scholarly journals Phenotypically and Genotypically Heterogeneous Strains of Pseudomonas syringae Associated With Alfalfa Leaf Spot Disease in Iran

Plant Disease ◽  
2019 ◽  
Vol 103 (12) ◽  
pp. 3199-3208 ◽  
Author(s):  
Maryam Ansari ◽  
S. Mohsen Taghavi ◽  
Sadegh Zarei ◽  
Soraya Mehrb-Moghadam ◽  
Hamzeh Mafakheri ◽  
...  
Keyword(s):  
Host Range ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Phylogenetic Analyses ◽  
Housekeeping Genes ◽  
Pcr Primers ◽  
Phylogenetic Position ◽  
Leaf Spot Disease ◽  
Bacterial Strains ◽  
Alfalfa Leaf

In this study, we provide a polyphasic characterization of 18 Pseudomonas spp. strains associated with alfalfa leaf spot symptoms in Iran. All of the strains were pathogenic on alfalfa, although the aggressiveness and symptomology varied among the strains. All strains but one were pathogenic on broad bean, cucumber, honeydew, and zucchini, whereas only a fraction of the strains were pathogenic on sugar beet, tomato, and wheat. Syringomycin biosynthesis genes (syrB1 and syrP) were detected using the corresponding PCR primers in all of the strains isolated from alfalfa. Phylogenetic analyses using the sequences of four housekeeping genes (gapA, gltA, gyrB, and rpoD) revealed that all of the strains except one (Als34) belong to phylogroup 2b of P. syringae sensu lato, whereas strain Als34 placed within phylogroup 1 close to the type strain of P. syringae pv. apii. Among the phylogroup 2b strains, nine strains were phylogenetically close to the P. syringae pv. aptata clade, whereas the remainder were scattered among P. syringae pv. atrofaciens and P. syringae pv. syringae strains. Pathogenicity and host range assays of the bacterial strains evaluated in this study on a set of taxonomically diverse plant species did not allow us to assign a “pathovar” status to the alfalfa strains. However, these results provide novel insight into the host range and phylogenetic position of the alfalfa-pathogenic members of P. syringae sensu lato, and they reveal that phenotypically and genotypically heterogeneous strains of the pathogen cause bacterial leaf spot of alfalfa.

scholarly journals First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 418-418 ◽  
Author(s):  
M. Gupta ◽  
N. Bharat ◽  
A. Chauhan ◽  
A. Vikram
Keyword(s):  
Host Range ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Molecular Techniques ◽  
Bacterial Suspension ◽  
Leaf Spot Disease ◽  
Rrna Gene ◽  
First Report ◽  
Leaf Spots ◽  
Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

scholarly journals First Report of Pseudomonas syringae pv. aptata Causing Bacterial Leaf Spot on Sugar Beet in Serbia

Plant Disease ◽  
2015 ◽  
Vol 99 (2) ◽  
pp. 281-281 ◽  
Author(s):  
V. Stojšin ◽  
J. Balaž ◽  
D. Budakov ◽  
Slaviša Stanković ◽  
I. Nikolić ◽  
...  
Keyword(s):  
Sugar Beet ◽  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Leaf Surface ◽  
Negative Control ◽  
Gyrb Gene ◽  
Bacterial Suspension ◽  
Bacterial Strains ◽  
Gene Sequences ◽  
Bacterial Leaf Spot

A severe bacterial leaf spot was observed during June and July 2013 on commercial cultivars of sugar beet (Beta vulgaris var. saccharifera) in the Vojvodina Province of Serbia. Serbia is a major sugar beet production area in southeastern Europe, with 62,895 ha and 3 million tons of sugar beet yield in 2013. A foliar leaf spot observed in 25 commercial sugar beet fields surveyed ranged from 0.1 to 40% severity. Symptoms were characterized as circular or irregular, 5- to 20-mm diameter, white to light brown necrotic spots, each with a dark margin. Diseased leaves were rinsed in sterilized, distilled water (SDW) and dried at room temperature, and leaf sections taken from the margin of necrotic tissue were macerated in SDW. Isolations from 48 symptomatic leaves onto nutrient agar with 5% (w/v) sucrose (NAS) produced bacterial colonies that were whitish, circular, dome-shaped, and Levan-positive. Representative isolates (n = 105) were Gram negative; aerobic; positive for catalase, fluorescence on King's medium B, and tobacco hypersensitivity; and negative for oxidase, potato rot, and arginine dehydrolase. These reactions corresponded to LOPAT group Ia, which includes Pseudomonas syringae pathovars (2). Repetitive extragenic palindromic sequence (rep)-PCR was used for genetic fingerprinting the isolates using the REP, ERIC, and BOX primers. Twenty-five different profiles were obtained among the strains. From each profile group, one representative strain was sequenced for the gyrB gene (1). Four heterogenic groups were observed, and representative gyrB gene sequences of each group were deposited in the NCBI GenBank (Accession Nos. KJ950024 to KJ950027). The sequences were compared with those of pathotype strain P. syringae pv. aptata CFBP 1617 deposited in the PAMDB database; one strain was 100% homologous, and the other three were 99% homologous. To fulfill identification of the Serbian sugar beet isolates, gltA and rpoD partial gene sequences were determined (1), and the sequences were deposited as Accession Nos. KM386838 to KM386841 for gltA and KM386830 to KM38683033 for rpoD. The sequences were 100% homologous with those of pathotype strain CFBP 1617. Pathogenicity of each of four representative bacterial strains was tested on 3-week-old plants of the sugar beet cultivars Marinela, Serenada, and Jasmina (KWS, Belgrade, Serbia) and Lara (NS Seme, Novi Sad, Serbia) by atomizing a bacterial suspension of ~106 CFU/ml of the appropriate isolate onto the abaxial leaf surface of three plants per cultivar until water-soaking of the leaf surface was observed. Three plants of each cultivar atomized similarly with P. syringae pv. aptata CFBP 2473 and SDW served as positive and negative control treatments, respectively. Inoculated plants were kept in a clear plastic box at 80 to 100% RH and 17 ± 1°C and examined for symptom development over 3 weeks. For all test isolates and the control strain, inoculated leaves first developed water-soaked lesions 7 days after inoculation (DAI). By 10 to 14 DAI, lesions were necrotic and infection had spread to the petioles. By 21 DAI, wilting was observed on more than 50% of inoculated plants. Negative control plants were symptomless. Bacteria re-isolated onto NAS from inoculated leaves had the same colony morphology, LOPAT results, and gyrB partial gene sequences as described for the test strains. No bacteria were re-isolated from negative control plants. Based on these tests, the pathogen causing leaf spot on sugar beet in Serbia was identified as P. syringae pv. aptata. References: (1) P. Ferrente and M. Scortichini. Plant Pathol. 59:954, 2010. (2) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966.

scholarly journals First Report of Leaf Spot Disease Caused by Colletotrichum gloeosporioides on Chinese Bean Tree in China

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 138-138 ◽  
Author(s):  
B. Z. Fu ◽  
M. Yang ◽  
G. Y. Li ◽  
J. R. Wu ◽  
J. Z. Zhang ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Colletotrichum Gloeosporioides ◽  
Disease Incidence ◽  
Phylogenetic Analyses ◽  
Morphological Characteristics ◽  
Leaf Spot Disease ◽  
First Report ◽  
Spot Disease ◽  
Rdna Its ◽  
Its Sequence Analysis

Chinese bean tree, Catalpa fargesii f. duciouxii (Dode) Gilmour, is an ornamental arbor plant. Its roots, leaves, and flowers have long been used for medicinal purposes in China. During July 2010, severe outbreaks of leaf spot disease on this plant occurred in Kunming, Yunnan Province. The disease incidence was greater than 90%. The symptoms on leaves began as dark brown lesions surrounded by chlorotic halos, and later became larger, round or irregular spots with gray to off-white centers surrounded by dark brown margins. Leaf tissues (3 × 3 mm), cut from the margins of lesions, were surface disinfected in 0.1% HgCl2 solution for 3 min, rinsed three times in sterile water, plated on potato dextrose agar (PDA), and incubated at 28°C. The same fungus was consistently isolated from the diseased leaves. Colonies of white-to-dark gray mycelia formed on PDA, and were slightly brown on the underside of the colony. The hyphae were achromatic, branching, septate, and 4.59 (±1.38) μm in diameter on average. Perithecia were brown to black, globose in shape, and 275.9 to 379.3 × 245.3 to 344.8 μm. Asci that formed after 3 to 4 weeks in culture were eight-spored, clavate to cylindrical. The ascospores were fusiform, slightly curved, unicellular and hyaline, and 13.05 to 24.03 × 10.68 to 16.02 μm. PCR amplification was carried out by utilizing universal rDNA-ITS primer pair ITS4/ITS5 (2). Sequencing of the PCR products of DQ1 (GenBank Accession No. JN165746) revealed 99% similarity (100% coverage) with Colletotrichum gloeosporioides isolates (GenBank Accession No. FJ456938.1, No. EU326190.1, No. DQ682572.1, and No. AY423474.1). Phylogenetic analyses (MEGA 4.1) using the neighbor-joining (NJ) algorithm placed the isolate in a well-supported cluster (>90% bootstrap value based on 1,000 replicates) with other C. gloeosporioides isolates. The pathogen was identified as C. gloeosporioides (Penz.) Penz. & Sacc. (teleomorph Glomerella cingulata (Stoneman) Spauld & H. Schrenk) based on the morphological characteristics and rDNA-ITS sequence analysis (1). To confirm pathogenicity, Koch's postulates were performed on detached leaves of C. fargesii f. duciouxii, inoculated with a solution of 1.0 × 106 conidia per ml. Symptoms similar to the original ones started to appear after 10 days, while untreated leaves remained healthy. The inoculation assay used three leaves for untreated and six leaves for treated. The experiments were repeated once. C. gloeosporioides was consistently reisolated from the diseased tissue. C. gloeosporioides is distributed worldwide causing anthracnose on a wide variety of plants (3). To the best of our knowledge, this is the first report of C. gloeosporioides causing leaf spots on C. fargesii f. duciouxii in China. References: (1) B. C. Sutton. Page 1 in: Colletotrichum: Biology, Pathology and Control. CAB International. Wallingford, UK, 1992. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (3) J. Yan et al. Plant Dis. 95:880, 2011.

scholarly journals Bradyrhizobia isolated from root nodules of Parasponia (Ulmaceae) do not constitute a separate coherent lineage

2006 ◽  
Vol 56 (5) ◽  
pp. 1013-1018 ◽  
Author(s):  
Bénédicte Lafay ◽  
Erika Bullier ◽  
Jeremy J. Burdon
Keyword(s):  
16S Rrna ◽  
Host Range ◽  
Root Nodules ◽  
Phylogenetic Analyses ◽  
Rrna Gene ◽  
Bacterial Strains ◽  
Gene Sequences ◽  
Host Switch ◽  
Cultural Types ◽  
The Relationship

Rhizobial bacteria almost exclusively nodulate members of the families Fabaceae, Mimosaceae and Caesalpiniaceae, but are found on a single non-legume taxon, Parasponia (Ulmaceae). Based on their host-range, their nitrogen-fixing ability and strain competition experiments, bacterial strains isolated from Parasponia were thought to constitute a separate lineage that would account for their exceptional host affinity. This hypothesis was investigated by focusing on four isolates that are representative of the morphological and cultural types of Parasponia-nodulating bradyrhizobia. Their evolutionary relationships with other rhizobia were analysed using 16S rRNA gene sequences and their nodulation properties were explored using the nodA gene as a proxy for host-range specificity. Phylogenetic analyses of the 16S rRNA and nodA gene sequences revealed that bacterial isolates from Parasponia species are embedded among other bradyrhizobia. They did not cluster together in topologies based on the 16S rRNA or nodA gene sequences, but were scattered among other bradyrhizobia belonging to either the Bradyrhizobium japonicum or the Bradyrhizobium elkanii lineages. These data suggest that the ability of some bradyrhizobia to nodulate species of the genus Parasponia does not represent a historical relationship that predates the relationship between rhizobia and legumes, but is probably a more recent host switch for some rhizobia.

scholarly journals Multilocus Sequence Typing and Phylogenetic Analyses of Pseudomonas aeruginosa Isolates from the Ocean

2008 ◽  
Vol 74 (20) ◽  
pp. 6194-6205 ◽  
Author(s):  
Nurul Huda Khan ◽  
Mahbuba Ahsan ◽  
Susumu Yoshizawa ◽  
Shoichi Hosoya ◽  
Akira Yokota ◽  
...  
Keyword(s):  
Pseudomonas Aeruginosa ◽  
Multilocus Sequence Typing ◽  
Phylogenetic Trees ◽  
Phylogenetic Analyses ◽  
Housekeeping Genes ◽  
Phylogenetic Position ◽  
Microb Ecol ◽  
Distinct Cluster ◽  
Unique Genotype ◽  
Geographical Locations

ABSTRACT Recent isolation of Pseudomonas aeruginosa strains from the open ocean and subsequent pulsed-field gel electrophoresis analyses indicate that these strains have a unique genotype (N. H. Khan, Y. Ishii, N. Kimata-Kino, H. Esaki, T. Nishino, M. Nishimura, and K. Kogure, Microb. Ecol. 53:173-186, 2007). We hypothesized that ocean P. aeruginosa strains have a unique phylogenetic position relative to other strains. The objective of this study was to clarify the intraspecies phylogenetic relationship between marine strains and other strains from various geographical locations. Considering the advantages of using databases, multilocus sequence typing (MLST) was chosen for the typing and discrimination of ocean P. aeruginosa strains. Seven housekeeping genes (acsA, aroE, guaA, mutL, nuoD, ppsA, and trpE) were analyzed, and the results were compared with data on the MLST website. These genes were also used for phylogenetic analysis of P. aeruginosa. Rooted and unrooted phylogenetic trees were generated for each gene locus and the concatenated gene fragments. MLST data showed that all the ocean strains were new. Trees constructed for individual and concatenated genes revealed that ocean P. aeruginosa strains have clusters distinct from those of other P. aeruginosa strains. These clusters roughly reflected the geographical locations of the isolates. These data support our previous findings that P. aeruginosa strains are present in the ocean. It can be concluded that the ocean P. aeruginosa strains have diverged from other isolates and form a distinct cluster based on MLST and phylogenetic analyses of seven housekeeping genes.

scholarly journals Morphology and Molecular Characteristics of Alternaria sonchi Causing Brown Leaf Spot on Sonchus asper in Korea

2021 ◽  
Vol 27 (3) ◽  
pp. 107-114
Author(s):  
Huan Luo ◽  
Myung Soo Park ◽  
Jun Myoung Yu
Keyword(s):  
Rna Polymerase Ii ◽  
Leaf Spot ◽  
Phylogenetic Analyses ◽  
Morphological Characteristics ◽  
Leaf Spot Disease ◽  
Molecular Characteristics ◽  
Internal Transcribed Spacer Region ◽  
Sonchus Asper ◽  
Brown Leaf Spot ◽  
Brown Leaf

During a disease survey on weeds and minor cultivated crops in Korea, a brown leaf spot disease was observed on Sonchus asper. Leaf lesions were round or irregular in shape, and grayish brown to brown with a purple margin. In severe infection, lesions enlarged and coalesced, resulting in blighting of the leaves. The isolates from these leaf lesions were identified as Alternaira sonchi based on morphological characteristics and phylogenetic analyses of Internal transcribed spacer region, Alternaria allergen a1, glyceraldehyde 3-phosphate dehydrogenase, RNA polymerase II, and translation elongation factor genes. This study provides a comprehensive description of the morphological characteristics and phylogenetical traits of A. sonchi causing brown leaf spot on S. asper in Korea.

scholarly journals Testing of different methods for identification of bacterial leaf spot (Siringae pv. maculicola (Mcculloch) Young et al.) plant pathogen in cauliflower leaves

2021 ◽  
Vol 1 (25) ◽  
pp. 174-186
Author(s):  
S.I. Prikhodko ◽  
◽  
A.B. Yaremko ◽  
K.P. Kornev ◽  
◽  
...  
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Biochemical Properties ◽  
Analytical Sensitivity ◽  
Bacterial Strains ◽  
Bacterial Leaf Spot ◽  
Plant Quarantine ◽  
Test Kit ◽  
Russian Plant

Pseudomonas syringae pv. maculicola (McCulloch) Young et al. is a pathogen of cauliflower bacterial spot that affects many plants of the Cruciferae family. The need for quality diagnostics of this species arose due to the mandatory phytosanitary inspection of places of production of plant products intended for export. Our research aims at determining a set of methods for the diagnosis of the pathogen of cauliflower bacterial leaf spot and evaluating these methods’ applicability in laboratory practice. The object of the research is P. syringae pv. maculicola – the causative agent of cauliflower bacterial leaf spot.The article presents the test results of two methods for the identification of Pseudomonas syringae pv. maculicola (McCulloch) Young et al. carried out in 2020 at the All-Russian Plant Quarantine Center (VNIIKR). The first method is based on the determination of biochemical properties using the API 20E test kit produced by bioMérieux’s (France); the second one – is a conventional PCR. The type bacterial strain CFBP 1657 obtained by specialists of the All-Russian Plant Quarantine Center (VNIIKR) from French collection of plant-associated bacteria (Cirm-CFBP) was used in the studies. A comparison of the biochemical properties of 23 bacteria of the genus Pseudomonas showed that there are only two characteristics within this test that distinguish P. s. pv. maculicola from other species pathovars: acetoin products and gelatin hydrolysis. Two pairs of primers with different targets in the P. syringae genome were also tested. PCR with PsyF/PsyR primers demonstrated the highest similarity of the obtained fragments with the NCBI database (97.2 %). The analytical sensitivity of PCR with PsyF/PsyR primers in plant and seed extracts was 105 CFU/ml. Determination of analytical specificity with 33 bacterial strains of the genus Pseudomonas revealed cross-reactions with strains of the following species: P. congelans, P. savastanoi pv. phaseolicola, P. savastanoi pv. glycinea, P. syringae pv. coronafaciens, P. syringae pv. syringae. Thus, to differentiate the species by means of PCR with PsyF/PsyR primers, the nucleotide sequence of the obtained amplification products should be additionally determined by Sanger sequencing.

scholarly journals First Report of a Leaf Spot Disease of Tobacco Caused by Pseudomonas cichorii in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Dayu Lan ◽  
Fangling Shu ◽  
Yanhui Lu ◽  
Anfa Shou ◽  
Wei Lin ◽  
...  
Keyword(s):  
Pseudomonas Syringae ◽  
Leaf Spot ◽  
Leaf Spot Disease ◽  
Pathogenicity Test ◽  
Pseudomonas Cichorii ◽  
Koch’S Postulates ◽  
First Report ◽  
Initial Symptoms ◽  
Wide Range ◽  
Koch's Postulates

Tobacco (Nicotiana tabacum L.), one of the chief commercial crops, is wildly cultivated worldwide. In June 2020 and 2021, an unknown bacterial leaf spot on tobacco was found in Hezhou and Hechi City, Guangxi, China. 30% of the tobacco were affected and the rate of diseased leaves reached about 10% in the field under high temperature and rainstorm. The disease mainly damaged the middle and top leaves of tobacco plants at vigorous growing stage. The initial symptoms were water-soaked spots on the frontal half of a leaf, and then expanded into circular to irregular spots with a yellow halo at the edge. The spots mostly appeared dark brown at high air humidity, while yellow brown at low humidity and exhibited a concentric pattern. In severe cases, the lesions coalesced and the whole leaf was densely covered with lesions, resulting in the loss of baking value. A bacterium was consistently isolated from diseased leaf tissues on nutrient agar (NA). Growth on NA was predominantly grayish white circular bacterial colonies with smooth margins, and the bacterium is rod-shaped, gram-negative and fluorescent on King’s B medium. Seven isolates (ND04A-ND04C and ZSXF02-ZSXF05) were selected for molecular identification and pathogenicity tests. Genomic DNA of the bacterium was extracted and the housekeeping gene of cts (encoding citrate synthase) was amplified with the primers cts-Fs/cts-Rs (forward primer cts-Fs: 5’-CCCGTCGAGCTGCCAATWCTGA-3’; reverse primer cts-Rs: 5’-ATCTCGCACGGSGTRTTGAACATC-3’) (Berge et al. 2014; Sarkar et al. 2004). 409-bp cts gene sequences were deposited in the GenBank database for seven isolates (accession no. OK105110-OK105116). Sequence of seven isolates shared 100% identity with several Pseudomonas cichorii strains within the GenBank database (accession no. KY940268 and KY940271), and the phylogenetic tree of cts genes of the seven isolates clustered with the phylogroup 11 of Pseudomonas syringae (accession no. KJ877799 and KJ878111), which was classified as P.cichorii. To satisfy Koch’s postulates, a pathogenicity test was tested by using a needle to dip a suspension of the bacterium (108 CFU/ml) and pricking three holes in the tobacco leaf. The control plants leaves were needled with sterile water. Each tobacco plant was inoculated with three leaves, and the test was repeated three times. All plants were placed in transparent plastic boxes and incubated in a greenhouse at 25 ± 3°C. The water-soaked spots appeared 24h after inoculation and quickly expanded through leaf veins. Three days after inoculation, all the inoculated leaves showed symptoms similar to those observed in the field. Control plants remained healthy. Only P. cichorii was successfully re-isolated from the lesions, confirming Koch’s postulates. Pseudomonas cichorii can infect eggplant, lettuce, tomatoand other crops, and has a wide range of hosts (Timilsina et al. 2017; Ullah et al. 2015). To our knowledge, this is the first report of P. cichorii causing leaf spot on tobacco in China.

scholarly journals Identification of Resistance to Peppery Leaf Spot among Brassica juncea and Brassica rapa Plant Introductions

HortScience ◽  
2007 ◽  
Vol 42 (5) ◽  
pp. 1140-1143 ◽  
Author(s):  
W. Patrick Wechter ◽  
Mark W. Farnham ◽  
J. Powell Smith ◽  
Anthony P. Keinath
Keyword(s):  
Brassica Juncea ◽  
Pseudomonas Syringae ◽  
Brassica Rapa ◽  
Leaf Spot ◽  
Plant Introduction ◽  
Leafy Vegetables ◽  
Leaf Spot Disease ◽  
Disease Symptoms ◽  
Plant Introductions ◽  
Leafy Greens

Brassica leafy greens (Brassica juncea L. and Brassica rapa L.) represent one of the most economically important vegetable crop groups in the southeastern United States. In the last 10 years, numerous occurrences of a leaf-spot disease on these leafy vegetables have been reported in several states. This disease, known as peppery leaf spot, is now causing serious crop losses and has been attributed to the bacterial phytopathogen Pseudomonas syringae pv. maculicola (Psm). To date, it appears that all cultivars of the Brassica leafy greens are susceptible, and available pesticides for control of this disease appear unable to reduce the disease to acceptable levels. Thus, we undertook a search for potential resistance to this disease among accessions of B. juncea and B. rapa included in the U.S. Plant Introduction (PI) collection. In greenhouse trials, we screened commercial cultivars and 672 U.S. PIs (226 B. juncea and 446 B. rapa) for resistance to Psm with artificial inoculation. Although severity of disease symptoms was significantly different among inoculated accessions, no acceptable levels of resistance were found in any of the more than 400 B. rapa accessions tested. Only two B. juncea accessions (PI 195553 and G 30988) of 226 tested had acceptable levels of resistance that might prove economically useful.

Sign in / Sign up

Export Citation Format

Share Document