scholarly journals First Report of Pectobacterium brasiliense causing soft rot on mizuna (Brassica rapa var. japonica) in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Diksha Klair ◽  
Joshua Silva ◽  
Eduardo Dario Arizala ◽  
Gamze Boluk ◽  
Shefali Dobhal ◽  
...  
Keyword(s):  
Brassica Rapa ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
The United States ◽  
Bacterial Suspension ◽  
Original Strain ◽  
Distilled Water ◽  
Tetrazolium Chloride ◽  
First Report ◽  
Query Coverage

Mizuna (Brassica rapa var. japonica), a member of family Brassicaceae, is a leafy vegetable having phenolic and other compounds beneficial to human health, such as natural antioxidants (Khanam et al. 2012). In October 2020, a field of mizuna (variety: Early) on Oahu island was observed having 20-30% diseased plants. Four randomly selected infected mizuna plants, showing the symptoms of wilt and stem rot (Figure 1A-D), were collected and isolations were made to determine the pathogen. Small sections of infected stems were cut, surface sterilized with 0.6% sodium hypochlorite solution for 30 sec, followed by three consecutive rinses in distilled water. The tissues were macerated in a sterile 1.5 ml centrifuge tube containing 100 μl sterile water—macerated tissues were streaked onto crystal violet pectate medium (CVP) (Hélias et al. 2011) and incubated at 26 ± 2°C for 48 h. Isolated bacterial colonies that formed pits on the CVP plates were re-streaked onto dextrose peptone agar: Peptone (10 g/L), Dextrose (5 g/L) and Agar (17 g/L) (DPA–without tetrazolium chloride; Norman and Alvarez 1989) to obtain purified colonies for DNA isolation using DNeasy Blood and Tissue Kit (Qiagen, Germantown, MA). The two housekeeping genes (dnaA and gapA) were amplified and sequenced following the protocols used by Dobhal et al. (2020) and Boluk et al. (2020), for identity confirmation and phylogenetic analysis. Cleaned PCR products were sent to the GENEWIZ facility (Genewiz, La Jolla, CA) for sequencing of sense and antisense strands. The obtained sequences were aligned, manually edited, and consensus sequences were analyzed with BLASTn using the NCBI GenBank nucleotide and genome databases for identity confirmation. The BLASTn results demonstrated 100% query coverage of all four strains (PL248-PL251); and showed 100% identity of PL248 and PL249, and 99% identity of PL250 and PL251 with Pectobacterium brasiliense. All the sequences were submitted to the NCBI GenBank database under the following accession numbers: dnaA gene MW560271 - MW560274 (PL248 – PL251); and gapA gene MW560275 - MW560278 (PL248 - PL251). Pathogenicity was assessed by artificially inoculating 100 µl bacterial suspension of each strain (PL248 - 1.12x 10⁸ CFU/ml; PL249 - 1.32x 10⁸ CFU/ml; PL 250 - 1.2x 10⁸ CFU/ml and PL251 - 1.15x 10⁸ CFU/ml) onto four-week-old mizuna (variety: Leafy Asian Greens) plants in three replicates, using sterile pipette tips, which was stabbed into stem halfway and wrapped with parafilm. The inoculated plants were well maintained under controlled greenhouse conditions. As negative controls, three plants were inoculated with 100 µl distilled water. Soft rot and wilt symptoms (Figure 1E-H) were observed 24 hours post inoculation. No symptoms were observed on control plants (Figure 1F). All four strains were re-isolated from the inoculated plants and confirmed as P. brasiliense based on resequencing of the dnaA region and 100% homology with the sequences of original strain. In the phylogenetic tree (Figure 2), based on two housekeeping genes (dnaA and gapA), the bacterial strains from mizuna grouped with other P. brasiliense retrieved from the NCBI GenBank database. To our knowledge, this is the first report of P. brasiliense infecting mizuna plants in Hawaii or in the USA and is important because this species is one of the most aggressive pectolytic pathogens in the genus Pectobacterium. Understanding the diversity of different pectolytic phytopathogens is essential to formulating risk mitigation strategies as P. brasiliense could potentially pose a threat to additional vegetable crops, especially the crucifers vegetables (Arizala et al. 2019; Klair et al, 2021).

scholarly journals First Report of Bacterial Soft Rot Disease on Pak Choi (Brassica rapa subsp. chinensis) caused by Pectobacterium brasiliense in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Diksha Klair ◽  
Gamze Boluk ◽  
Joshua Silva ◽  
Eduardo Dario Arizala ◽  
Shefali Dobhal ◽  
...  
Keyword(s):  
Brassica Rapa ◽  
Soft Rot ◽  
The United States ◽  
High Water Content ◽  
Distilled Water ◽  
Vegetable Crop ◽  
Tetrazolium Chloride ◽  
Pak Choi ◽  
First Report ◽  
Query Cover

Pak choi (Brassica rapa subsp. chinensis) is an important vegetable crop native to China, known for high water content and low caloric value, containing high quality of protein, carbohydrates, fiber, vitamins, minerals, and secondary plant metabolites (Acikgoz, 2016). A pak choi field (8,000 sq. ft.) on Oahu, Hawaii, was visited in May 2020. About 10% plants were infected and showed characteristic symptoms of soft rot, wet lesions, macerated infected stem and necrotic leaves (Figure1A-D); leading to the suspect of one of the most devastating bacterial pathogens within genus Pectobacterium (Boluk et al. 2020; Li et al. 2019; Arizala et al. 2020; Arizala and Arif, 2019). Four infected plants were collected from the field, and stems were surface sterilized with 0.6% sodium hypochlorite solution for 30 sec, followed by three consecutive rinses in distilled water. The stems were aseptically macerated, streaked on Crystal violet pectate medium (CVP) (Hélias et al. 2011), and incubated for 48 h at 26 ± 2°C. The peculiar morphological characteristic of pectolytic bacterial pathogen, forming pits on CVP, were observed (Meng et al. 2016) (Figure 1E). Purification of bacterial colonies were done by re-streaking of a single colony on dextrose peptone agar (DPA—without tetrazolium chloride; Norman and Alvarez 1989). DNA was isolated from bacterial cultures using the DNeasy Blood and Tissue Kit (Qiagen, Germantown, MA), respectively. Molecular identification of four strains (PL243-246) were performed by the sequencing region of the housekeeping gene dnaA (chromosomal replication initiation protein) using Pec. dnaA-F1/R1 primer set (Dobhal et al. 2020). The amplified PCR product was enzymatically cleaned using ExoSAP-ITTM (Affymetrix Inc, Santa Clara, CA), and sent for sequencing at the GENEWIZ facility (Genewiz, La Jolla, CA) using both forward and reverse primers. The dnaA gene sequences were aligned using Geneious, and manually edited to remove the errors. The consensus sequences were analyzed with the NCBI BLASTn tool and were deposited in the NCBI GenBank under the accession numbers MT899920-MT899923. The NCBI BLASTn report indicated that all the sequences shared 99-100% identity and query cover with Pectobacterium brasiliense accession numbers MN544627-29. A phylogenetic analysis, using Geneious, was performed with the dnaA sequences representing different Pectobacterium spp., all strains grouped within the clade of P. brasiliense (Figure 2; Arizala et al, 2020). A pathogenicity assay was carried out in three replications on pak choi grown in pots containing commercial pot mixture, and maintained in the controlled-greenhouse (temperature 26-30°C; relative humidity 50-58%). Three-weeks old plant stems were artificially inoculated with 100 µl bacterial suspensions of PL243 (1.3x 10⁸ CFU/ml), PL244 (1.2x 10⁸ CFU/ml), PL 245 (1.2x 10⁸ CFU/ml) and PL246 (1.1x 10⁸CFU/ml); control plants were inoculated with 100 µl of distilled water (Figure 1F). Two days after inoculation, the soft rot and wilting symptoms (Figure 1G-H), similar to the ones observed on the field, were developed for all four strains tested. Bacteria was successfully re-isolated from the inoculated plants; DNA was isolated, amplified, sequenced for dnaA region and analyzed for 100% homology with original strains, to fulfill Koch’s postulates. Based on the molecular characteristics re-isolates were identical to the original strains. To the best of our knowledge, this is the first report of P. brasiliense on pak choi in the USA. Recent reports indicated that the pathogen could potentially pose a threat to cruciferous crops, therefore, highlighting a need to conduct a state-wide survey for pectinolytic bacteria, and implement better management strategies to combat the vegetable crop losses.

scholarly journals First Report of Bacterial Soft Rot of Potato Caused by Pectobacterium carotovorum subsp. carotovorum in Guangdong Province of China

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1819-1819 ◽  
Author(s):  
J. X. Zhang ◽  
B. R. Lin ◽  
H. F. Shen ◽  
X. M. Pu ◽  
Z. N. Chen ◽  
...  
Keyword(s):  
Guangdong Province ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Pectobacterium Carotovorum ◽  
Bacterial Soft Rot ◽  
First Report ◽  
Wide Range ◽  
Carotovorum Subsp ◽  
Agar Media

Potato (Solanum tuberosum L.) is a major crop in China, with 80.0 million tons being produced in 2010 on 3.3 million ha. Pectobacterium carotovorum subsp. carotovorum Jones 1901; Hauben et al. 1999 causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During spring 2010, a soft rot with a foul smell was noted in stored potato tubers of different cultivars in the Guangdong Province. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white to cream colored. Stems of infected plants with typical inky black symptoms could also be found in the fields prior to harvest. Three different potato fields were surveyed, and 13% of the plants had the symptoms. Twenty-seven samples (three symptomatic tubers per sample) were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar media supplemented with 5% sucrose and incubated at 26 ± 1°C for 36 h. After purification on tripticase soy agar media, four typical strains (7-3-1, 7-3-2, 8-3-1, and 8-3-2) were identified using the following deterministic tests: gram-negative rods, oxidase negative, facultatively anaerobic, able to degrade pectate, sensitive to erythromycin, negative for phosphatase, unable to produce acid from α-methyl-glucoside, and produced acid from trehalose. Biolog analysis (Ver 4.20.05, Hayward, CA) identified the strains as P. carotovorum subsp. carotovorum (SIM 0.808, 0.774, 0.782, and 0.786, respectively). The identity of strains 7-3-1 (GenBank Accession No. JX258132), 7-3-2 (JX258133), and 8-3-1 (JX196705) was confirmed by 16S rRNA gene sequencing (4), since they had 99% sequence identity with other P. carotovorum subsp. carotovorum strains (GenBank Accession Nos. JF926744 and JF926758) using BLASTn. Further genetic analysis of strain 8-3-1 was performed targeting informative housekeeping genes, i.e., acnA (GenBank Accession No. JX196704), gabA (JX196706), icdA (JX196707), mdh (JX196708), mtlD (JX196709), pgi (JX196710), and proA (JX196711) (2). These sequences from strain 8-3-1 were 99 to 100%, homologous to sequences of multiple strains of P. carotovorum subsp. carotovorum. Therefore, strain 8-3-1 grouped with P. carotovorum subsp. carotovorum on the phylogenetic trees (neighbor-joining method, 1,000 bootstrap values) of seven concatenated housekeeping genes when compared with 60 other strains, including Pectobacterium spp. and Dickeya spp. (3). Pathogenicity of four strains (7-3-1, 7-3-2, 8-3-1, and 8-3-2) was evaluated by depositing a bacterial suspension (106 CFU/ml) on the potato slices of cultivar ‘Favorita’ and incubating at 30 ± 1°C. Slices inoculated with just water served as non-inoculated checks. The strains caused soft rot within 72 h and the checks had no rot. Bacteria were reisolated from the slices and were shown to be identical to the original strains based on morphological, cultural, and biochemical tests. Although this pathogen has already been reported in northern China (1), to our knowledge, this is the first report of P. carotovorum subsp. carotovorum causing bacterial soft rot of potato in Guangdong Province of China. References: (1) Y. X. Fei et al. J. Hexi Univ. 26:51, 2010.(2) B. Ma et al. Phytobacteriology 97:1150, 2007. (3) S. Nabhan et al. Plant Pathol. 61:498, 2012. (4) W. G. Weisbury et al. J. Bacteriol. 173:697, 1991.

scholarly journals First report of stalk bacterial soft rot of sugarcane caused by Dickeya zeae in China

Plant Disease ◽  
2020 ◽  
Author(s):  
yanchang Yang ◽  
Ziting Yao ◽  
Mu-Qing Zhang ◽  
Chengwu Zou ◽  
Baoshan Chen
Keyword(s):  
Pure Water ◽  
Bacterial Species ◽  
Evolutionary Relationship ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Post Inoculation ◽  
Distilled Water ◽  
Sugarcane Cultivar ◽  
First Report

In late September 2019, seven stalks of about 1400 stalks of sugarcane cultivar Zhongzhe 1 exhibited soft rot symptoms in a trial plot in Beihai city, Guangxi province of China. Symptoms included scorched and collapsed leaves, maceration of stalks, and sour smelling exudates from the stalks (Supplementary Fig. S1). Severely diseased stalks had collapsed and were dead. Internal stalk fragments of 5 × 5 mm were collected at the junction of healthy and diseased tissue after surface-sterilization of stalks with 70% ethanol for one minute, and three times rinsing with sterile distilled water. Stalk fragments were placed on Luria–Bertani agar medium (1 % w/v tryptone, 0.5 % w/v yeast extract, 1 % w/v NaCl, 1 % w/v agar, pH7.0) and plates were put in an incubator at 30°C for 48h. Four types of bacterial colonies were obtained, and small and white colonies with irregular margins were the most dominant. A single colony of each type was diluted in sterile distilled water and aliquots of each suspension were streaked on fresh medium plates to obtain pure cultures. Ten eight-week-old stalks (11 th leaf stage) of sugarcane plants, which derived from cuttings of symptomless cultivar Zhongzhe 1, were inoculated by injection of 300 μl of bacterial suspension (3.5x108 CFU/ml) into the stalks. Another 10 stalks were injected with pure water and served as control. The inoculated plants were kept in a greenhouse at 25-37℃.Among the four types of bacteria, only strain BH9 induced symptoms that were identical to those of diseased canes observed in the field (Supplementary Fig. S1). Elongated water-soaked lesions were observed around the inoculation sites three days post inoculation. Five of the 10 BH9-inoculated plants had collapsed two days later. Water-soaked stalks had a sour smell similar to the filed diseased plants. Eight days post inoculation, all BH9-inoculated plants exhibited symptoms but control plants remained symptomless up to 30 days after inoculation. Uniform white colonies with irregular margins were isolated from the inoculated stalks that developed soft rot symptom, and these bacteria caused again stalk soft rot symptoms when inoculated to a new batch of 10 healthy plants. The 16S rRNA gene of strain BH9 was amplified by PCR with primer pair fD2/rP1 and the PCR amplicons from three independent colonies were sequenced. The sequences of the three amplicons were identical (Accession No. MT723897). BLAST alignments of the 16S rDNA sequence from BH9 strain with the GenBank database revealed that BH9 belonged to the genus Dickeya (98.5% identity between D. zeae BH9 and D. zeae EC1). Further PCR assays and sequencing of three genes, DNA polymerase III gamma subunit gene dnaX with primers dnaXf/dnaXr, DNA gyrase gene gyrB with primers gyrBf1/gyrBr1, and recombinase A gene recA with primers recAf/recAr, were performed to identify the species within the genus Dickeya (Zhang et al., 2014). BH9 sequences of these genes (Accession No. MT723898 to MT723900) had highest identity (97.5%, 97.6%, and 97.7%, respectively) with those from D. zeae EC1 (GenBank accession No. CP006929.1). To determine the evolutionary relationship of BH9 to other Dickeya species and strains, a phylogenetic analysis was performed using dnaX, gyrB, and recA sequences. As shown in Supplementary Fig. S2, BH9 clustered with D. zeae strains and formed a lineage distinguishable from other Dickeya species. Among the closest strains, D. zeae NCPPB3531 (Accession No. CM001980.1) was isolated from potato and D. zeae CSL RW192 (Accession No. CM001972.1) from river water (Pritchard et al., 2013). Consequently, strain BH9 was identified as D. zeae. This bacterial species has been reported to cause soft rot in rice (Pu et al., 2012), banana (Zhang et al., 2014), maize (Martinez-Cisneros et al., 2014), and clivia (Hu et al., 2018). To the best of our knowledge, this is the first report of a bacterial stalk rot caused by D. Zeae in sugarcane. In fact, low incidence of D. zeae-caused stalk soft rot was recently found in sugarcane fields in Fusui County, about 150 km north to Beihai. Given the potential threat of this disease to the local sugarcane industry, the mode of transmission, cultivar resistance, and measures to control the disease should be investigated.

scholarly journals First Report of Bacterial Soft Rot on Tagetes patula Caused by Dickeya dieffenbachiae in China

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 282-282 ◽  
Author(s):  
J. X. Zhang ◽  
B. R. Lin ◽  
H. F. Shen ◽  
X. M. Pu ◽  
Z. W. Wang ◽  
...  
Keyword(s):  
Black Spot ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Early Summer ◽  
Bacterial Suspension ◽  
Bacterial Disease ◽  
Tagetes Patula ◽  
First Report ◽  
Chain Reactions ◽  
Plant Pathol

French marigold (Tagetes patula L.), originally from Mexico, is an annual herb widely planted in China because of its beautiful color, long flowering, and strong adaptability, and has been used widely for ornamentation and decorating. French marigold is also rich in patuletin, quercetagetin, and patulitrin, and is therefore applied medicinally for treating colds and coughs. In early summer 2012, soft rot symptoms on French marigold were found at three flower nurseries in Guangzhou, Guangdong Province, P. R. China, and approximately 25% of the plants had the symptoms. The symptoms included tissue collapse of the stems at the soil line followed by wilting of the whole plants. Within 1 week, the infected stems showed vascular discoloration, turned brown and then inky black, and eventually the whole plant collapsed after the basal stem was infected. Bacteria were successfully isolated from eight symptomatic plants on nutrient agar media incubated at 30°C for 48 h. Ten isolates were selected randomly for further characterization. They were gram negative, degraded pectate, negative for oxidase and positive for indole production, and utilized malonate, glucose, and sucrose but not glucopyranoside, trehalose, or palatinose. Polymerase chain reactions (PCR) were performed using the 16S primers 27f and 1495r (4) for molecular identification. Subsequent DNA sequencing showed that the representative tested strain TP1 (GenBank Accession No. JX575747) was 99% identical to that of Dickeya dieffenbachiae (JF419463) using BLASTn. Further genetic analysis of strain TP1 was performed targeting several housekeeping genes, i.e., dnaX (GenBank Accession No. JX575748) with primers dnaxf and dnaxr (3), gyrB (JX575749) with primers of gyrbf1 and gyrbr1 (1), and gapA (JX575750) with primers of gapa326f and gapa845r (2). They were most homologous to the sequences of D. dieffenbachiae, since they had 97%, 96%, and 97% identity with GenBank accessions GQ904794, JF311653, and GQ891968, respectively. Pathogenicity was confirmed by injecting all 10 original bacterial isolates into each of 10 French marigold seedlings, with approximately 100 μl of a bacterial suspension at 1 × 108 CFU/ml. Ten plants inoculated with 100 μl of sterile water served as controls. Plants were placed in a greenhouse at 30 to 32°C and 90% relative humidity. Within 48 h, soft rot symptoms appeared on all inoculated seedlings, while the control plants appeared normal. D. dieffenbachiae was reisolated from the diseased tissues, and confirmed to be the same as the inoculated pathogen by conducting a 16S rDNA sequence comparison. Previously, black spot, botrytis blight, oedema, powdery mildew, southern bacterial wilt, and damping off have been found on T. patula. To our knowledge, it is the first report of a soft rot caused by D. dieffenbachiae on French marigold. Because of the popularity and high economic value of French marigold, identification of this progressing bacterial disease is important to maintain safe production and beautiful scenery. References: (1) B. R. Lin et al. Plant Dis. 96:452, 2012. (2) S. Nabhan et al. Plant Pathol. 61:498, 2012. (3) M. Sławiak et al. Eur. J. Plant Pathol. 125:245, 2009. (4) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Pectobacterium punjabense causing potato soft rot and blackleg in Serbia

Plant Disease ◽  
2021 ◽  
Author(s):  
Marta Loc ◽  
Dragana Milošević ◽  
Maja Ignjatov ◽  
Žarko Ivanović ◽  
Dragana Budakov ◽  
...  
Keyword(s):  
16S Rdna ◽  
Potato Plant ◽  
Soft Rot ◽  
Economic Losses ◽  
Bacterial Suspension ◽  
Distilled Water ◽  
Potato Tubers ◽  
First Report ◽  
Potato Plants ◽  
16S Rdna Pcr

Soft rot and blackleg are common diseases affecting potato (Solanum tuberosum) production in Serbia. Pectinolytic plant pathogens belonging to the genera Pectobacterium cause soft rot and wilt diseases by plant cell wall degradation. These opportunistic phytopathogens lead to considerable economic losses in many potato-growing regions worldwide and are listed among top 10 plant pathogenic bacteria (Mansfield et al. 2012). Potato plants (cv. VR808) with symptoms of wilting, slow growth, stem blackening and tubers softening, were collected from a commercial potato field in Zobnatica (Serbia) in July 2019 and subjected to analysis. All symptoms occurred in the same field and the incidence of symptomatic plants was approximately 5%. Isolation was performed from 10 randomly chosen potato plant and tuber samples, expressing wilting and soft rot symptoms. Plant tissue was surface-disinfected and 1 cm length sections from the margins of lesions were macerated in sterile distilled water for 25 min and streaked on nutrient-agar medium. After 48 h of incubation at 26°C, predominant shiny, cream-colored, round colonies were obtained from all samples. Three representative isolates (MMZKVR1, MMZCVR2, and MMZKVR3) from independent samples were selected randomly and subjected to biochemical and pathogenicity tests. Isolates were gram-negative, nonfluorescent facultative anaerobes, exhibiting pectinolytic activity on potato tuber slices and hypersensitive response on tobacco leaves. They expressed catalase activity but did not express oxidase or acid phosphatase activity or produce indole. All strains grew at 37°C, in 5% NaCl, and reduced nitrate. Pathogenicity of the obtained isolates was tested on 3-week-old healthy potato plants (cv. VR808 and cv. Kiebitz) grown in commercial Baltic Tray Substrate (Hawita) in the greenhouse, as well as on potato tubers of the same varieties. Three potato plant stems per isolate were inoculated by the toothpick piercing method (Duarte et al. 2004) using bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated plants were incubated under plastic bags in a greenhouse at 25 ± 2°C. Blackleg symptoms and stem wilting developed 48 hours after inoculation. No symptoms were observed on plants inoculated with sterile toothpicks dipped in sterile distilled water. The pathogen was re-isolated from symptomatic plants, fulfilling Koch's postulates and sequencing of 16S rDNA confirmed the originally isolated pathogen. Three potato tubers per isolate were inoculated by toothpicks dipped in bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated tubers were placed in a sealed plastic container at 25 ± 2°C. Treatment with sterile distilled water was used as a negative control. Softening of the tissue around the inoculation point developed within 48 h from inoculation, and no symptoms developed on the control tubers. For molecular analyses, total DNA of the isolates was extracted using the DNeasy Plant Mini Kit (Qiagen). The isolates were not detected in diagnostic PCR assays using specific primers Br1F/L1R for the detection of P. brasiliense (Duarte et al. 2004) and primers EXPCCF/EXPCCR for P. catotovorum subsp. carotovorum (Kang et al. 2003). The 16S rDNA PCR amplification was performed using the universal PCR primer pair 27F/1492R (Fredriksson et al. 2013) and followed by Sanger sequencing (Macrogen Europe BV). The BLASTn analysis of sequences (GenBank Accession Numbers MZ048661, MZ048662, and MZ157274) revealed 100% query coverage and 100% identity to the sequences of Pectobacterium punjabense in NCBI (MT242589 and CP038498) isolated from potato in China and Pakistan (Sarfraz et al. 2018), respectively. All three obtained isolates were proposed to belong to Pectobacterium punjabense sp. nov. To further validate the identification, isolate MMZCVR2 of P. punjabense was selected for multilocus sequence analyses of 5 housekeeping genes (gyrA, recA, recN, rpoA and rpoS). The gyrA (MZ161817), recA (MZ161818), recN (MZ161819), rpoA (MZ161820) and rpoS (MZ161821) sequence analysis showed the highest nucleotide identity (99.44 to 100%) with P. punjabense strain SS95 (Sarfraz et al. 2018) previously deposited in NCBI GenBank database. To our knowledge, this is the first report of blackleg and soft rot caused by P. punjabense on potato in Serbia. Pectobacterium punjabense is a newly described species causing soft rot and blackleg disease in potato plants (Sarfraz et al. 2018). Its current geographic distribution is not well-described but important to know since soft rot bacteria are easily transported long distances in latently infected seed tubers and can cause significant economic losses in potato production worldwide.

scholarly journals First report of Xanthomonas campestris pv. campestris as the causal agent of necrotic leaf spot in Phaseolus vulgaris at Puebla, Mexico

Plant Disease ◽  
2021 ◽  
Author(s):  
Conrado Parraguirre-Lezama ◽  
Omar Romero Arenas ◽  
Maria de los Angeles Valencia de Ita ◽  
Antonio Rivera ◽  
Nemesio Villa-Ruano ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Xanthomonas Campestris ◽  
Casamino Acid ◽  
Bacterial Suspension ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Tetrazolium Chloride ◽  
First Report ◽  
Bean Plants ◽  
Xanthomonas Campestris Pv Campestris

Beans are the most cultivated legume in the world. In Mexico, it is the second most important crop after corn (FAO 2020; SIAP 2020). Bean plants “Flor de Mayo M38” variety were affected by a foliar disease during the agricultural cycle 2019 in Puebla-Mexico (19°02'46.6" LN and 98°05'15.6" LO). Necrotic V- shaped lesions were observed on the margins of the leaves surrounded by yellow halos followed by foliar necrosis, affecting 40% of the crop. In Mexico this variety of cultivars is in great demand for local consumption and generates income in foreign currency (Castellanos et al. 1997). Sampling was carried out on 50 plants “Flor de Mayo M38” variety, with necrotic leaf symptoms from ten plots of one hectare. Samples were cut into pieces (5 mm), disinfested with 1% hypochlorite 3 min, and washed with sterile distilled water. Subsequently, samples were dried on sterile paper and placed on Petri plates containing yeast extract calcium carbonate dextrose agar (YDC) medium and kept at 36°C for 3 days. Colonies of ten typical bacteria isolated from all symptomatic plants were Gram (-), small and uniform in size with rounded edges, yellow, convex with entire borders and mucoid appearance on YDC. Bacteria did not grow on 0.1% triphenyl tetrazolium chloride amended casamino acid, peptone, and glucose medium (CPG). Biochemical tests showed that isolates did not reduce nitrate to nitrites, had positive catalase and starch hydrolysis, while the Kovac oxidase test was negative (Schaad and White 1974). Genus identity of the representative isolate Xcf1-APJR, was confirmed by 16S rRNA encoding gene partial sequencing, using universal primers 518F (5'-CCAGCAGCCGCGGTAATACG-3') and 800R (5′-TACCAGGGTATCTAATCC-3′) (Halim et al. 2020). BLASTn alignments against the nucleotide collection were 100% identical to Xanthomonas sequences including Xanthomonas campestris pv. campestris strains NZ_AP019684.1, CP025750.1, and MN108237.1. The 1,418 bp sequence was deposited in the GenBank database under accession number MT645246. The identification of species/pathovar was accomplished by serological methods using a polyclonal antiserum specific for X. campestris pv. campestris (Popovic ́ et al. 2013) with the DAS-ELISA commercial kit (catalog number 07122C/096, LOEWE Biochemica GmbH, Germany). The pathogenicity test was carried out on 50 healthy bean plants from the "Flor de Mayo M38" variety. Bacterial culture incubated at 28°C for 48 h in YDC medium was used to prepare the bacterial suspension (108 CFU mL-1). The first two lower leaves of 30-day-old plants were inoculated by sprinkling. Ten plants sprayed with sterile distilled water were used as negative control. All plants were kept for 20 days in greenhouse at 18-26°C and relative humidity of 60%. After seven days, chlorotic lesions developed on all inoculated plants that became necrotic from 14 days after inoculation (dai). Necrotic leaf spots merged at 14 dai to form necrotic areas of more than 20 mm in diameter, reaching total necrosis of the leaf tissue at 20 dai and were similar to the symptoms observed in the field. Koch's postulates were confirmed by the reisolation of Xcf1-APJR strain, which presented the same colony morphology, partial sequence, and polyclonal specific detection. This is the first report of this pathogen causing necrotic leaf spot in beans from the "Flor de Mayo M38" variety in Puebla-Mexico. The author(s) declare no conflict of interest. References: FAO. 2020. FAOSTAT. Food and Agriculture Data. http://www.fao.org/faostat/en/#home/. SIAP. 2020. Atlas Agroalimentario. https://www.gob.mx/siap/. Castellanos, J. Z., et al. 1997. Arch. Latinoam. Nutr. 47:163. Schaad, N. W., and White, W. C. 1974. Phytopathology. 64:876. https://doi.org/10.1094/Phyto-64-876 Halim, R. A., et al. 2020. HAYATI J. Biosciences. 27:215. https://doi.org/10.4308/hjb.27.3.215 Popovic ́, T., et al. 2013. Plant Dis. 97:418. https://doi.org/10.1094/PDIS-05-12-0506-PDN

scholarly journals First Report of a Bacterial Soft Rot on Tolumnia Orchids Caused by a Dickeya sp. in the United States

Plant Disease ◽  
2009 ◽  
Vol 93 (12) ◽  
pp. 1354-1354 ◽  
Author(s):  
R. A. Cating ◽  
A. J. Palmateer ◽  
R. T. McMillan ◽  
E. R. Dickstein
Keyword(s):  
Pathogenic Bacteria ◽  
Soft Rot ◽  
The United States ◽  
South Florida ◽  
Nutrient Agar ◽  
Bacterial Suspension ◽  
Brown Pigment ◽  
Rrna Gene ◽  
University Of Florida ◽  
First Report

Tolumnia orchids are small epiphytic orchids grown for their attractive flowers. In the fall of 2008, approximately 100 Tolumnia orchids with soft, brown, macerated leaves were brought to the University of Florida Extension Plant Diagnostic Clinic in Homestead. Ten plants were randomly selected and bacteria were isolated from the margins of symptomatic tissues of each of the 10 plants on nutrient agar according to the method described by Schaad et al. (2). Four reference strains were used in all tests, including the molecular tests: Erwinia carotovora subsp. carotovora (obtained from J. Bartz, Department of Plant Pathology, University of Florida, Gainesville), E. chrysanthemi (ATCC No. 11662), Pectobacterium cypripedii (ATCC No. 29267), and Acidovorax avenae subsp. cattleyae (ATCC No. 10200). All 10 of the isolated bacteria were gram negative, grew at 37°C, degraded pectate in CVP (crystal violet pectate) medium, grew anaerobically, produced brown pigment on NGM (nutrient agar-glycerol-manganese chloride) medium (1), were sensitive to erythromycin, and produced phosphatase. Three of the strains were submitted for MIDI analysis (Sherlock version TSBA 4.10; Microbial Identification, Newark DE) (SIM 0.732 to 0.963), which identified them as E. chrysanthemi. A PCR assay was performed on the 16S rRNA gene with primers 27f and 1495r described by Weisburg et al. (3) from two of the isolates and a subsequent GenBank search showed 99% identity of the 1,508-bp sequence to that of Dickeya chrysanthemi (Accession No. FM946179) (formerly E. chrysanthemi). The sequences were deposited in GenBank (Accession Nos. GQ293897 and GQ293898). Pathogenicity was confirmed by injecting approximately 100 μl of a bacterial suspension at 1 × 108 CFU/ml into leaves of 10 Tolumnia orchid mericlones. Ten plants were also inoculated with water as controls. Plants were placed in a greenhouse at 29°C with 60 to 80% relative humidity. Within 24 h, soft rot symptoms appeared on all inoculated leaves. The water controls appeared normal. A Dickeya sp. was reisolated and identified using the above methods (biochemical tests and MIDI), fulfilling Koch's postulates. To our knowledge, this is the first report of a soft rot caused by a Dickeya sp. on Tolumnia orchids. Although 16S similarity and MIDI results suggest the isolated bacteria are D. chrysanthemi because of its close similarity with other Dickeya spp., these results are not conclusive. Further work should be conducted to confirm the identity of these isolates. Through correspondence with South Florida Tolumnia growers, it appears this disease has been a recurring problem, sometimes affecting international orchid shipments where plant losses have been in excess of 70%. References: (1) Y. A. Lee and C. P. Yu. J. Microbiol. Methods 64:200, 2006. (2) N. W. Schaad et al. Erwinia soft rot group. Page 56 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. American Phytopathological Society. St. Paul, MN, 2001. (3) W. G. Weisburg et al. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Aglaonema Bacterial Blight Caused by Erwinia chrysanthemi in Taiwan

Plant Disease ◽  
2006 ◽  
Vol 90 (10) ◽  
pp. 1358-1358 ◽  
Author(s):  
Y. C. Chao ◽  
C. T. Feng ◽  
W. C. Ho
Keyword(s):  
Bacterial Blight ◽  
Pathogenic Bacteria ◽  
Soft Rot ◽  
The United States ◽  
Erwinia Chrysanthemi ◽  
Blue Pigment ◽  
Pcr Analysis ◽  
Bacterial Suspension ◽  
Pigment Synthesis ◽  
First Report

Aglaonema (Aglaonema spp.) is a popular ornamental potted plant in Taiwan. In 2003, leaves showing soft rot symptoms were found on a number of Sithiporn aglaonema (A. marantifoloum var. tricolor × A. rotundum) plants in a nursery in southern Taiwan. The disease usually started from leaf tips or wounded sites and the affected areas appeared water soaked. The diseased tissue subsequently turned dark brown and became fragile. More than 50% of Sithiporn aglaonema plants were destroyed in the affected nursery. Bacteria isolated from the symptomatic leaves grew at 39°C, degraded pectate, caused soft rot on slices of potato tuber and petioles of Chinese cabbage, produced phosphatase and lecithinase, and utilized malonate, but did not grow in 5% NaCl or produce acid from trehalose. These characteristics were similar to those of Erwinia chrysanthemi Burkholder et al. (1,2) and the reference strain OS2 from Phalaenopsis sp. provided by K. C. Tzeng of National Chung Hsing University, Taichung, Taiwan. Polymerase chain reaction (PCR) analysis using the primer pair 5A (5′ GCGGTTGTTCACCAGGTGTTTT 3′) and 5B (5′ ATGCACGCTACCTGGAAGTAT 3′) specific for E. chrysanthemi (4) confirmed the identity of all seven isolates tested as E. chrysanthemi. The primer pair 5A/5B was designed from the sequences of pT8-1, idg (a gene for blue-pigment synthesis), and pecS (a gene for regulation of pectinase, cellulose, and pigment production). PCR products amplified from E. chrysanthemi DNA with the 5A/5B primer were 500 bp (4). Pathogenicity of isolates was confirmed by rubbing the leaf surface of Sithiporn aglaonema plants with Carborundum and spraying the wounded surface with a bacterial suspension at 1 × 108 CFU/ml in the greenhouse. Plant leaves sprayed with distilled water were used as the control. Three leaves were inoculated for each isolate, and the experiment was conducted twice. Symptoms appeared within 24 h after inoculation. All seven isolates tested were pathogenic, causing an average of 86 to 95% of inoculated leaves to show water-soaked symptoms similar to these observed in nature. Symptoms did not occur on control leaves. E. chrysanthemi was reisolated from diseased tissues of inoculated leaves. To our knowledge, this is the first report of bacterial blight caused by E. chrysanthemi on aglaonema in Taiwan and the first report of the disease on the Sithiporn cultivar of aglaonema. This disease on aglaonema was previously reported in the United States (3). References: (1) R. S. Dickey and A. Kelman. Page 44 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. W. Schaad, ed. The American Phytopathological Society, St. Paul, MN, 1988. (2) M. Goto and K. Matsumoto. Int. J. Syst. Bacteriol. 37:130, 1987. (3) L. A. McFadden. Plant Dis. Rep. 53:253. 1969. (4) M. G. Zhu. Ph.D. diss, National Chung Hsing University, Taichung, Taiwan, 1995.

scholarly journals First Report of Xylella fastidiosa Associated with Leaf Scorch in Black Oak in Washington, D.C.

Plant Disease ◽  
2004 ◽  
Vol 88 (2) ◽  
pp. 224-224 ◽  
Author(s):  
Q. Huang
Keyword(s):  
Xylella Fastidiosa ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Bacterial Suspension ◽  
White Oak ◽  
First Report ◽  
Leaf Petiole ◽  
Leaf Scorch ◽  
Pcr Product ◽  
Black Oak

Bacterial leaf scorch caused by Xylella fastidiosa has been reported in 17 species of oak including bur, pin, red, scarlet, shingle, and white oaks (3). In September 2002, a leaf scorch symptom characterized by marginal necrosis of leaves bordered by a darker brown band was observed in a mature black oak (Quercus velutina Lam.) at the U.S. National Arboretum in Washington, D.C. The leaf petiole of the black oak was processed in general extraction buffer (Agdia, Inc., Elkhart, IN) contained in a FastDNA lysing matrix tube using the FastPrep FP120 instrument (Qbiogene, Inc., Carlsbad, CA) (1). The leaf petiole extract reacted with an antiserum specific for X. fastidiosa (Agadia, Inc.) in an enzyme-linked immunosorbent assay (ELISA). A slow-growing bacterium was cultured from leaf petioles of the affected black oak tree by soaking the surface-sterilized, finely cut leaf petioles in sterile water for 30 min, followed by spreading the bacterial suspension on periwinkle wilt plates (1). When the cultured bacterium was subjected to polymerase chain reaction (PCR) with primers specific for X. fastidiosa (2), a 472-bp PCR product was detected. The PCR product was confirmed to be the predicted X. fastidiosa product by sequencing and sequence comparison with the reported genomic sequence of X. fastidiosa. ELISA and bacterial isolation from leaf petioles of a nearby symptomless white oak (Q. alba L.) tree were negative. To our knowledge, this is the first report of X. fastidiosa associated with leaf scorch in black oak in the United States, expanding the host range of the bacterium in economically important landscape tree species. References: (1) Q. Huang and J. L. Sherald. Curr. Microbiol. 48:73, 2004. (2) M. R. Pooler and J. S. Hartung. Curr. Microbiol. 31:377, 1995. (3) J. L. Sherald. Xylella fastidiosa, A bacterial pathogen of landscape trees. Page 191 in: Shade Tree Wilt Diseases, C. L. Ash, ed. The American Phytopathological Society, 2001.

scholarly journals First Report of Stigmina palmivora Causing Leaf Spots on Phoenix roebelenii in Brazil

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 849-849 ◽  
Author(s):  
A. Colmán ◽  
R. A. da Silva ◽  
R. Alves ◽  
M. Silva ◽  
R. W. Barreto
Keyword(s):  
Pure Culture ◽  
Leaf Surface ◽  
The United States ◽  
Culture Collection ◽  
Commonwealth Mycological Institute ◽  
First Report ◽  
Leaf Spots ◽  
Nucleotide Homology ◽  
Query Coverage ◽  
Representative Samples

Phoenix roebelenii (Arecaceae), known as dwarf date (tamareira-anã in Brazil), is a palm native to Southeast Asia and widely cultivated worldwide because of its ornamental value and ease of adaptation to a broad range of climates and soil types (4). In June 2012, some individuals were observed in a private garden in the municipality of Viçosa (state of Minas Gerais, Brazil) bearing numerous necrotic lesions on its leaves. Representative samples were taken, dried in a plant press, and brought to the laboratory for examination. A fungus was regularly associated with the leaf spots. Fungal structures were mounted in lactophenol and slides were examined under a microscope (Olympus BX 51). Spores were taken from sporulating colonies with a sterile fine needle and plated on PDA for isolation. A pure culture was deposited in the culture collection of the Universidade Federal de Viçosa (accession COAD1338). A dried herbarium sample was deposited in the local herbarium (VIC39741). The fungus had the following morphology: conidiophores grouped on sporodochia, cylindrical, 12 to 29 × 5 to 6 μm, dark brown; conidiogenous cells, terminal, proliferating percurrently (annellidic), 8 to 20 × 5 to 6 μm, pale to dark brown; conidia obclavate to subcylindrical, straight, 58 to 147 × 5 to 6 μm, 6 to 16 septate, hila thickened and darkened with a thin-walled projecting papilla, dark brown, and verrucose. The morphology of the Brazilian collections agrees well with the description of Stigmina palmivora (2), a species known to cause leaf spots on P. roebelenii in the United States (Florida) and Japan (3). Pathogenicity was demonstrated through inoculation of leaves of healthy plants by placing 6 mm diameter cuture disks of COAD1338 on the leaf surface followed by incubation in a moist chamber for 48 h and then transferred to a greenhouse bench at 21 ± 3°C. Typical leaf spots were observed 15 days after inoculation. DNA was extracted from the isolate growing in pure culture and ITS and LSU sequences were generated and deposited in GenBank under the accession numbers KF656785 and KF656786, respectively. These were compared by BLASTn with other entries in GenBank, and the closest match for each region were Mycosphaerella colombiensis strain X215 and M. irregulariamosa strain CPC 1362 (EU514231, GU2114441) with 93% of nucleotide homology (over 100% query coverage) for ITS and 98% of nucleotide homology (over 100% query coverage) for LSU. There are no sequences for S. palmivora deposited in public databases for comparison, but for Stigmina platani, the type species in this genus, 86% and 96% nucleotide homology for ITS and LSU with S. palmivora were found. The genus Stigmina is regarded as being polyphyletic (1) and this is probably reflected by these low homology levels found in the BLASTn search. To our knowledge, this is the first report of Stigmina palmivora in Brazil. References: (1) P. W. Crous et al. Stud. Mycol. 75:37, 2012. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Commonwealth Mycological Institute, Kew, UK, 1971. (3) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab. ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , 2013. (4) H. Lorenzi et al. Palmeira no Brasil: Exóticas e Nativas, 2nd ed. Editora Plantarum, Nova Odessa, Brazil, 2005.

Sign in / Sign up

Export Citation Format

Share Document