First Report of Pectobacterium punjabense causing potato soft rot and blackleg in Serbia

Soft rot and blackleg are common diseases affecting potato (Solanum tuberosum) production in Serbia. Pectinolytic plant pathogens belonging to the genera Pectobacterium cause soft rot and wilt diseases by plant cell wall degradation. These opportunistic phytopathogens lead to considerable economic losses in many potato-growing regions worldwide and are listed among top 10 plant pathogenic bacteria (Mansfield et al. 2012). Potato plants (cv. VR808) with symptoms of wilting, slow growth, stem blackening and tubers softening, were collected from a commercial potato field in Zobnatica (Serbia) in July 2019 and subjected to analysis. All symptoms occurred in the same field and the incidence of symptomatic plants was approximately 5%. Isolation was performed from 10 randomly chosen potato plant and tuber samples, expressing wilting and soft rot symptoms. Plant tissue was surface-disinfected and 1 cm length sections from the margins of lesions were macerated in sterile distilled water for 25 min and streaked on nutrient-agar medium. After 48 h of incubation at 26°C, predominant shiny, cream-colored, round colonies were obtained from all samples. Three representative isolates (MMZKVR1, MMZCVR2, and MMZKVR3) from independent samples were selected randomly and subjected to biochemical and pathogenicity tests. Isolates were gram-negative, nonfluorescent facultative anaerobes, exhibiting pectinolytic activity on potato tuber slices and hypersensitive response on tobacco leaves. They expressed catalase activity but did not express oxidase or acid phosphatase activity or produce indole. All strains grew at 37°C, in 5% NaCl, and reduced nitrate. Pathogenicity of the obtained isolates was tested on 3-week-old healthy potato plants (cv. VR808 and cv. Kiebitz) grown in commercial Baltic Tray Substrate (Hawita) in the greenhouse, as well as on potato tubers of the same varieties. Three potato plant stems per isolate were inoculated by the toothpick piercing method (Duarte et al. 2004) using bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated plants were incubated under plastic bags in a greenhouse at 25 ± 2°C. Blackleg symptoms and stem wilting developed 48 hours after inoculation. No symptoms were observed on plants inoculated with sterile toothpicks dipped in sterile distilled water. The pathogen was re-isolated from symptomatic plants, fulfilling Koch's postulates and sequencing of 16S rDNA confirmed the originally isolated pathogen. Three potato tubers per isolate were inoculated by toothpicks dipped in bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated tubers were placed in a sealed plastic container at 25 ± 2°C. Treatment with sterile distilled water was used as a negative control. Softening of the tissue around the inoculation point developed within 48 h from inoculation, and no symptoms developed on the control tubers. For molecular analyses, total DNA of the isolates was extracted using the DNeasy Plant Mini Kit (Qiagen). The isolates were not detected in diagnostic PCR assays using specific primers Br1F/L1R for the detection of P. brasiliense (Duarte et al. 2004) and primers EXPCCF/EXPCCR for P. catotovorum subsp. carotovorum (Kang et al. 2003). The 16S rDNA PCR amplification was performed using the universal PCR primer pair 27F/1492R (Fredriksson et al. 2013) and followed by Sanger sequencing (Macrogen Europe BV). The BLASTn analysis of sequences (GenBank Accession Numbers MZ048661, MZ048662, and MZ157274) revealed 100% query coverage and 100% identity to the sequences of Pectobacterium punjabense in NCBI (MT242589 and CP038498) isolated from potato in China and Pakistan (Sarfraz et al. 2018), respectively. All three obtained isolates were proposed to belong to Pectobacterium punjabense sp. nov. To further validate the identification, isolate MMZCVR2 of P. punjabense was selected for multilocus sequence analyses of 5 housekeeping genes (gyrA, recA, recN, rpoA and rpoS). The gyrA (MZ161817), recA (MZ161818), recN (MZ161819), rpoA (MZ161820) and rpoS (MZ161821) sequence analysis showed the highest nucleotide identity (99.44 to 100%) with P. punjabense strain SS95 (Sarfraz et al. 2018) previously deposited in NCBI GenBank database. To our knowledge, this is the first report of blackleg and soft rot caused by P. punjabense on potato in Serbia. Pectobacterium punjabense is a newly described species causing soft rot and blackleg disease in potato plants (Sarfraz et al. 2018). Its current geographic distribution is not well-described but important to know since soft rot bacteria are easily transported long distances in latently infected seed tubers and can cause significant economic losses in potato production worldwide.

Download Full-text

First Report of Candidatus Phytoplasma solani Associated with Potato Plants in Greece

Plant Disease ◽

10.1094/pdis-05-14-0488-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1739-1739 ◽

Cited By ~ 3

Author(s):

M. C. Holeva ◽

P. E. Glynos ◽

C. D. Karafla ◽

E. M. Koutsioumari ◽

K. B. Simoglou ◽

...

Keyword(s):

16S Rdna ◽

Nested Pcr ◽

Pathogenic Bacteria ◽

Related Strain ◽

Northern Greece ◽

First Report ◽

Potato Plants ◽

Pcr Product ◽

16S Rdna Pcr ◽

Stolbur Phytoplasma

In August 2013, potato plants (Solanum tuberosum) cv. Banba displaying symptoms resembling those caused by Candidatus Phytoplasma solani (potato stolbur phytoplasma) were observed in a 2-ha field in the area of the Peripheral Unit of Drama (northern Greece). The plants were 10 weeks old and their symptoms included reddening and upward rolling of leaflets, reduced size of leaves, shortened internodes, and aerial tuber formation. Incidence of affected plants was estimated to be 40% in the field. Four symptomatic potato plants were collected for laboratory testing of possible phytoplasma infection. From each of these four plants, total DNA was extracted from mid veins of reddish leaflets from apical shoot parts and of leaflets emerging from aerial tubers, using a phytoplasma enrichment procedure (1). A nested PCR using the phytoplasma universal 16S rRNA primer pairs: P1/P7 followed by R16F2n/R16R2 (3) amplified the expected ~1.2-kb 16S rDNA fragment in all four symptomatic potato plants. No amplification was observed with DNA similarly extracted from leaflets of asymptomatic potato plants of the same variety collected from an apparently healthy crop. One of the four 1.2-kb nested 16S rDNA PCR products was gel purified, cloned into the pGEM-T-easy plasmid vector (Promega, Madison, WI), and sequenced by Beckman Coulter Genomics (United Kingdom). At least twofold coverage per base position of the cloned PCR product was achieved. BLAST analysis showed that the obtained sequence of the PCR 16S rDNA product was: i) 100% identical to several GenBank sequences of Ca. P. solani strains, including strains detected previously in Greece infecting tomato (GenBank Accession No. JX311953) and Datura stramonium (HE598778 and HE598779), and ii) 99.7% similar to that of the Ca. P. solani reference strain STOL11 (AF248959). Furthermore, analysis by iPhyClassifier software showed that the virtual restriction fragment length polymorphism (RFLP) pattern of the sequenced PCR 16S rDNA product is identical (similarity coefficient 1.00) to the reference pattern of the 16SrXII-A subgroup (AF248959). The sequence of this PCR product was deposited in NCBI GenBank database under the accession no. KJ810575. The presence of the stolbur phytoplasma in all four symptomatic potato plants examined was further confirmed by nested PCR using the stolbur-specific STOL11 primers (3) targeting non-ribosomal DNA. Based on the observed symptoms in the field and laboratory molecular examinations, we concluded that the potato plants were infected by a Ca. P. solani related strain. The stolbur disease has been previously reported in Greece affecting tomato (2,5) and varieties of D. stramonium (4). To our knowledge, this is the first report of a Ca. P. solani related strain infecting a potato crop in Greece. As northern Greece is a center of potato production, the source of this pathogen is to be investigated. References: (1) U. Ahrens and E. Seemuller. Phytopathology 82:828, 1992. (2) A. S. Alivizatos. Pages 945-950 in: Proceedings of the 7th International Conference of Plant Pathogenic Bacteria. Academiai Kiado, Budapest, Hungary, 1989. (3) J. Jović et al. Bull. Insectol. 64:S83, 2011. (4) L. Lotos et al. J. Plant Pathol. 95:447, 2013. (5) E. Vellios and F. Lioliopoulou. Bull. Insectol. 60:157, 2007.

Download Full-text

First Report of a Soft Rot of Phalaenopsis aphrodita Caused by Dickeya dieffenbachiae in China

Plant Disease ◽

10.1094/pdis-11-11-0942 ◽

2012 ◽

Vol 96 (5) ◽

pp. 760-760 ◽

Cited By ~ 8

Author(s):

J. N. Zhou ◽

B. R. Lin ◽

H. F. Shen ◽

X. M. Pu ◽

Z. N. Chen ◽

...

Keyword(s):

16S Rdna ◽

Large Scale ◽

Soft Rot ◽

The Philippines ◽

Gyrb Gene ◽

Bacterial Suspension ◽

Sterile Water ◽

Gene Sequences ◽

First Report ◽

Tropical Asia

Phalaenopsis orchids, originally from tropical Asia, are mainly planted in Thailand, Singapore, Malaysia, the Philippines, and Taiwan and have gained popularity from consumers all over the world. The cultivation area of Phalaenopsis orchids has been rising and large-scale bases have been established in mainland China, especially South China because of suitable environmental conditions. In September 2011, a soft rot of Phalaenopsis aphrodita was found in a Phalaenopsis planting base in Guangzhou with an incidence of ~15%. Infected plants initially showed water-soaked, pale-to-dark brown pinpoint spots on leaves that were sometimes surrounded by a yellow halo. Spots expanded rapidly with rising humidity and temperatures, and in a few days, severely extended over the blade with a light tan color and darker brown border. Lesions decayed with odorous fumes and tissues collapsed with inclusions exuding. The bacterium advanced to the stem and pedicle. Finally, leaves became papery dry and the pedicles lodged. Six diseased samples were collected, and bacteria were isolated from the edge of symptomatic tissues after sterilization in 0.3% NaOCl for 10 min, rinsing in sterile water three times, and placing on nutrient agar for culture. Twelve representative isolates were selected for further characterization. All strains were gram negative, grew at 37°C, were positive for indole production, and utilized malonate, glucose, and sucrose but not glucopyranoside, trehalose, or palatinose. Biolog identification (version 4.20.05, Hayward, CA) was performed and Pectobacterium chrysanthemi (SIM 0.868) was confirmed for the tested isolates (transfer to genus Dickeya). PCR was used to amplify the 16S rDNAgene with primers 27f and 1492r, dnaX gene with primers dnaXf and dnaXr (3), and gyrB gene with primers gyrBf (5′-GAAGGYAAAVTKCATCGTCAGG-3′) and gyrB-r1 (5′-TCARATATCRATATTCGCYGCTTTC-3′) designed on the basis of the published gyrB gene sequences of genus Dickeya. BLASTn was performed online, and phylogeny trees (100% bootstrap values) were created by means of MEGA 5.05 for these gene sequences, respectively. Results commonly showed that the representative tested strain, PA1, was most homologous to Dickeya dieffenbachiae with 98% identity for 16S rDNA(JN940859), 97% for dnaX (JN989971), and 96% for gyrB (JN971031). Thus, we recommend calling this isolate D. dieffenbachiae PA1. Pathogenicity tests were conducted by injecting 10 P. aphrodita seedlings with 100 μl of the bacterial suspension (1 × 108 CFU/ml) and another 10 were injected with 100 μl of sterile water as controls. Plants were inoculated in a greenhouse at 28 to 32°C and 90% relative humidity. Soft rot symptoms were observed after 2 days on the inoculated plants, but not on the control ones. The bacterium was isolated from the lesions and demonstrated identity to the inoculated plant by the 16S rDNA sequence comparison. Previously, similar diseases of P. amabilis were reported in Tangshan, Jiangsu, Zhejiang, and Wuhan and causal agents were identified as Erwinia spp. (2), Pseudomonas grimontii (1), E. chrysanthemi, and E. carotovora subsp. carovora (4). To our knowledge, this is the first report of D. dieffenbachiae causing soft rot disease on P. aphrodita in China. References: (1) X. L. Chu and B. Yang. Acta Phytopathol. Sin. 40:90, 2010. (2) Y. M. Li et al. J. Beijing Agric. Coll. 19:41, 2004. (3) M. Sławiak et al. Eur. J. Plant Pathol. 125:245, 2009. (4) Z. Y. Wu et al. J. Zhejiang For. Coll. 27:635, 2010.

Download Full-text

First report of stalk bacterial soft rot of sugarcane caused by Dickeya zeae in China

Plant Disease ◽

10.1094/pdis-10-20-2234-pdn ◽

2020 ◽

Author(s):

yanchang Yang ◽

Ziting Yao ◽

Mu-Qing Zhang ◽

Chengwu Zou ◽

Baoshan Chen

Keyword(s):

Pure Water ◽

Bacterial Species ◽

Evolutionary Relationship ◽

Soft Rot ◽

Bacterial Suspension ◽

Rrna Gene ◽

Post Inoculation ◽

Distilled Water ◽

Sugarcane Cultivar ◽

First Report

In late September 2019, seven stalks of about 1400 stalks of sugarcane cultivar Zhongzhe 1 exhibited soft rot symptoms in a trial plot in Beihai city, Guangxi province of China. Symptoms included scorched and collapsed leaves, maceration of stalks, and sour smelling exudates from the stalks (Supplementary Fig. S1). Severely diseased stalks had collapsed and were dead. Internal stalk fragments of 5 × 5 mm were collected at the junction of healthy and diseased tissue after surface-sterilization of stalks with 70% ethanol for one minute, and three times rinsing with sterile distilled water. Stalk fragments were placed on Luria–Bertani agar medium (1 % w/v tryptone, 0.5 % w/v yeast extract, 1 % w/v NaCl, 1 % w/v agar, pH7.0) and plates were put in an incubator at 30°C for 48h. Four types of bacterial colonies were obtained, and small and white colonies with irregular margins were the most dominant. A single colony of each type was diluted in sterile distilled water and aliquots of each suspension were streaked on fresh medium plates to obtain pure cultures. Ten eight-week-old stalks (11 th leaf stage) of sugarcane plants, which derived from cuttings of symptomless cultivar Zhongzhe 1, were inoculated by injection of 300 μl of bacterial suspension (3.5x108 CFU/ml) into the stalks. Another 10 stalks were injected with pure water and served as control. The inoculated plants were kept in a greenhouse at 25-37℃.Among the four types of bacteria, only strain BH9 induced symptoms that were identical to those of diseased canes observed in the field (Supplementary Fig. S1). Elongated water-soaked lesions were observed around the inoculation sites three days post inoculation. Five of the 10 BH9-inoculated plants had collapsed two days later. Water-soaked stalks had a sour smell similar to the filed diseased plants. Eight days post inoculation, all BH9-inoculated plants exhibited symptoms but control plants remained symptomless up to 30 days after inoculation. Uniform white colonies with irregular margins were isolated from the inoculated stalks that developed soft rot symptom, and these bacteria caused again stalk soft rot symptoms when inoculated to a new batch of 10 healthy plants. The 16S rRNA gene of strain BH9 was amplified by PCR with primer pair fD2/rP1 and the PCR amplicons from three independent colonies were sequenced. The sequences of the three amplicons were identical (Accession No. MT723897). BLAST alignments of the 16S rDNA sequence from BH9 strain with the GenBank database revealed that BH9 belonged to the genus Dickeya (98.5% identity between D. zeae BH9 and D. zeae EC1). Further PCR assays and sequencing of three genes, DNA polymerase III gamma subunit gene dnaX with primers dnaXf/dnaXr, DNA gyrase gene gyrB with primers gyrBf1/gyrBr1, and recombinase A gene recA with primers recAf/recAr, were performed to identify the species within the genus Dickeya (Zhang et al., 2014). BH9 sequences of these genes (Accession No. MT723898 to MT723900) had highest identity (97.5%, 97.6%, and 97.7%, respectively) with those from D. zeae EC1 (GenBank accession No. CP006929.1). To determine the evolutionary relationship of BH9 to other Dickeya species and strains, a phylogenetic analysis was performed using dnaX, gyrB, and recA sequences. As shown in Supplementary Fig. S2, BH9 clustered with D. zeae strains and formed a lineage distinguishable from other Dickeya species. Among the closest strains, D. zeae NCPPB3531 (Accession No. CM001980.1) was isolated from potato and D. zeae CSL RW192 (Accession No. CM001972.1) from river water (Pritchard et al., 2013). Consequently, strain BH9 was identified as D. zeae. This bacterial species has been reported to cause soft rot in rice (Pu et al., 2012), banana (Zhang et al., 2014), maize (Martinez-Cisneros et al., 2014), and clivia (Hu et al., 2018). To the best of our knowledge, this is the first report of a bacterial stalk rot caused by D. Zeae in sugarcane. In fact, low incidence of D. zeae-caused stalk soft rot was recently found in sugarcane fields in Fusui County, about 150 km north to Beihai. Given the potential threat of this disease to the local sugarcane industry, the mode of transmission, cultivar resistance, and measures to control the disease should be investigated.

Download Full-text

First Report of Crown Gall, Caused by Agrobacterium tumefaciens on Soapberry (Sapindus delavayi) in China

Plant Disease ◽

10.1094/pdis-10-12-0988-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 685-685

Author(s):

Y. J. Wang ◽

Y. Y. He ◽

Z. Xie ◽

L. Q. Zhang

Keyword(s):

Agrobacterium Tumefaciens ◽

16S Rdna ◽

Crown Gall ◽

Maximum Parsimony Analysis ◽

Bacterial Suspension ◽

Identification System ◽

Distilled Water ◽

Bacterial Identification ◽

Poor Growth ◽

First Report

Soapberry (Sapindus delavayi (Franch.) Radlk.,) plants are widely grown as shade trees in the subtropical to tropical regions of China. In July 2011, large, aerial galls were observed on the above-ground trunks of 5-year-old soapberry plants in two commercial nursery gardens located in Zhejiang Province. Disease incidence was estimated to be 75%. The galls varied in weight from 2 to 24 g and in texture from soft and spongy to hard, and in some cases, the galls completely girdled the trunk. The trees with galls exhibited poor growth compared with healthy trees. Isolations from the grinded and macerated galls yielded nearly pure white, circular, and glistening bacterial colonies on Roy Sauer medium (2). Six random colonies from different galls were selected for bacterial identification, and showed the same morphological, physiological, and biochemical characters and 16S rDNA sequences. All six isolates (isolate SD01 to SD06) were gram negative, rod-shaped bacteria. Carbon source utilization testing with the Biolog GN Bacterial Identification System (version 3.50) confirmed the bacteria as Agrobacterium tumefaciens with a similarity of 0.90. The most-parsimonious tree from the maximum parsimony analysis (PHYLIP package, version 3.68, 500 replicates) of bacterial 16S rDNA gene sequences showed that A. tumefaciens SD01 (GenBank Accession No. JX997939) clustered phylogenetically most closely (99.5% similarity) with A. tumefaciens C58 (AE007870.2). Pathogenicity was confirmed by injecting 3- to 5-week old tomato and sunflower plants and 2-year-old soapberry with approximately 5 μl of the bacterial suspension (108 CFU/ml) in sterile, distilled water. Sterile distilled water was used as a negative control. Ten plants of each treatment were inoculated. Inoculated plants were then transferred to a greenhouse at 25°C. Typical tumors developed at the inoculation sites on tomatoes and sunflower plants 3 weeks after inoculation and on soapberry 6 weeks after inoculation. No symptoms were observed on the control plants. The bacteria that were readily reisolated from the inoculated plants exhibited the same morphological, physiological characters and 16S rDNA sequence as the original culture and were confirmed as A. tumefaciens, fulfilling Koch's postulates. A. tumefaciens is endemic to China and has a very wide host range (1). However, crown gall of soapberry has never been found in China and other countries. To our knowledge, this is the first report of A. tumefaciens on soapberry plants in China. References: (1) M. A. Escobar and A. M. Dandekar. Trends Plant Sci. 8:380, 2003. (2) L. W. Moore et al. Page 17 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001.

Download Full-text

First Report of Leaf Blight on Saposhnikovia divaricata by Pseudomonas viridiflava in Gansu, China

Plant Disease ◽

10.1094/pdis-06-14-0641-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 281-281 ◽

Cited By ~ 1

Author(s):

Y. Wang ◽

C. Y. Zeng ◽

X. R. Chen ◽

C. D. Yang

Keyword(s):

16S Rdna ◽

Leaf Blight ◽

Gansu Province ◽

Rdna Sequence ◽

Bacterial Suspension ◽

Distilled Water ◽

16S Rdna Sequence ◽

First Report ◽

Saposhnikovia Divaricata ◽

The Impact

Saposhnikovia divaricata (Turcz) Schischk, a perennial plant in the Umbelliferae, is widely cultivated in north China. As a traditional Chinese medicine, it can be used to cure colds and rheumatism (1). During disease surveys on medicinal plants in August 2010, a bacterial leaf blight was discovered with a general incidence of 40 to 60% on S. divaricata farms in Longxi, Weiyuan County in Gansu China. In young plants, tiny yellow-white points were visible on the backs of the leaves. They then expanded to 2- to 3-mm oil-soaked lesions; leaves appeared crimped and deformed. Later the leaves shriveled; black-brown oil-soaked lesions appeared on the vein and the tissue around it; and black streaks appeared on the stems. Ten diseased leaf and stem tissues were cut into 4- to 5-mm squares, surface-sterilized in 1% sodium hypochlorite for 1 min, rinsed three times, and macerated for 5 min in sterilized distilled water. They were then streaked onto nutrient agar (NA) medium and incubated at 28°C for 3 days. Colonies on NA were round, smooth, translucent, and yellowish green. They were Gram negative and induced a hypersensitive response on tobacco (Nicotiana tabacum L.) leaves. The strain was positive for gelatin, catalase, oxidase, and utilization of glucose and saccharose. Pathogenicity tests were performed by spraying bacterial suspension containing 107 CFU/ml on six leaves of three healthy potted S. divaricata plants and injecting it into another six leaves on three plants. Plants inoculated with sterile distilled water alone served as controls. They were placed in a growth chamber at 25°C and bagged for 24 h to maintain >95% humidity. Thirty-six hours after inoculation, the inoculated leaves appeared water-soaked; 10 days later, the symptoms were apparent on leaves and the plant wilted. The negative control appeared normal. Finally, Koch's postulates were verified by re-isolating P. viridiflava from the leaves with typical blight. The genomic DNA of the isolate was extracted, and the partial 16S rDNA sequence was amplified with a universal bacterial primer set (27f and 1492r) (2). The sequence was deposited in GenBank as KM030291. BLAST search yielded 99% identity with P. viridiflava strains, including the strains KNOX209 (AY604847), RMX3.1b (AY574911), ME3.1b (AY574909), and UASWS0038 (AY919300). Based on the symptoms, colony morphology, biochemical tests, and 16S rDNA sequence identity, the pathogen was identified as P. viridiflava. To our knowledge, this is the first report of leaf blight of S. divaricata by P. viridiflava in Gansu province of China. In Jilin province, the same disease was reported in 2008 (3). The impact of P. viridiflava on S. divaricata production is not yet known. References: (1) Committee of China Pharmacopoeia. Pharmacop. People's Repub. 1:102, 2005. (2) C. Morenol et al. Microbiology 148:1233, 2002. (3) W. Xue. Dissertation. Jilin Agric. Univ. 1, 2008.

Download Full-text

First Report of Dickeya fangzhongdai Causing Peduncle Soft Rot of Banana in China

Plant Disease ◽

10.1094/pdis-11-21-2513-pdn ◽

2021 ◽

Author(s):

Di Yang ◽

Chan Juan Du ◽

Yunfeng Ye ◽

Lian Fu Pan ◽

Jin Zhang ◽

...

Keyword(s):

16S Rdna ◽

Dna Sequences ◽

Southern China ◽

Intergenic Spacer ◽

Soft Rot ◽

Bacterial Suspension ◽

Sterile Water ◽

Internal Tissue ◽

Flower Bud ◽

First Report

Banana (Musa spp.) is a popular fruit all over the world, and it’s also an important cash crop with a planting area of 358,924 ha in southern China. In July 2020, a peduncle soft rot disease occurred on dwarf banana (Musa sp. cv. Guangfen) in Guigang city (N22°50'29″, E109° 43'34″), Guangxi province, China. More than 20% plants were infected in the banana plantation. The first external sign of the disease appeared on the incisional wound after the flower bud was cut off from the peduncle. The symptom initially appeared as a black lesion on the wound, then extended into the internal tissue of the whole peduncle. In the later stages, the internal tissue became soft and rot, occasionally formed a necrotic cavity, and eventually led to the black rot of the whole peduncle with a foul smell. To isolate the pathogen, the internal lesion tissues of 5 mm × 5 mm were collected between the border of symptomatic and healthy tissue, treated with 75% ethanol for 10 s, and 0.1% HgCl2 for 3 min, then rinsed with sterile water for three times. Sterilized tissue fragments were cut to pieces with sterilized surgical shears and soaked in 5 mL sterile water, then shaken for 10 min in a vortex oscillator. The suspension was diluted 1000 times with sterilized water，then plated on nutrient-agar medium and incubated at 28℃ in darkness for 24 h. Among the 32 isolates, 23 pure bacterial cultures with similar morphology were predominantly obtained from the samples. These bacteria were gram-negative, and their colonies were initially yellowish white with irregular edges and smooth surfaces, then turned to grayish blue after 72 h incubated at 28℃. The representative isolates GZF2-2 and GZF1-8 were selected for further identification. Genomic DNA was isolated from the bacteria and the 16S rDNA was amplified with primers 27F/1492R (Weisburg et al. 1991) and sequenced. The obtained sequences (GenBank Accession No. MZ768922 and OK668082) showed >99% identities to several records of Dickeya fangzhongdai deposited in NCBI GenBank (1400/1404 bps for GZF2-2 to KT992690, 1409/1417 bps for GZF1-8 to MT613398) based on BLAST analysis. In addition, the recA, fusA, gapA, purA, rplB, dnaX genes and the 16S-23S intergenic spacer (IGS) regions of the two isolates were also amplified and sequenced (GenBank Accession Nos. OK634381-OK634382, OK634369- OK634370, OK634373-OK634374, OK634377-OK634378, OK634385-OK634386, OK634365- OK634366 and OK631722-OK631723) as described by Tian et al. (2016). All the DNA sequences matched that of D. fangzhongdai strains JS5T (percent identities>99.06%), PA1 and ECM-1 in GenBank. Neighbor-joining phylogenetic analysis by software MegaX (Kumar et al. 2018) based on the 16S rDNA sequences revealed that the two isolates were in the same clade with reported D. fangzhongdai strains. Multilocus sequence analysis of the other seven regions also showed the two representative isolates were belong to D. fangzhongdai. Therefore, the isolates were identified as D. fangzhongdai. Pathogenicity of isolate GZF2-2 was investigated to demonstrate Koch’s postulate. The end of the banana peduncles of 6 healthy plants were cut off, and 10 mL bacterial suspension (108 CFU/mL) was inoculated to the fresh wound on the plants using sterile brushes. Six control plants were inoculated with sterilized water. All the inoculated peduncles were covered with plastic bags to maintain high humidity. After 28 days, all the peduncles inoculated with strain GZF2-2 showed soft rot symptoms similar to those observed in the field, while the controls remained symptomless. The same bacteria were re-isolated from the symptomatic peduncles and confirmed by sequencing the 16S rDNA. D. fangzhongdai has been reported to cause soft rot on onion (Ma et al. 2020) and bleeding cankers on pear trees (Chen et al. 2020). To the best of our knowledge, this is the first report of D. fangzhongdai causing peduncle soft rot on banana in China.

Download Full-text

First Report of a Leaf Spot of Radermachera sinica in China Caused by Bacillus megaterium

Plant Disease ◽

10.1094/pdis-05-14-0469-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1425-1425 ◽

Cited By ~ 3

Author(s):

Y. L. Li ◽

Z. Zhou ◽

Y. C. Yuan ◽

J. R. Ye

Keyword(s):

16S Rdna ◽

Bacillus Megaterium ◽

Leaf Spot ◽

Disease Incidence ◽

Bacterial Suspension ◽

Distilled Water ◽

Biochemical Tests ◽

16S Rdna Gene ◽

First Report ◽

Rdna Gene

Radermachera sinica is widely planted as an ornamental plant in homes, offices, and malls in China. A leaf spot of R. sinica occurred in Luoyang, China, from 2013 to 2014. Lesions mostly occurred in wounds and were irregular with light brown centers and purple borders. One or more lesions on a leaf sometimes covered the entire blade. Eighty plants were surveyed in Luoyang, with disease incidence of 17%. Five millimeter pieces from the borders of lesions were surface-disinfected with 75% ethanol for 30 s, 1% sodium hypochlorite for 5 min, washed three times in sterilized distilled water, placed on nutrient agar (NA) medium at 25°C in darkness, and incubated for 24 to 48 h. Four white, round, smooth, and shiny colonies were selected for further identification. All strains were gram-positive, aerobic rods with many peritrichous flagella, and could grow in medium containing 5% NaCl. The strains were positive for catalase, starch hydrolysis, liquefaction of gelatin, reduction of nitrate, acid production from glucose, mannitol, maltose, lactose, xylose, and pectinose. The strains were positive for phenylalanine deaminase, decomposition of tyrosine, and utilization of citrate. The strains were identified by biochemical tests as Bacillus megaterium (1). To confirm pathogenicity, the strains were grown on NA for 48 h and suspended in sterile distilled water to produce a suspension with a final concentration of 108 CFU/ml. Healthy leaves of biennial R. sinica plants were sterilized with 75% ethanol and washed three times with sterilized distilled water. Fresh wounds were made with a sterile needle on the healthy leaves. Each of four strains was tested by spray inoculation with a bacterial suspension on three leaves. Sterile distilled water was used as negative control. Plants were enclosed in plastic bags and placed in a growth chamber at 28°C with 80% relative humidity. After 5 days, water-soaked lesions were observed. Two weeks later, lesions 4 mm in diameter turned light brown with purple borders, and most of lesions occurred in puncture wounds. Symptoms similar to those observed on field plants developed on all inoculated leaves, while no symptoms appeared on the control leaves. B. megaterium was re-isolated from the lesions of inoculated leaves, but not from the control leaves. To confirm the bacterial identification, PCR was performed on the 16S rDNA gene with P1/P2 (P1: CAGAGTTTGATCCTGGCT, P2: AGGAGGTGATCCAGCCGCA) (2) and 1,463 bp of the 16S rDNA gene (GenBank Accession No. KJ789369) showed 100% sequence identity to B. megaterium DSM 319 (NC_014103.1). To our knowledge, this is the first report of a leaf spot of R. sinica caused by B. megaterium in China as well as anywhere in the world. References: (1) P. Vos et al. Bergey's Manual of Systematic Bacteriology. Vol 3: The Firmicutes. Springer, 2009. (2) W. G. Weisbury et al. J. Bacteriol. 173:697, 1991.

Download Full-text

First Report of Pectobacterium versatile Causing Aerial Stem Rot of Potato in China

Plant Disease ◽

10.1094/pdis-06-21-1264-pdn ◽

2021 ◽

Author(s):

Wanxin Han ◽

Jinhui Wang ◽

Zheng Li ◽

Yang Pan ◽

Dai Zhang ◽

...

Keyword(s):

16S Rdna ◽

Disease Incidence ◽

New York State ◽

Housekeeping Genes ◽

Soft Rot ◽

Stem Rot ◽

Post Inoculation ◽

First Report ◽

Potato Plants ◽

Aerial Stem

Pectobacterium species cause blackleg, soft rot and stem rot in potato and many other vegetable crops (Charkowski 2015). In July 2020, potato plants showing characteristic symptoms of aerial stem rot were observed in a field (cv. Xisen 6) in Fengning Manchu Autonomous County, Chengde, Hebei Province (North China). The disease incidence in that field (5 ha in size) was more than 50%. Putative pectolytic bacteria were obtained from symptomatic stem tissues (light brown and water-soaked stem sections) by culturing on the crystal violet pectate (CVP) medium. Bacterial colonies producing pits, were restreaked and purified on Luria-Bertani (LB) agar. The isolates causing stem rot were gram negative and rod shaped, negative for oxidase, urease, indole production, gelatin liquefaction and acid production from maltose and D-sorbitol. All isolates were catalase positive, produced acid from lactose, rhamnose, saccharose, raffinose and D-arabinose, and were tolerant to 5% NaCl, and able to utilize citrate. The bacterial gDNA was extracted using the EasyPure Bacteria Genomic DNA Kit (TransGen Biotech). The 16S rDNA region was amplified by PCR using the universal primer pair 27F/1492R and sequenced. Result of the Blastn analysis of the 16S rDNA amplicons (MZ379788, MZ379789) suggested that the isolates FN20111 and FN20121 belonged to the genus Pectobacterium. To determine the species of the stem rot Pectobacterium isolates, multi-locus sequence analysis (MLSA) was performed with six housekeeping genes acnA, gapA, icdA, mdh, proA and rpoS (MZ403781-MZ403792), and phylogenetic tree was reconstructed using RAxML v8.2.12 (https://github.com/stamatak/standard-RAxML). The result of phylogenetic analysis showed that the stem rot Pectobacterium isolates FN20111 and FN20121 clustered with P. versatile (syn. ‘Candidatus Pectobacterium maceratum’) strains CFBP6051T (Portier et al. 2019), SCC1 (Niemi et al. 2017) and F131 (Shirshikov et al. 2018). And the isolates FN20111 and FN20121 were more closely related to the type strain CFBP6051T than to strains SCC1 and F131. Potato seedlings (cv. Xisen 6 and Favorita) were inoculated with the isolates FN20111 and FN20121 by injecting 100 µl of bacterial suspensions (108 CFU·mL-1) into the upper parts of the stems of potato plants, or injected with 100 µl of 0.9% saline solution as control. The seedlings were grown at 28°C and 50% relative humidity. Three days post-inoculation, only the bacteria-inoculated seedlings showed diseased symptoms resembling to those observed in the field. Bacterial colonies were obtained from the infected stems and were identified using the same PCR primers of housekeeping genes as described above, fulfill Koch’s postulates. P. versatile causing soft rot and blackleg on potato plants has been reported in Finland (Niemi et al. 2017), Russia (Shirshikov et al. 2018), Netherlands (Portier et al. 2019), Poland (Waleron et al. 2019) and in New York State (Ma et al. 2021). To our knowledge, this is the first report of P. versatile causing aerial stem rot of potato in China.

Download Full-text

Occurrence of Potato Soft Rot Caused by Erwinia carotovora (synonym Pectobacterium carotovorum) in Nepal: A First Report

Plant Disease ◽

10.1094/pdis-94-3-0382c ◽

2010 ◽

Vol 94 (3) ◽

pp. 382-382 ◽

Cited By ~ 1

Author(s):

J. R. Lamichhane ◽

G. M. Balestra ◽

L. Varvaro

Keyword(s):

16S Rdna ◽

Solanum Tuberosum L ◽

Erwinia Carotovora ◽

Soft Rot ◽

Bacterial Suspension ◽

Potato Tubers ◽

Biochemical Tests ◽

Wide Range ◽

Fundamental Value ◽

Negative Controls

Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.

Download Full-text

First Report of Potato Blackleg Disease Caused by Pectobacterium atrosepticum in Guangdong China

Plant Disease ◽

10.1094/pdis-03-13-0275-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1652-1652

Author(s):

X. M. She ◽

Z. F. He ◽

Y. F. Tang ◽

Z. G. Du ◽

G. B. Lan

Keyword(s):

16S Rdna ◽

Vascular Tissue ◽

Guangdong Province ◽

Bacterial Suspension ◽

Post Inoculation ◽

Blackleg Disease ◽

Potato Blackleg ◽

Pectobacterium Atrosepticum ◽

First Report ◽

Potato Plants

Potato (Solanum tuberosum L.) is an important crop in China. In 2013, diseased potatoes exhibiting blackleg and soft rot symptoms were found in the winter potato growing areas of Huizhou city, Guangdong Province, China, with an incidence of approximately 20%. Initially, the stem bases of infected plants blackened and this symptom spread upward. Later, foliage of the diseased plants became yellow and the stem rotted with vascular discoloration. Twenty diseased plants with typical black leg symptoms were collected from a 10-ha potato field with approximately 60,000 potato plants per hectare. A bacterium with small, irregular, round, fluidal, white colonies was isolated from the vascular tissue of all diseased plants on nutrient agar at 26°C for 2 days. Ten strains were randomly selected for pathogenicity assays. Potato plants (cv. Favorita) at the five- to six-leaf stage were inoculated by injecting their stems with 1 ml of each strain in a bacterial suspension (3 × 108 CFU/ml). The inoculated potato plants were incubated at 16 to 21°C and 65 to 85% humidity, and exhibited the same symptoms as the diseased potato plants in the field by 3 to 5 days post inoculation (dpi). The bacterium was reisolated from the diseased tissue (stem) of the inoculated potato plants and produced characteristic pits on crystal violet pectate medium (1). The bacterium utilized a-methyl glucoside, glucose, lactose, maltose, cellobiose, raffinose, melibiose, and citrate, but not d-arabitol, sorbitol, or malonate. The bacteria also gave a positive reaction for catalase and production of reducing substances from sucrose, but gave a negative reaction for oxidase, production of phosphatase, and indole. Using the universal bacterial 16S rDNA primer set, 27f/1541R (4), 1,400-bp fragments were amplified from the 10 strains. The sequences of the 10 fragments (GenBank Accessions KC695819 to KC695828) were identical and had 100% sequence identity with 16S rDNA of Pectobacterium atrosepticum CFBP 1526 (JN600332). Further, the 438-bp and 690-bp fragments were respectively amplified from all 10 strains with the P. atrosepticum-specific primers Y45/Y46 (3) and ECA1f/ECA2r (2). To our knowledge, this is the first report of potato blackleg disease caused by P. atrosepticum (formerly named as Erwinia carotovora subsp. atroseptica) in Guangdong Province, China. References: (1) D. Cupples et al. Phytopathology 64:468, 1974. (2) S. H. De Boer et al. Phytopathology 85:854, 1995. (3) D. Frenchon et al. Potato Research 41:63, 1995. (4) M. Horita et al. J. Gen. Plant Pathol. 70:278, 2004.

Download Full-text