First Report of Cucumber vein yellowing virus in Spain

In the autumn of 2000, an outbreak of a disease caused considerable losses in greenhouse cucumber crops in Almeria (Spain). Infected plants showed vein clearing followed by chlorosis in leaves and yellow/green chlorotic spots on fruits. These symptoms as well as the presence of Bemisia tabaci in the crops suggested the possible involvement of Cucumber vein yellowing virus (CVYV), a proposed member of the Potiviridae family, which was first described in 1960 in Cucumis spp. from Israel (1). B. tabaci populations and leaves from cucumber plants were collected from the greenhouses and analyzed by RT-PCR using specific primers (CV(+): 5′-AGCTAGCGCGTATGGGGTGAC-3′; CV(-): 5′-GCGCCGCAAGTGCAA-ATAAAT-3′) that we designed based on the partial sequence published for CVYV (2). Total nucleic acid extracts from both B. tabaci individuals and the collected plants yielded amplification products of the expected size (449 bp), which were cloned and sequenced (Genebank accession number AJ301640). The sequence was 95.6% identical to that previously reported for CVYV. Nonviruliferous B. tabaci whiteflies were given a 24-h acquisition period on symptomatic leaves and then placed in groups of 15 insects on each of 10 healthy cucumber plants at the 4 leaf-stage for a 24-h inoculation period. Inoculated and control plants were analyzed 1 week later and the infection with CVYV was confirmed (10/10) by RT-PCR. Doublestranded RNA extractions from field-collected samples and from plants inoculated under controlled conditions suggested that no dsRNA formation was associated with the infection. This is the first report of CVYV in Spain. References: (1) S. Cohen and F. E. Nitzany. Phytopathol. Medit. 1:44, 1960. (2) H. Lecoq et al. J. Gen. Virol. 81:2289, 2000.

Download Full-text

First Report of Cucumber vein yellowing virus on Cucumber, Melon, and Watermelon in Iran

Plant Disease ◽

10.1094/pd-90-1113c ◽

2006 ◽

Vol 90 (8) ◽

pp. 1113-1113 ◽

Cited By ~ 9

Author(s):

K. Bananej ◽

C. Desbiez ◽

M. Girard ◽

C. Wipf-Scheibel ◽

I. Vahdat ◽

...

Keyword(s):

Coat Protein ◽

Plant Extracts ◽

Infected Plant ◽

Economic Losses ◽

Healthy Plant ◽

Cucumber Plant ◽

Rt Pcr ◽

First Report ◽

Vein Clearing ◽

Yellowing Virus

Several viral diseases are responsible for significant economic losses in commercial cucurbit production worldwide. During a survey conducted in July 2002 in cucurbit growing areas in southern Iran, vein-clearing symptoms and leaf chlorosis on older leaves were observed on a cucumber plant near Jiroft (Kerman Province). These symptoms were similar to those caused by Cucumber vein yellowing virus (CVYV, genus Ipomovirus, family Potyviridae), a virus first described in Israel (1) and now widespread in cucurbit crops in the Middle East and Mediterranean Regions (2). The identification of CVYV was established through differential host range reaction and immunosorbent electron microscopy (IEM) experiments. Typical vein-clearing symptoms were observed following mechanical inoculation of cucumber and melon plantlets, but no symptoms were observed in Chenopodium quinoa, C. amaranticolor, Nicotiana tabacum, or Vigna sinensis. Numerous, slightly flexuous, elongated virus particles were observed in infected plant extracts. The particles were decorated by a polyclonal antiserum raised against a Sudanese isolate of CVYV. To confirm CVYV identification, total RNA extracts (TRI-Reagent, Sigma Chemical, St. Louis, MO) were obtained from the original cucumber sample. Reverse transcription-polymerase chain reactions (RT-PCR) were carried out using CVYV-specific primers CVYV-CP-5′: 5′-GCTTCTGGTTCTCAAGTGGA-3′ and CVYV-CP-3′: 5′-GATGCATCAGTTGTCAGATG-3′ designed according to the partial sequence of the coat protein gene of CVYV-Isr (GenBank Accession No. AF233429) (2). A 540-bp fragment corresponding to the central region of CVYV coat protein was obtained from extracts of infected plants but not from healthy plant extracts. Additional watermelon (n = 6) and melon (n = 4) leaf samples collected from plants growing in the same farm were tested for the presence of CVYV using RT-PCR. All samples reacted positively for CVYV. However, a sample of Citrullus colocynthis, a wild relative of watermelon growing nearby, was negative. CVYV was not detected using RT-PCR in 123 additional cucurbit samples collected from the eastern and central regions of Iran during a survey conducted in 2002. To our knowledge, this is the first report of the occurrence of CVYV in Iran. Additional surveys in southern regions where Bemisia tabaci, the vector of CVYV, is abundant are required to better estimate the prevalence of this virus in cucurbit crops in Iran. References: (1) S. Cohen and F. E. Nitzany. Phytopathol. Mediterr. 1:44, 1960 (2) H. Lecoq et al. J. Gen. Virol. 81:2289, 2000.

Download Full-text

First report of Cnidium officinale as a natural host plant of Apple stem grooving virus in South Korea

Plant Disease ◽

10.1094/pdis-04-21-0781-pdn ◽

2021 ◽

Author(s):

Bong Nam Chung ◽

Sun-Jung Kwon ◽

Ju-Yeon Yoon ◽

In Sook Cho

Keyword(s):

South Korea ◽

Sanger Sequencing ◽

Likelihood Method ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Apple Stem Grooving Virus ◽

Apple Stem ◽

Cnidium Officinale ◽

Yellowing Virus

Cnidium officinale is a perennial plant in the family Apiaceae. It is native to China and cultivated in China, Japan, and Korea for its roots for medicinal purposes. In August 2019, 63 C. officinale plants showing symptoms of vein chlorosis, yellowing and chlorotic spots (Supplementary Fig. 1) were collected from commercial farms in Bonghwa and Youngyang, Gyeongsangbuk-do, South Korea. Reverse transcription and polymerase chain reaction (RT-PCR) was performed to confirm the presence of apple stem grooving virus (ASGV), cnidium vein yellowing virus 1, cnidium vein yellowing virus 2, lychnis mottle virus, and Cnidium virus X with specific primers (Supplementary Table 1). Forty-one out of the sixty-three samples were positive for ASGV in mixed infection with one or more of the other four viruses. Nicotiana benthamiana plants mechanically inoculated with the crude sap of one of the ASGV-infected C. officinale plants showed mosaic symptom on upper leaves 10 days post inoculation (dpi). Infection was confirmed by RT-PCR and Sanger sequencing. N. benthamiana plants systemically infected with ASGV-CO-kr1 isolate alone were used for subsequent sequencing and host range test. Twenty-day old seedlings of 23 species of plants (two to 14 species for each family) from the families Solanaceae, Chenopodiaceae, Cucurbitaceae, Fabaceae and Amaranthaceae (Supplementary Table 2) were mechanically inoculated with sap of ASGV-CO-kr1-infected N. benthamiana plants. ASGV-CO-kr1 infected all tested 23 species as confirmed by symptomology, RT-PCR, and Sanger sequencing at 10 to 20 dpi. The MP and CP genes of ASGV-CO-kr1 were amplified by RT-PCR with specific primers 4300-4325F/5642-5666R and 5592-5612F/6475-6499R, respectively (Supplementary Table 1). The amplicons were cloned and sequenced (GenBank accession numbers: MP = MW889883 and CP = MW889884). Multiple sequence alignment using the MegAlign program in DNASTAR showed that the complete CP and MP genes of ASGV-CO-kr1 shared 89.9%-99.7% and 83.1%-99.5% identities, respectively at the nucleotide (nt) level and they shared 92.4%-99.6% and 93.8%-99.4% identities, respectively at amino acid (aa) level with corresponding sequences of 34 other ASGV isolates from various host plants and countries. Phylogenetic analysis with the Maximum Likelihood method using the MEGA X program (Kumar et al., 2018) showed that ASGV-CO-kr1 grouped with isolates Cuiguan (KR185346), BH (LC480456), and YY (LC480457) based on the CP aa sequences, while it grouped with isolates SG (LC475148) and TL101 (MH108976) based on the MP aa sequences. ASGV is known to naturally infect apples, European pear, Asian pear, citrus, apricot, cherry, kiwifruit, loquat, lily, and lotus (Clover et al., 2003; He et al., 2019; Hu et al., 2017; Liu et al., 2017; Yanase et al., 1975). To the best of our knowledge, this is the first report of the natural infection of ASGV in C. officinale. C. officinale plants are propagated by root division, so they are susceptible to infection with viruses. The result of this study is important for generating virus-free seedlings to produce C. officinale.

Download Full-text

First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

Plant Disease ◽

10.1094/pdis-06-13-0668-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 698-698 ◽

Cited By ~ 1

Author(s):

Y. Tomitaka ◽

T. Usugi ◽

R. Kozuka ◽

S. Tsuda

Keyword(s):

Nucleotide Sequence ◽

Solanum Lycopersicum ◽

Mosaic Disease ◽

Causal Agent ◽

Cultivated Plants ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

Tomato Plants ◽

First Report

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

Download Full-text

First Report of Malva vein clearing virus Naturally Occurring in Hollyhock in Germany

Plant Disease ◽

10.1094/pdis-94-2-0276b ◽

2010 ◽

Vol 94 (2) ◽

pp. 276-276 ◽

Cited By ~ 5

Author(s):

W. Menzel ◽

S. Winter ◽

K. R. Richert-Pöggeler

Keyword(s):

Host Range ◽

Direct Sequencing ◽

Amino Acid Sequences ◽

Rt Pcr ◽

Electron Microscopic ◽

First Report ◽

Vein Clearing ◽

Naturally Occurring ◽

Potyvirus Species ◽

Cloned Cdna

Hollyhocks are popular garden plants and selected cultivars of Alcea rosea (family Malvaceae) are widespread in Germany. In spring 2009, dozens of A. rosea plants displaying strong vein clearing and veinal yellowing symptoms were found in private gardens in Hannover, Lower Saxony. Electron microscopic examinations of negatively stained adsorption preparations of five randomly selected samples of symptomatic plants or their offshoots revealed flexuous filamentous particles resembling those of potyviruses. Sap extracts also reacted strongly positive in an antigen coated plate (ACP)-ELISA with the broad-spectrum potyvirus antiserum AS-0573/I (DSMZ, Braunschweig, Germany). RNA extracts (RNeasy Kit, Qiagen, Valencia, CA) of the above mentioned leaf samples were used as templates in reverse transcription (RT)-PCR assays with potyvirus specific primers (2) that have been shown to amplify the 3′ terminus of the genome of many potyvirus species. For extracts from symptomatic samples, this resulted in a consistent amplification of an ~1.6-kbp fragment, whereas no products were obtained from RNA extracts of asymptomatic plants. From one positive sample, the amplified fragment was cloned and one clone was partially sequenced. The nucleotide (nt) and amino acid sequences showed the highest identities (81 to 83% and 87 to 90%, respectively) to GenBank sequences FJ539084, FM212972, EU884405, and FJ561293 of the potyvirus Malva vein clearing virus (MVCM). On the basis of these identity values and according to the species demarcation criteria in the genus Potyvirus, the virus can be regarded as a German isolate of the recently sequenced MVCV (3,4). Direct sequencing of the 5′-end of the amplified RT-PCR fragment revealed sequences of only one potyvirus species. The virus isolate has been submitted to the DSMZ Plant Virus Collection (Braunschweig, Germany) under accession PV-0963 and the sequence obtained from the cloned cDNA is deposited in GenBank (GQ856544). In addition, sap from affected leaves was mechanically inoculated onto sets of herbaceous indicator plants (Chenopodium quinoa, C. foliosum, C. murale, C. amaranticolor, Datura stramonium, Nicotiana benthamiana, N. hesperis, Petunia hybrida, and Solanum lycopersicum) of which only C. quinoa plants became infected. Symptoms of weak chlorosis along and beside veins of inoculated leaves, but not systemic leaves, became visible 2 weeks postinoculation. Symptomatic leaves contained flexuous filamentous particles and ACP-ELISA and RT-PCR confirmed virus presence. The partially sequenced amplicon showed 99% nt identity to the sequence from the cloned cDNA. To our knowledge, this is the first report of a MVCV isolate naturally occurring in A. rosea and C. quinoa is the first host identified that does not belong to the plant family Malvaceae. In contrast, the MVCV isolate used in the host range study of Lunello et al. (4) did not infect A. rosea and C. quinoa, confirming previous host range descriptions by Brunt et al. (1). Since MVCV infections of hollyhocks seem to cause only leaf symptoms and do not noticeably affect growth or flowering of the plants, this will hopefully not impair the usability of this popular garden plant. References: (1) A. A. Brunt et al. Descriptions and Lists from the VIDE Database. Online publication. Version: 16th January, 1997. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) A. Hein Phytopathol. Z. 28:205, 1957. (4) P. Lunello et al. Virus Res. 140:91, 2009.

Download Full-text

First Report of Beet necrotic yellow vein virus Infecting Spinach in California

Plant Disease ◽

10.1094/pdis-94-5-0640a ◽

2010 ◽

Vol 94 (5) ◽

pp. 640-640 ◽

Cited By ~ 4

Author(s):

H.-Y. Liu ◽

B. Mou ◽

K. Richardson ◽

S. T. Koike

Keyword(s):

Spinacia Oleracea ◽

Sandwich Elisa ◽

Chenopodium Quinoa ◽

Yellow Vein ◽

Mechanical Transmission ◽

Polymyxa Betae ◽

Rt Pcr ◽

First Report ◽

Vein Clearing ◽

Rigid Rod

In 2009, plants from two spinach (Spinacia oleracea) experimental fields in Monterey County and one commercial spinach field in Ventura County of California exhibited vein-clearing, mottling, interveinal yellowing, and stunting symptoms. For experimental fields, up to 44% of spinach plants have symptoms. With a transmission electron microscope, rigid rod-shaped particles with central canals were observed from plant sap of the symptomatic spinach. Analysis with a double-antibody sandwich-ELISA assay for Beet necrotic yellow vein virus (BNYVV) showed that all 10 symptomatic plants we tested were positive and 5 asymptomatic plants were negative. Symptomatic spinach from both counties was used for mechanical transmission experiments. Chenopodium quinoa, Tetragonia expansa, and Beta vulgaris (sugar beet) showed chlorotic local lesions and B. macrocarpa and spinach showed vein-clearing, mottling, and systemic infections. To further confirm the presence of BNYVV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from field- and mechanically inoculated symptomatic spinach plants using an RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR. Forward and reverse primers specific to the BNYVV RNA-3 P25 protein gene from the beet isolate were used (2). Amplicons of the expected size (approximately 860 bp) were obtained. Four RT-PCR products were sequenced and the sequences were identical (GenBank Accession No. GU135626). Sequences from the spinach plants had 97 to 99% nucleotide and 94 to 100% amino acid identity with BNYVV RNA-3 P25 protein sequences available in the GenBank. On the basis of the data from electron microscopy, indicator plants, serology, and cDNA sequencing, the virus was identified as BNYVV. BNYVV has been reported from spinach fields in Italy (1). To our knowledge, this is the first report of BNYVV occurring naturally on spinach in California. Since BNYVV is transmitted by the zoospores of the soil-inhabiting plasmodiophorid Polymyxa betae, it could be a new threat to spinach production in the state. References: (1) C. R. Autonell et al. Inf. Fitopatol. 45:43, 1995. (2) H.-Y. Liu and R. T. Lewellen, Plant Dis. 91:847, 2007.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato in Georgia

Plant Disease ◽

10.1094/pdis-02-11-0122 ◽

2011 ◽

Vol 95 (7) ◽

pp. 881-881 ◽

Cited By ~ 1

Author(s):

S. Sundaraj ◽

R. Srinivasan ◽

C. G. Webster ◽

S. Adkins ◽

K. Perry ◽

...

Keyword(s):

Nucleic Acid Hybridization ◽

N Gene ◽

Natural Occurrence ◽

Rt Pcr ◽

Specific Primers ◽

Tomato Production ◽

First Report ◽

Interveinal Chlorosis ◽

Cp Gene ◽

Tomato Chlorosis Virus

Tomato yellow leaf curl virus (TYLCV) and Tomato spotted wilt virus (TSWV) are prevalent in field-grown tomato (Solanum lycopersicum) production in Georgia. Typical TYLCV symptoms were observed during varietal trials in fall 2009 and 2010 to screen genotypes against TYLCV at the Coastal Plain Experiment Station, Tifton, GA. However, foliar symptoms atypical of TYLCV including interveinal chlorosis, purpling, brittleness, and mottling on upper and middle leaves and bronzing and intense interveinal chlorosis on lower leaves were also observed. Heavy whitefly (Bemisia tabaci (Gennadius), B biotype) infestation was also observed on all tomato genotypes. Preliminary tests (PCR and nucleic acid hybridization) in fall 2009 indicated the presence of TYLCV, TSWV, Cucumber mosaic virus, and Tomato chlorosis virus (ToCV); all with the exception of ToCV have been reported in Georgia. Sixteen additional symptomatic leaf samples were randomly collected in fall 2010 and the preliminary results from 2009 were used to guide testing. DNA and RNA were individually extracted using commercially available kits and used for PCR testing for ToCV, TYLCV, and TSWV. Reverse transcription (RT)-PCR with ToCV CP gene specific primers (4) produced approximately 750-bp amplicons from nine of the 16 leaf samples. Four of the nine CP gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 100.0% identical with each other (GenBank Accession Nos. HQ879840 to HQ879843). They were 99.3 to 99.5%, 97.2 to 97.5%, and 98.6 to 98.9% identical to ToCV CP sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. The presence of ToCV was confirmed by amplifying a portion of the HSP70h gene using the primers HSP-1F and HSP-1R (1). RT-PCR produced approximately 900-bp amplicons in the same nine samples. Four HSP70h gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 99.7% identical to each other (Accession Nos. HQ879844 to HQ879847). They were 99.2 to 99.5%, 98.0 to 98.4%, and 98.9 to 99.3% identical to HSP70h sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. TYLCV was also detected in all 16 samples by PCR using degenerate begomovirus primers PAL1v 1978 and PARIc 496 (3) followed by sequencing. TSWV was also detected in two of the ToCVinfected samples by RT-PCR with TSWV N gene specific primers (2) followed by sequencing. To our knowledge, this is the first report of the natural occurrence of ToCV in Georgia. Further studies are required to quantify the yield losses from ToCV alone and synergistic interactions between ToCV in combination with TSWV and/or TYLCV in tomato production in Georgia. References: (1) T. Hirota et al. J. Gen. Plant Pathol. 76:168, 2010. (2) R. K. Jain et al. Plant Dis. 82:900, 1998. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) L. Segev et al. Plant Dis. 88:1160, 2004.

Download Full-text

Squash vein yellowing virus Identified in Watermelon (Citrullus lanatus) in Indiana

Plant Disease ◽

10.1094/pdis-91-8-1056b ◽

2007 ◽

Vol 91 (8) ◽

pp. 1056-1056 ◽

Cited By ~ 17

Author(s):

D. S. Egel ◽

S. Adkins

Keyword(s):

Citrullus Lanatus ◽

Amino Acid Sequences ◽

Rt Pcr ◽

Strain Vector ◽

First Report ◽

Pcr Product ◽

Field Samples ◽

Health Progress ◽

Vine Decline ◽

Yellowing Virus

During September 2006, moderate vine decline symptoms including vine collapse and wilt and root rot were observed on numerous watermelon plants growing in a commercial field in Sullivan County, Indiana. No symptoms were observed on the fruit. Six plants displaying typical vine decline symptoms were collected and assayed for potyvirus infection and subsequently for Squash vein yellowing virus (SqVYV) and Papaya ringspot virus type W (PRSV-W). SqVYV is a whitefly-transmitted member of the Potyviridae, recently shown to cause watermelon vine decline in Florida (1,4). Plants infected with SqVYV in Florida are also frequently infected with PRSV-W, although SqVYV is sufficient for watermelon vine decline. The six field samples harbored one or more potyviruses as determined by ELISA (Agdia, Elkhart, IN). Mechanical inoculation of squash (Cucurbita pepo) and watermelon with sap from three of the field samples induced mosaic symptoms in both that are typical of potyviruses. Vein yellowing in squash and plant death in watermelon typical of SqVYV (1) later developed in plants inoculated with one field sample. A coat protein gene fragment was amplified by reverse transcription (RT)-PCR with SqVYV primers (1) from total RNA of five of the six field samples and also from the symptomatic, inoculated plants. Nucleotide and deduced amino acid sequences of a 957-bp region of the RT-PCR product (primer sequences deleted prior to analysis) were 100% identical to SqVYV (GenBank accession No. DQ812125). PRSV-W also was identified in two of the five SqVYV-infected field samples by ELISA (Agdia) and by sequence analysis of a 3′ genome fragment amplified by RT-PCR with previously described degenerate potyvirus primers (3). No evidence for infection by other potyviruses was obtained. To our knowledge, this is the first report of SqVYV in Indiana and the first report of the virus anywhere outside of Florida. The whitefly (Bemisia tabaci, B strain) vector of SqVYV is relatively uncommon in Indiana and the cold winter temperatures make it unlikely that any SqVYV-infected watermelon vines or whiteflies will overseason, necessitating reintroductions of virus and vector each season. We feel that the moderate and restricted occurrence of SqVYV in Indiana observed in September 2006 should pose little or no threat to commercial watermelon production in Indiana and should not cause growers to alter their growing practices. The occurrence of SqVYV in Indiana does not appear to explain the similar symptoms of mature watermelon vine decline (MWVD) that has been observed in Indiana since the 1980s. In contrast with the insect vectored SqVYV, MWVD seems to be caused by a soilborne biological agent (2). References: (1) S. Adkins et al. Phytopathology 97:145, 2007. (2) D. S. Egel et al. Online publication. doi:10.1094/PHP-2000-1227-01-HN. Plant Health Progress, 2000. (3) A. Gibbs and A. Mackenzie. J. Virol. Methods 63:9, 1997. (4) P. Roberts et al. Citrus Veg. Mag. December 12, 2004.

Download Full-text

First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽

10.1094/pdis-93-9-0970a ◽

2009 ◽

Vol 93 (9) ◽

pp. 970-970 ◽

Cited By ~ 4

Author(s):

R. M. Castro ◽

E. Hernandez ◽

F. Mora ◽

P. Ramirez ◽

R. W. Hammond

Keyword(s):

Costa Rica ◽

Sequence Analysis ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Download Full-text

First report of cucurbit chlorotic yellows virus infecting cucumber in South Korea

Plant Disease ◽

10.1094/pdis-10-20-2254-pdn ◽

2021 ◽

Author(s):

Hae-Ryun Kwak ◽

Hui-Seong Byun ◽

Hong-Soo Choi ◽

Jong-Woo Han ◽

Chang-Seok Kim ◽

...

Keyword(s):

Coat Protein ◽

South Korea ◽

East Asia ◽

Rna Extraction ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Chlorotic Mottle ◽

Cucurbit Chlorotic Yellows Virus

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

Download Full-text

First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain

Plant Disease ◽

10.1094/pdis-07-10-0491 ◽

2011 ◽

Vol 95 (1) ◽

pp. 75-75 ◽

Cited By ~ 4

Author(s):

A. Alfaro-Fernández ◽

C. Córdoba-Sellés ◽

T. Tornos ◽

M. C. Cebrián ◽

M. I. Font

Keyword(s):

Plant Viruses ◽

Dwarf Virus ◽

Eastern Coast ◽

Rt Pcr ◽

Pcr Assay ◽

Specific Primers ◽

First Report ◽

Type Isolate ◽

The Mean ◽

Pittosporum Tobira

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

Download Full-text