scholarly journals First Report of Meloidogyne incognita on Cardamine Violifohia in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Rui Liu ◽  
Hongqing Yin ◽  
Lin Li ◽  
Kaiwei Huang ◽  
Huixia Li ◽  
...  
Keyword(s):  
Body Length ◽  
Meloidogyne Incognita ◽  
Uv Light ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Economic Losses ◽  
Egg Masses ◽  
First Report ◽  
Stylet Length

Cardamine violifohia is an economically-important medicinal plant, and also a valuable plant for strong ability to accumulate selenium (Se) (Ebba et al. 2020). It is not only be used to extract selenium protein and selenium polysaccharide, but also widely used to develop selenium-supplement reagent. In September 2020, root-knot nematodes (RKN; Meloidogyne spp.) infection experiments showed that galls and egg masses were observed on the roots of numerous C. violifolia plants in Enshi (30°32′25.67″ N; 109°48′48.46″ E), Hubei Province, China. Meanwhile, the overground plants of C. violifohia were stunted and leaves were yellow. Almost 5% C. violifohia plants were affected by the disease. The roots with galls were collected, and nematodes were dissected and extracted (Fig. S1). Based on phytopathological clinic, the number of galls on each plant was 91.87 ± 19.01, and egg masses was 15.27 ± 5.36 (n = 15). Nematodes and galls were collected from soil and infected roots (Barker 1985). The morphological diagnostic of the nematode species was measured as follows. Measurements of adult females (n=20), body length = 628.15 ± 73.69 μm, width = 356.77 ± 36.72 μm, stylet length = 15.58 ±0.93 μm. Meanwhile, a high and trapezoidal dorsal arch with thick striations was observed in the perineal region of females. Second-stage juveniles (J2s) (n=20): body length = 377.09 ± 18.19 μm, body width = 15.64 ± 1.24 μm, stylet length = 13.31 ± 1.04 μm, tail length = 42.49 ± 4.64 μm, hyaline tail terminus = 12.35 ± 2.02 μm and presented well developed esophageal glands. Eggs (n=20): length = 80.81 ± 3.47 μm, and width = 37.09 ± 2.98 μm. All the morphological characteristics of the identified species were consistent with the descriptions of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 (Whitehead, 1968). Molecular identification was carried out by PCR with the M. incognita-specific primers Mi-F/Mi-R (Meng et al. 2004) and 28S rDNA D2/D3 region primers MF/MR (Hu et al. 2011). The target fragments of 955 bp and 478 bp amplified by of the primer pairs Mi-F/Mi-R and MF/MR were observed under a UV light, which confirmed that these nematodes collected from C. violifohia were M. incognita (Fig. S2). Fragments were, sequenced (MZ596342 and MZ566843, respectively) and aligned with available sequences on NCBI, which were 100% identical to the MK410954, MN728679, and MK410953, MF177882 M. incognita sequences, respectively. Pathogenicity testing was conducted to perform Koch’s postulates in a greenhouse by inoculation of 500 J2s from the original population into C. violifohia seedlings (n = 30, 5-6 leaves stage). After 7 weeks, all inoculated plants exhibited the same symptoms that observed in the field initially. Different life stages of M. incognita were observed in dissected galled tissues. The average reproductive factor was 37.30 ± 6.13, which is considered as the pathogenicity of M. incognita to C. violifohia. Therefore, C. violifohia is a suitable host for M. incognita in China. The growers should be informed of the current findings to avoid serious economic losses that might be caused by this pathogenic nematode, and prepare for proper management action. To our knowledge, this is the first report of M. incognita infecting C. violifohia in China.

scholarly journals First Report of Leipotylenchus abulbosus in Iran

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 882-882
Author(s):  
M. Mirzaee-Qomi ◽  
F. Khozeini ◽  
S. Barooti ◽  
S. Rezaee
Keyword(s):  
Body Length ◽  
Sandy Loam ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Crop Plants ◽  
The Body ◽  
Posterior Portion ◽  
First Report ◽  
Pure Cultures ◽  
Stylet Length

Leipotylenchus abulbosus (Thorne, 1949) Sher, 1974 belongs to the family Tylenchidae, subfamily Leipotylenchinae, and order Tylenchida. During the spring and autumn months of 2008 to 2010, 80 samples were collected from rhizosphere soil of symptomatic plants including wheat (Tritichum aestivum L.), beet (Beta vulgaris L.), and maize (Zea mays L.) from Meighan and Gavar regions of Markazi Province in central Iran. Plants were dwarfed and leaves were chlorotic. Diseased plants comprised ~7% of all plants in the field. Sandy loam soil was collected from roots up to 15 cm from the base of the plants. Nematodes were extracted from the soil by sieving and centrifugation (3). For species identification, nematodes were transferred to anhydrous glycerin (2) and mounted on slides by the paraffin ring method. Identification was based on morphometric and morphological characteristics of females and males. No other forms of the nematode were isolated from collected samples. L. abulbosus was found in 10% of the collected samples. The nematodes showed typical characteristics of the genus Leipotylenchus: striated and anteriorly flattened lip region, stylet without basal knobs, didelphic gonads, four incisures in lateral fields that were areolated in the posterior portion, presence of deirids and adanal caudal alae, amphid inconspicuous in males. Males contained bursa in tail. Females contained an almost straight body, tapering anteriorly from median bulb and posteriorly beyond the anus; cuticle thick, annules fine. Labial framework was moderately sclerotized. Median bulb with prominent valvular apparatus in the center, oval, occupied two-thirds of the body. Deirids were prominent and at the level of the excretory pore. Vagina a transverse slit at right angles to body axis, extending less than half width into body. Tai1 finely annulated, short, tapering to a narrow tip but becoming broader just before the terminus. Phasmids small in anterior half of the tail. Measurements of 12 females: body length = 1,377 ± 90 (1,276 to 1,469) μm; a = 39.2 ± 1.62 (36.8 to 41.1); b = 7.2 ± 0.34 (6.6 to 8.30); c = 11.1 ± 0.16 (10.7 to 11.3); V% = 52.6 ± 1.42 (50.4 to 53.8); stylet length = 17 ± 0.22 (16.6 to 18) μm; tail length = 124 ± 6.83 (116 to 137) μm); and 7 males: (body length = 1,150 ± 56.84 (1,090 to 1,246) μm; a = 39.5 ± 1.48 (37.5 to 41.5); b = 6.4 ± 0.21 (6.1 to 6.8); c = 9.5 ± 0.06 (9.4 to 9.6); T% = 55.1 ± 0.91 (54.4 to 56.20); stylet length = 17.6 ± 0.36 (17 to 18) μm; tail length = 120 ± 3.77 (115 to 129) μm) conformed to the description of L. abulbosus. L. abulbosus, originally isolated from crop plants in surveyed regions, was cultured on beet (B. vulgaris L.) in the greenhouse. Pure cultures of the nematode were inoculated on beet seedlings at the 4- to 6-leaf stage as described previously (1). Sterilized soils were inoculated with 1,000 infective mature nematodes with three replications. Infection of beet roots by the nematode resulted in leaf chlorosis and reduction in plant height. Previously, L. amiri was collected from soils associated with the roots of onion (Allium cepa L.) plants in Pakistan (4). However there have not been any reports of L. abulbosus in crop plants before. To our knowledge, this is also the first report of L. abulbosus infecting wheat, beet, and maize plants in Iran. References: (1) K. R. Barker. Methodology 2:19, 1985. (2) A. De Grisse. Meded. Rijksfac. Landbouwwet. Gent. 34:351, 1969. (3) W. R. Jenkins. Plant Dis. Rep. 48:692, 1964. (4) M. A. Maqbool and F. Shahina. Rev. Nèmatol. 7:363, 1984.

scholarly journals First Report of Meloidogyne incognita on Mulberry in Saudi Arabia

Plant Disease ◽  
2021 ◽  
Author(s):  
Hamzeh Lafi ◽  
Fahad Al-Yahya ◽  
Ahmad Al Hazmi
Keyword(s):  
Saudi Arabia ◽  
Body Length ◽  
Meloidogyne Incognita ◽  
Tail Length ◽  
Total Body Length ◽  
Morus Alba ◽  
Body Width ◽  
First Report ◽  
Stylet Length ◽  
Total Body

The genus Morus comprises many species (Suttie 2012). The species Morus alba is one of the most popular mulberry species worldwide. In October 2020, numerous mulberry trees presented chlorotic leaves and stunted growth with severe root galling in a private compound in Riyadh region, Saudi Arabia. The infected roots showed galls, which are typical symptoms of infection by root-knot nematodes (RKNs). Infected roots were dissected, and males and females were extracted from roots while second stage juveniles (J2s) were from both soil and eggmasses. Morphological and morphometrical features were documented. Perineal patterns of females, males, and J2s were studied using a compound microscope. The endoparasitic females had pearly shaped bodies with projecting neck. Stylet knobs were rounded and set off and the shape of the cone distinctly curved. The posterior perineal had a dorsally high square arch. Striae patterns were zig-zag or forked along the lateral lines. Males were vermiform and the head cap flat to concave. Mostly conus of stylet was longer than shaft. Stylet knobs were prominent, set off, flat and usually greater width than the length. Males had a bluntly rounded tail, spicules were slightly curved and gubernaculum was crescentic. The J2s were vermiform, and stylet knobs were prominent and rounded shape. The J2s tail had a transparent area with an obtuse tip. The morphological measurements (means and range) of the perineal patterns of females (n = 4) were: length of vulval slit (LVS) = 22.5 (21.5 to 23.4) μm, anus to vulval slit (AVS) = 22 (21.8 to 22.1) μm, and anus length (AL) = 7.7 (7.5 to 7.8) μm. The males (n = 16) measurements were: length (L) = 1136 (1116 to 1159) μm; a (total body length / greatest body width) = 34.8 (33 to 37.1); body width = 32.7 (31.2 to 33.8) μm; stylet length = 25.6 (24.7 to 27.3) μm; dorsal oesophageal gland orifice (DGO) = 2.9 (2.6 to 3) μm, tail length = 7.1 (6.5 to 7.8) μm, c (total body length / tail length) = 161 (143.1 to 175), spicules length = 30.8 (26 to 33.8) μm; gubernaculum = 9.7 (9.1 to 10.4) μm. The J2s (n = 11) measurements were: L = 395 (378 to 405) μm; a = 26.2 (24.3 to 28.4); c = 8.6 (8.2 to 9.2); head end to metacorpus valve = 53 (49.4 to 54.6) μm; excretory pore to head end = 78 (72.8 to 80) μm, stylet length = 10.7 (10.4 to 11.7) μm; body width = 15.1 (14.3 to 15.6) μm; tail length = 45.8 (44.2 to 49.4) μm; hyaline tail terminus length = 12.5 (10.4 to 13) μm. Both the morphological and morphometrical features of the perineal pattern of the females, males, and J2s match the original description of Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Eisenback and Hirschmann 1981; Taylor and Netscher 1974). To perform Koch’s postulates, mulberry plants maintained in pots were inoculated with 2,500 J2s and eggs of the original population of M. incognita using five replicates. After two months, all inoculated plants had galled roots typical of RKNs. Reproduction factor value was 6.4. The noninoculated plants did not present galls in the roots. These results confirmed the nematode’s pathogenicity on mulberry. To the best of our knowledge, this is the first report that M. incognita was identified as a parasite of mulberry (Morus alba) in Saudi Arabia and the world, while Meloidogyne hispanica was reported on mulberry trees in Iran (Shokoohi et al. 2016). The importance of this report shed some lights on this new problem to direct the attention of farmers and home gardeners to take actions for the management of this newly identified problem. The authors declare no conflict of interest. Acknowledgments Authors wish to thanks College of Food and Agricultural Sciences, Research Center and Deanship of Scientific Research, King Saud University, Saudi Arabia for supporting this work. References: Eisenback, J. D. and Hirschmann, H. 1981. J. Nematol. 13:513. Shokoohi, E. et al. 2016. Australasian Plant Dis. Notes 11:16. Suttie, J. M. 2012. Food and Agricultural Organization of the United Nations. Taylor D. P., Netscher, C. 1974. Nematologica 20:268.

scholarly journals First Report of Subanguina moxae Infecting Mugwort in Yunnan, China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1232-1232 ◽  
Author(s):  
R. Y. Yao ◽  
X. Q. Hu ◽  
J. P. Xue
Keyword(s):  
Body Length ◽  
Tail Length ◽  
Total Body Length ◽  
Guizhou Province ◽  
Universal Primers ◽  
Parasitic Nematodes ◽  
Its Sequence ◽  
First Report ◽  
Stylet Length ◽  
Total Body

Mugwort is a perennial in the Compositae family distributed throughout Asia and Europe. The leaves are reported to have various pharmaceutical properties, e.g., antibacterial, antiviral, antitussive, and hemostatic properties, and have been used in traditional Chinese medicine for more than 2,000 years. In August 2011, a field of mugwort in Kunming, Yunnan Province, China, exhibited more than 90% incidence of whitish and rounded galls on the leaves. There were approximately 10 galls on each leaf, impacting the quality of the leaves for medicinal use. Parasitic nematodes were found upon dissection of the galls, then eggs, second-stage juveniles (J2), and mature males and females were observed. Through the morphologic observation of juveniles and female and male adults, the parasitic nematode was identified as Subanguina moxae (Yokoo and Choi, 1968) Brzeski, 1981 (3). Key morphological features are as follows: eggs (n = 20) measured 54.0 to 71.4 × 24.1 to 30.0 μm; J2 (n = 20) had the following characteristics: body length 689.3 to 873.2 μm (x = 775.5 μm); stylet length 8.2 to 9.8 μm (x = 8.8 μm); tail length 49.5 to 74.5 μm (x = 60.1 μm); a (total body length/maximum body width) ranged from 28.6 to 38.6 μm (x = 34.1 μm); and c (total body length/the length of the tail) ranged from 11.2 to 16.0 μm (x = 13.0 μm). Females (n = 20) had the following characteristics: body length 1,252.8 to 1,665.2 μm (x = 1,475.7 μm); stylet length 7.2 to 9.2 μm (x = 8.2 μm); V of 88.0 to 92.3 μm (x = 89.6 μm); a ranged from 17.6 to 24.5 μm (x = 21.3 μm); and c ranged from 20.2 to 28.9 μm (x = 22.8 μm). Males (n = 20) had the following characteristics: body length 994.2 to 1,453.6 μm (x = 1,253.2 μm); stylet length 7.5 to 9.9 μm (x= 9.1 μm); tail length 69.2 to 88.1 μm (x = 78.0 μm); spicule length 22.2 to 33.4 μm (x = 29.4 μm); gubernaculum length 10.4 to 14.2 μm (x = 12.2 μm); a ranged from 23.1 to 37.2 μm (x = 29.9 μm); and c ranged from 13.9 to 18.7 μm (x = 16.1 μm). Amplification of the rDNA-internal transcribed spacer (ITS) region and the D2/D3 (1) fragments of the 28S RNA with universal primers rDNA1/rDNA2 and D2A/D3B yielded PCR fragments of 934 bp and 754 bp, respectively. The ITS sequence (JN865234) and D2D3 sequence (JN885540) were submitted to GenBank. The ITS sequence (JN865234) exhibited 99.4% similarity with Mesoanguina moxae (AF396314) (synonym of S. moxae) (4). S. moxae has been identified from the common mugwort in Japan (2) and in China, was reported to infect wheat in Guizhou Province, but to our knowledge, this is the first report of this nematode affecting mugwort in Yunnan, China. References: (1) S. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) K. Daigo et al. Bull. School Agric. Meiji University. 56:237, 2007. (3) M. R. Siddiqi. Tylenchida: Parasites of Plants and Insects. CABI Publishing, New York, 2000. (4) S. A. Subbotin et al. Mol. Phylogenet. Evol. 30:226, 2004.

scholarly journals First report of Meloidogyne hapla infecting Yunmuxiang (Aucklandia lappa) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Wentao Wu ◽  
Zewen Gao ◽  
Shaofang Zhou ◽  
Hong Li ◽  
Ying Dong ◽  
...  
Keyword(s):  
Body Length ◽  
Morphological Characteristics ◽  
Herbaceous Plant ◽  
Pathogenicity Test ◽  
Meloidogyne Hapla ◽  
Medicinal Uses ◽  
First Report ◽  
Second Stage ◽  
Stylet Length ◽  
Species Specific

Yunmuxiang (Aucklandia lappa) is a tall, perennial herbaceous plant in the compositae family, occurring mainly in Asia and Europe. Yunmuxiang originated in India and was introduced into China in approximately 1940. Since then it has been widely cultivated in the southwest region of China for medicinal uses; it is included in the Chinese Pharmacopoeia. Yunmuxiang is used primarily as a sedative, including for anesthesia (Ting et al. 2012). Severely stunted and withered Yunmuxiang plants with rotted and galled roots were observed in a field in near the city of Lijiang (N 99°46′; E 27°18′) in October 2019. These symptoms were typical of infection by root-knot nematodes.The second-stage juveniles (J2) were collected from the soil in the root zone, and adult females were dissected from roots. Population densities of J2 ranged from 325 to 645 per 100 cm3. Morphological analysis and species-specific PCR were performed on the second stage (J2) and females. Morphological characteristics are as follows: for J2 (n=20) , body length = 360.5 ± 23.4 µm, tail length = 47.2 ± 6.1 µm, and stylet length = 10.4 ± 1.9 µm, distance from dorsal esophageal gland opening to the stylet knot (DGO) = 3.96 ± 0.42 μm; females (n = 20) were pear-shaped, body length = 565.23 ± 86.68 μm, maximum body width = 407.24 ± 60.21 μm, stylet length = 9.93 ± 0.88 μm, DGO = 4.76 ± 0.32 μm, stylet median bulb width (MBW) = 29.67 ± 3.61 μm, perineum morphology is low and low dorsal arch round, with a typical inferior protrusion near the anus. These morphological characteristics are consistent with Meloidogyne hapla as described by Hunt and Handoo (2009). To confirm species identification, DNA was extracted from females (Blok, et al. 1997) and ITS region was amplified using the primers 18S/26S (Vrain et al. 1992). Furthermore, species-specific SCAR primers JMV1/JMV hapla were used as described by Adam et al. (2007). PCR produced 768 bp and 419 bp sequences. Fragments were sequenced (MW512922and MW228371, respectively) and compared with available sequences on NCBI. Sequences were 99.48% identical to the MT249016, KJ572385, and 100% identical to the GQ395574, GQ395569 M. hapla sequences, respectively. Morphological and molecular characterization supports the identification of the isolate found on Aucklandia lappa as M. hapla. Yunmuxiang seed were planted in 20 cm diameter, 10 cm deep plastic pots containing 1000 cm3 sterilized soil. Seedlings were thinned to one per pot. At the 2-3 leaf stage 10 pots were infested with 1500 M. hapla J2 per seedling, using a sterilized micropipette. Plants were maintained at 20-25°C in a greenhouse. Control plants received sterile water, and the pathogenicity test was repeated three times. After 30 days, plants were removed from pots and soil gently removed from the roots. A large number of galls (95.6 ± 2.5) and egg masses (33.5 ± 0.5) were found on each root system. Yunmuxiang was considered a good host for M. hapla in Lijiang. M. hapla is a major plant parasitic nematode with a wide geographic distribution and range of host plants and causes severe yield losses (Azevedo de Oliveira et al. 2018). Through investigation, this is the first report worldwide of M. hapla infecting Aucklandia lappa.

scholarly journals First Report of Meloidogyne javanica Parasitizing Duboisia sp. in Paraná State, Brazil

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1745-1745
Author(s):  
A. C. Z. Machado ◽  
O. F. Dorigo ◽  
A. Boss ◽  
P. Tironi
Keyword(s):  
Morphological Characteristics ◽  
Tail Length ◽  
Nematode Species ◽  
Eastern Coast ◽  
State University ◽  
Root Knot Nematode ◽  
First Report ◽  
North Carolina State University ◽  
Tail Tip ◽  
And Control

Duboisia sp. is a small tree belonging to the family Solanaceae originating from the rainforest areas of the eastern coast of Australia. Dried leaves are used for the extraction of pharmaceutical alkaloids, making this a commercially viable crop. The root-knot nematode Meloidogyne incognita has been reported parasitizing Duboisia myoporoides (5); however, no information of other root-knot nematode species associated with this plant was found. Duboisia sp. is cultivated at Solana Farm, near Arapongas (23°25′08″ S, 51°25′26″ W), Paraná State, Brazil. During the renovation of a production field in this municipality, galled roots were observed on plants and samples were submitted to the Nematology Laboratory at Instituto Agronômico do Paraná, IAPAR, on December 2013. Plants did not exhibit any above-ground symptoms. The specimens were identified through perineal patterns and esterase phenotypes of 20 adult females extracted from dissected roots (2,3) and morphometrics of 10 second-stage juveniles extracted from roots using the blender-sieving method (1). Morphological characteristics were consistent with those described for M. javanica (4). Females had rounded perineal patterns with low, trapezoid shape dorsal arch, striae smooth interrupted by a pair of incisures on both sides, corresponding to lateral fields, clearly demarcated from striae by more or less parallel lines, tail whorl often distinct (4). The juvenile mean body length was 459.9 ± 28.7 μm and tail length averaged 51.6 ± 5.1 μm, with 10 to 16 μm long hyaline region and finely rounded tail tip (4). Results from the esterase electrophoresis were typical of M. javanica (2) with the J3 (Rm = 1.0, 1.3, and 1.4) phenotype being obtained. To our knowledge, this is the first report of M. javanica on Duboisia sp. in Brazil. This finding has great importance for Brazilian production since this nematode may damage plants, reduce yields, and control of this nematode on Duboisia sp. is difficult (5). Additional work is necessary in order to elucidate the losses caused by M. javanica on Duboisia sp. References: (1) J. I. Bonetti and S. Ferraz. Fitopatol. Bras. 6:533, 1981. (2) P. R. Esbenshade and A. C. Triantaphyllou. J. Nematol. 22:10, 1990. (3) K. M. Hartman and J. N. Sasser. Page 115 in: An Advanced Treatise on Meloidogyne. Volume II Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh, 1985. (4) D. J. Hunt and Z. A. Handoo. Page 55 in: Root-Knot Nematodes. R. N. Perry et al., eds. CABI International, Wallingford, UK, 2010. (5) A. M. Mello et al. Nematol. Bras. 22(2):12, 1998.

scholarly journals First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio

Plant Disease ◽  
2012 ◽  
Vol 96 (9) ◽  
pp. 1385-1385
Author(s):  
H. D. Lopez-Nicora ◽  
T. Mekete ◽  
N. J. Taylor ◽  
T. L. Niblack
Keyword(s):  
Body Length ◽  
Tail Length ◽  
The Body ◽  
28S Rrna ◽  
Lateral Field ◽  
First Report ◽  
Pratylenchus Vulnus ◽  
Buxus Sempervirens ◽  
Stylet Length ◽  
De Man

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 μm (mean 583.0 μm), stylet length from 15.0 to 17.8 μm (mean 16.8 μm), tail length from 23.2 to 37.5 μm (mean 29.2 μm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 μm (mean 3.1 μm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c′ = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 μm (mean 537.9 μm), stylet length from 15.0 to 17.2 μm (mean 16.2 μm), tail length from 22.7 to 28.1 μm (mean 25.5 μm), spicule from 15.0 to 17.5 μm (mean 16.4 μm), gubernaculum from 3.5 to 4.7 μm (mean 4.0 μm), and DGO from 2.6 to 3.7 μm (mean 3.1 μm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c′ = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

scholarly journals First Report of Bursaphelenchus doui on Tulip Tree (Liriodendron tulipifera) in Korea

Plant Disease ◽  
2009 ◽  
Vol 93 (11) ◽  
pp. 1221-1221 ◽  
Author(s):  
H. Han ◽  
Y.-J. Chung ◽  
S.-C. Shin
Keyword(s):  
Body Length ◽  
Pinus Densiflora ◽  
Tail Length ◽  
Liriodendron Tulipifera ◽  
Biological Information ◽  
Causative Organism ◽  
Male Body ◽  
First Report ◽  
Stylet Length ◽  
Tulip Tree

Tulip tree (Liriodendron tulipifera) is one the major tree species in Korean plantations, but it originated from North America. Bursaphelenchus doui was collected from the wood of dead tulip trees located at Wanju in Chonnam Province, Korea. Nematodes were maintained in fungal medium culture (Botrytis cinerae) on potato dextrose agar. B. doui is morphologically close to B. xylophilus, a causative organism of pine wilt disease, and identification to species is difficult. However, B. doui differs from the other species of the xyophilus group by the larger spicule (33.8 to 43.3 μm) (1). For accurate species identification, both morphology and molecular biological methods were applied. Morphological observations showed lip region 3.7 μm high and offset by a constriction, median bulb well developed, esophageal gland overlapping intestine dorsally, vulval flap present, tail terminus with distinct mucro. Males ventrally curved by fixation, spicules pared, and large with small, cucullus, oval-shaped bursa. Measurements of 20 females and 10 males (female; body length = 901.7 ± 60.5 μm, a = 34.3 ± 3.1, b = 10.4 ± 1.5, c = 23.0 ± 2.3, V = 77.1 ± 2.0, stylet length = 14.3 ± 0.4 μm, tail length = 39.5 ± 4.2 μm, length of postuterine sac = 104.6 ± 7.8: male; body length = 790.4 ± 40.6 μm, a = 34.4 ± 2.7, b = 10.8 ± 1.7, c = 22.7 ± 1.3, stylet length = 14.3 ± 0.3 μm, tail length = 34.8 ± 1.9 μm, spicules length = 39.5 ± 4.1 μm) were close to the original description of B. doui by Braasch et al. (1). For molecular diagnosis, DNA was extracted from more than 30 individual nematodes with a DNeasy Kit (Qiagen, Valencia, CA) and the internal transgenic spacers (ITS) 1, 2, and 5.8S regions in rDNA were amplified by PCR (US/PTC-0220; Bio Rad, Hercules, CA). ITS-restriction fragment length polymorphism (RFLP) can discriminate closely related species by using five different restriction enzymes (2). ITS-RFLP patterns obtained with these enzymes were the same as reported by Braasch et al. (1). B. doui previously has been detected in Korean wooden packages imported to China (1). However, most production of Korean wooden packages depends on imported coniferous trees from other countries. Although B. doui has been reported in Japanese red pine (Pinus densiflora) in Japan (3), the natural distribution of B. doui in Korea is unclear. On the basis of morphological and molecular biological information, we identify this nematode as B. doui. To our knowledge, this is the first report of B. doui on tulip tree and in a natural area in Korea. References: (1) H. Braasch et al. Russ. J. Nematol. 12:19, 2004. (2) W. Burgermeister et al. Russ. J. Nematol. 13:29, 2005. (3) N. Kanzaki et al. Nematology. 10:69, 2008.

scholarly journals First Report of Root-Knot Nematode Meloidogyne javanica on Chrysanthemum in Colombia

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 828-828 ◽  
Author(s):  
P. A. Agudelo ◽  
S. A. Lewis ◽  
M. A. Abril
Keyword(s):  
Morphological Characteristics ◽  
Meloidogyne Javanica ◽  
Nematode Species ◽  
Wide Distribution ◽  
Economic Losses ◽  
Cut Flower ◽  
Root Knot Nematode ◽  
Root Knot Nematodes ◽  
First Report ◽  
Phenotype Analysis

Severe plant stunting, chlorosis, and extensive root galling were observed on chrysanthemum (Dendrathema grandiflora cv. Yellow Vero) in a commercial cut-flower production facility in Rionegro, Antioquia, northwestern Colombia. Examination of the root samples from selected infected plants revealed the presence of abundant root-knot nematodes. Juveniles, males, and females were extracted for species identification using morphological characteristics. Identification was confirmed by perineal patterns and esterase phenotype analysis of females. All methods of identification were consistent with typical Meloidogyne javanica. No other root-knot nematode species were found on this farm, but the presence of other Meloidogyne species in the region is possible. Root-knot nematodes have been reported to cause economic losses in cut-flower plantations in Colombia (1), but there are no reports of the species involved. M. javanica has an extensive host range and wide distribution. The identification and distribution of M. javanica in chrysanthemum production is relevant because nematode-fungus interactions may depend on the nematode species involved. Only M. javanica, and not M. hapla or M. incognita, has been found to increase the severity of Fusarium wilt on chrysanthemum (2). To our knowledge, this is the first report of M. javanica on chrysanthemum in Colombia. References: (1) G. Arbeláez. Acta Hortic. 482:91, 1999. (2) A. W. Johnson and R. H. Littrell. J. Nematol. 1:122. 1969.

scholarly journals First report of Coniella castaneicola causing leaf blight on blueberry (Vaccinium virgatum) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jiahao Lai ◽  
Guihong Xiong ◽  
Bing Liu ◽  
Weigang Kuang ◽  
Shuilin Song
Keyword(s):  
Molecular Identification ◽  
Morphological Characteristics ◽  
Leaf Blight ◽  
Yield Potential ◽  
Effective Control ◽  
Economic Losses ◽  
Distilled Water ◽  
First Report ◽  
Fungal Isolates ◽  
Blight Disease

Blueberry (Vaccinium virgatum), an economically important small fruit crop, is characterized by its highly nutritive compounds and high content and wide diversity of bioactive compounds (Miller et al. 2019). In September 2020, an unknown leaf blight disease was observed on Rabbiteye blueberry at the Agricultural Science and Technology Park of Jiangxi Agricultural University in Nanchang, China (28°45'51"N, 115°50'52"E). Disease surveys were conducted at that time, the results showed that disease incidence was 90% from a sampled population of 100 plants in the field, and this disease had not been found at other cultivation fields in Nanchang. Leaf blight disease on blueberry caused the leaves to shrivel and curl, or even fall off, which hindered floral bud development and subsequent yield potential. Symptoms of the disease initially appeared as irregular brown spots (1 to 7 mm in diameter) on the leaves, subsequently coalescing to form large irregular taupe lesions (4 to 15 mm in diameter) which became curly. As the disease progressed, irregular grey-brown and blighted lesion ran throughout the leaf lamina from leaf tip to entire leaf sheath and finally caused dieback and even shoot blight. To identify the causal agent, 15 small pieces (5 mm2) of symptomatic leaves were excised from the junction of diseased and healthy tissue, surface-sterilized in 75% ethanol solution for 30 sec and 0.1% mercuric chloride solution for 2 min, rinsed three times with sterile distilled water, and then incubated on potato dextrose agar (PDA) at 28°C for 5-7 days in darkness. Five fungal isolates showing similar morphological characteristics were obtained as pure cultures by single-spore isolation. All fungal colonies on PDA were white with sparse creeping hyphae. Pycnidia were spherical, light brown, and produced numerous conidia. Conidia were 10.60 to 20.12 × 1.98 to 3.11 µm (average 15.27 × 2.52 µm, n = 100), fusiform, sickle-shaped, light brown, without septa. Based on morphological characteristics, the fungal isolates were suspected to be Coniella castaneicola (Cui 2015). To further confirm the identity of this putative pathogen, two representative isolates LGZ2 and LGZ3 were selected for molecular identification. The internal transcribed spacer region (ITS) and large subunit (LSU) were amplified and sequenced using primers ITS1/ITS4 (Peever et al. 2004) and LROR/LR7 (Castlebury and Rossman 2002). The sequences of ITS region (GenBank accession nos. MW672530 and MW856809) showed 100% identity with accessions numbers KF564280 (576/576 bp), MW208111 (544/544 bp), MW208112 (544/544 bp) of C. castaneicola. LSU gene sequences (GenBank accession nos. MW856810 to 11) was 99.85% (1324/1326 bp, 1329/1331 bp) identical to the sequences of C. castaneicola (KY473971, KR232683 to 84). Pathogenicity was tested on three blueberry varieties (‘Rabbiteye’, ‘Double Peak’ and ‘Pink Lemonade’), and four healthy young leaves of a potted blueberry of each variety with and without injury were inoculated with 20 μl suspension of prepared spores (106 conidia/mL) derived from 7-day-old cultures of LGZ2, respectively. In addition, four leaves of each variety with and without injury were sprayed with sterile distilled water as a control, respectively. The experiment was repeated three times, and all plants were incubated in a growth chamber (a 12h light and 12h dark period, 25°C, RH greater than 80%). After 4 days, all the inoculated leaves started showing disease symptoms (large irregular grey-brown lesions) as those observed in the field and there was no difference in severity recorded between the blueberry varieties, whereas the control leaves showed no symptoms. The fungus was reisolated from the inoculated leaves and confirmed as C. castaneicola by morphological and molecular identification, fulfilling Koch’s postulates. To our knowledge, this is the first report of C. castaneicola causing leaf blight on blueberries in China. The discovery of this new disease and the identification of the pathogen will provide useful information for developing effective control strategies, reducing economic losses in blueberry production, and promoting the development of the blueberry industry.

Characteristics of Bonpala sheep

1997 ◽  
Vol 22 ◽  
pp. 15-18 ◽  
Author(s):  
P. K. Vij ◽  
M. S. Tantia ◽  
A. E. Nivsarkar
Keyword(s):  
Body Length ◽  
Management Practices ◽  
Morphological Characteristics ◽  
Tail Length ◽  
Sheep Breed ◽  
Sample Survey ◽  
Body Measurements ◽  
Dual Purpose ◽  
Face Width ◽  
Face Length

SummaryBonpala is a dual purpose sheep breed found in Sikkim, Western Bhutan and Eastern Nepal. A sample survey was conducted in east Sikkim to record characteristics of Bonpala sheep. Information was recorded on morphological characteristics, management practices and body measurements. Bonpala sheep have mixed colours ranging from all white, white and black or all black. Measurements were recorded of body length, height, heart girth, paunch girth, rump width, pin width, face length, face width, ear length, tail length, horn length and horn circumference.

Sign in / Sign up

Export Citation Format

Share Document