. Frazier. Plant Dis. Rep. 58:28, 1974. (2) N. W. Frazier. Plant Dis. Rep. 58:203, 1974. (3) D. Teliz-Ortiz and A. Trejo-Reyes. Rev. Mex. Fitopatol. 7:38, 1989. (4) L. Pérez-Moreno et al. Rev. Mex. Fitopatol. 22:187, 2004.

Sign in / Sign up

Export Citation Format

Share Document