scholarly journals First Report of Turnip Mosaic Virus in Peanut (Arachis hypogaea L.) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Miaomiao Li ◽  
Qi Lin ◽  
Yi Chen ◽  
Fei Xu ◽  
Jiejun Peng ◽  
...  
Keyword(s):  
Western Blot ◽  
Mosaic Virus ◽  
Arachis Hypogaea ◽  
Rna Extraction ◽  
Turnip Mosaic Virus ◽  
Viral Agent ◽  
Rt Pcr ◽  
First Report ◽  
Arachis Hypogaea L ◽  
Beijing China

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer’s instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5’-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5’RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.

scholarly journals First Report of Watermelon mosaic virus causing a Mosaic Disease on Cucumis metuliferus in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Qiang Gao ◽  
Hai-long Ren ◽  
Wanyu Xiao ◽  
Yan Zhang ◽  
Bo Zhou ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Direct Sequencing ◽  
Rna Extraction ◽  
Viral Disease ◽  
Complete Sequence ◽  
Mosaic Disease ◽  
Shanxi Province ◽  
Watermelon Mosaic Virus ◽  
Rt Pcr ◽  
First Report

Cucumis metuliferus, also called horned cucumber or jelly melon, is considered as a wild species in the Cucumis genus and a potential material for nematodes- or viruses-resistant breeding (Provvidenti, et al. 1977; Sigüenza et al. 2005; Chen et al. 2020). This species, originating from Africa, has been cultivated as a fruit in China in recent years. In July 2020, a mosaic disease was observed on C. metuliferus growing in five fields (approximately 0.7 hectare) in Urumqi, Xijiang, China, where more than 85~100% of the field plants exhibited moderate to severe viral disease-like leaf mosaic and/or deformation symptoms. Delayed flowering and small and/or deformed fruits on the affected plants could result in yield loss of about 50%. To identify the causal pathogen, the symptomatic leaf samples were collected from the five fields (five plants/points for each field) and their total RNAs were extracted using a commercial RNA extraction kit. The universal potyviral primers (Ha et al. 2008) and specific primers for a number of frequently-occurring, cucurbit crop-infecting viruses including Papaya ringspot virus (PRSV) (Lin et al. 2013), Cucumber mosaic virus (CMV) and Watermelon mosaic virus (WMV) were designed and used for detection by RT-PCR. The result showed that only the WMV primers (forward: 5’-AAGTGTGACCAAGCTTGGACTGCA-3’ and reverse: 5’-CTCACCCATTGTGCCAAAGAACGT-3’) could amplify the corresponding target fragment from the total RNA templates, and direct sequencing of the RT-PCR products and GenBank BLAST confirmed the presence of WMV (genus Potyvirus) in the collected C. metuliferus samples. To complete Koch’s postulates, the infected C. metuliferus leaves were ground in the sodium phosphate buffer (0.01 M, pH 7.0) and the sap was mechanically inoculated onto 30 four-leaf-stage C. metuliferus seedlings (two leaves for each seedling were inoculated) kept in an insect-proof, temperature-controlled greenhouse at 25~28℃. Twenty-five of the inoculated plants were observed to have apparent leaf mosaic similar to the field symptoms two weeks after inoculation, and positive result was obtained in RT-PCR detection for the symptomatic leaves of inoculated plants using the WMV primers aforementioned, confirming the virus as the pathogen of C. metuliferus in Urumqi. To our knowledge, this is the first report of WMV naturally infecting C. metuliferus in China. We obtained the full-length sequence of the WMV Urumqi isolation (WMV-Urumqi) by sequencing the RT-PCR amplicons from seven pairs of primers spanning the viral genome and the 5’RACE and 3’RACE products. The complete sequence of WMV-Urumqi (GenBank accession no. MW345911) is 10046 nucleotides (nt) long and contains an open reading frame that encodes a polyprotein of 3220 amino acids (aa). WMV-Urumqi shares the highest nt identity (95.9%) and aa identity (98.0%) with the Cucurbita pepo-infecting isolation (KX664483) from Shanxi province, China. Our findings provide a better understanding of the host range and genetic diversity of WMV, and a useful reference for virus-resistant breeding involving C. metuliferus.

scholarly journals First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1664-1664 ◽  
Author(s):  
B. Babu ◽  
H. Dankers ◽  
S. George ◽  
D. Wright ◽  
J. Marois ◽  
...  
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
The United States ◽  
Turnip Mosaic Virus ◽  
Brassica Carinata ◽  
Rt Pcr ◽  
First Report ◽  
Ethiopian Mustard ◽  
Plant Pathol ◽  
Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

scholarly journals First Report of Tomato Brown Rugose Fruit Virus on Tomato in Syria

Plant Disease ◽  
2021 ◽  
Author(s):  
Ziad M Hasan ◽  
Nidà Mohammed Salem ◽  
Imad D. Ismail ◽  
Insaf Akel ◽  
Ahmad Y Ahmad
Keyword(s):  
Mosaic Virus ◽  
Rna Extraction ◽  
Coastal Region ◽  
Rt Pcr ◽  
Specific Primers ◽  
Total Rna ◽  
First Report ◽  
Species Specific ◽  
Das Elisa ◽  
Total Rna Extraction

Tomato (Solanum lycopersicum L.) is an important vegetable crop worldwide. In spring and autumn 2017, virus-like symptoms were observed on greenhouse grown tomato plants in the east of Akkar plain (south of coastal region, Tartous governorate, Syria). These symptoms were: mild to severe mosaic on the apical leaves, brown necrosis on sepals, receptacle and flower’s cluster carrier, and severe symptoms of brown rugose and discoloration on fruit. During next growing seasons, disease spread was observed in most of Syrian coastal region with disease incidence ranged from 40% to 70% by 2020. Tomato brown rugose fruit virus (ToBRFV) was suspected as a main causal agent of the disease, especially since its first report in Jordan, a neighboring country (Salem et al. 2016), Palestine (Alkowni et al. 2019), Turkey (Fidan et al. 2019), Germany (Menzel et al. 2019), Italy (Panno et al. 2019), America (Camacho-Beltrán et al. 2019), Egypt (Amer and Mahmoud, 2020), and recently in Spain (Alfaro-Fernandez et al. 2021). In November and December 2020, seventy-one leaf samples from symptomatic plants (59 from Tartous and 12 from Lattakia governorates) and seven from asymptomatic ones (5 from Tartous and 2 from Lattakia) were collected and tested for the presence of ToBRFV by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA), using ToBRFV-commercial kit (LOEWE® Biochemia, Germany) following the manufacturer’s instructions. Results showed, forty-three of symptomatic samples reacted positively (38 in Tartous and 5 in Lattakia) and none of asymptomatic ones. On the other hand, sap mechanical inoculation of 10 tomato cv. Mandaloun F1 (Enza Zaden, the Netherlands) plants using a positive tomato isolate gave systemic mosaic symptoms in all plants identical to those observed in the original plants in the field, after 13 days of inoculation, and necrotic local lesions on 10 plants of Nicotiana tabacum after 5 days, indicating the presence of a tobamovirus in general. ToBRFV infection was confirmed in all mechanically-inoculated plants by DAS-ELISA. Further tests were necessary to investigate ToBRFV presence, because of its serological relationships with another tobamoviruses. Six representative symptomatic samples (ELISA-positive) and two asymptomatic (ELISA-negative) samples were subjected to total RNA extraction using the SV-Total RNA Extraction kit (Promega, U.S.A.) following the manufacturer’s instructions. The samples were tested by two-step reverse transcription-polymerase chain reaction (RT-PCR) using species-specific primers and protocols for most common tomato-infecting viruses, including: tomato chlorosis virus and tomato infectious chlorosis virus (Dovas et al. 2002), pepino mosaic virus (PepMV) and tomato torrado virus (Wieczorek et al. 2013), alfalfa mosaic virus (Parrella et al. 2000), tomato spotted wilt virus (Salem et al. 2012) and a pair of primers: ToBRFV-F2 (5’-CATATCTCTCGACACCAGTAAAAGGACCCG-3’) and ToBRFV-R2 (5’-TCCGAGTATAGGAAGACTCTGGTTGGTC-3’) targeting a region of the RNA dependent RNA polymerase (RdRp), of the ToBRFV genome (KT383474; Salem et al. 2016). First-strand cDNA synthesis was carried out using Moloney murine leukemia virus reverse transcriptase (M-MLV RT; Promega) and random primer according to the manufacturer's protocol, then followed by PCR with the seven species-specific primers. Only ToBRFV was detected among all tested viruses in symptomatic samples (ELISA-positive), and none of the tested viruses was detected in the asymptomatic plants. To confirm the presence of ToBRFV, two selected RdRp-specific PCR amplicons (872 bp) were purified and ligated into pGEM T-Easy Vector (Promega), and three clones were sequenced (GenBank accession nos. MZ447794 to 96). BLASTn analysis showed that the nucleotide sequences are 99.77-100% identical and shared around 99% identity to RdRp of ToBRFV isolate (MT118666) from Turkey available in the GenBank. Accordingly, the presence of ToBRFV was confirmed by bioassays on indicator plants, DAS-ELISA, RT-PCR, and further sequencing. To our knowledge, this is the first report of ToBRFV infecting tomato in Syria, and this requires special emphasis for further investigations because of the virus severity, easy transmission ability and absent of commercial resistance varieties till now.

scholarly journals First Report of Dasheen Mosaic Virus Infecting Typhonium giganteum Engl. (Baifuzi) in Henan Province of China

Plant Disease ◽  
2021 ◽  
Author(s):  
YanHong Qin ◽  
Suxia Gao ◽  
Yuxia Liu ◽  
Yi Wen ◽  
Chuantao Lu ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
High Throughput Sequencing ◽  
Genomic Sequence ◽  
Close Association ◽  
Henan Province ◽  
Full Length ◽  
Reference Sequence ◽  
Rt Pcr ◽  
First Report ◽  
Beijing China

Typhonium giganteum Engl. (Baifuzi ) is a perennial plant of the family Araceae. In China, its root is commonly used as an antispasmodic for stroke and cancer treatment (Chi et al. 2010; Gao et al. 2014; Khalivulla et al. 2019). Yuzhou city in Henan Province is the main producing area of T. giganteum Engl., and in July 2020, a survey of viral disease infecting T. giganteum Engl. was conducted in the city. In the surveyed fields (n =5), over 60% of plants displayed varying levels of virus-like symptoms, including mosaic, chlorotic and leaf distortion (Supplementary Figure S1) . To identify possible viral pathogens associated with the disease symptoms afflicting T. giganteum Engl., one leaf each from 25 symptomatic plants was collected and analyzed by high-throughput sequencing (HTS) as well as PCR. For HTS analysis, total RNA was extracted from one pooled sample containing a portion of all abovementioned leaves using RNAprep Pure Plant Plus Kit (TIANGEN Biotech, Beijing, China). After removing ribosomal RNA with Ribo-off rRNA depletion kit (Vazyme Biotech, Nanjing, China), a sequencing library was generated using NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA) and sequenced on an Illumina Novaseq6000 sequencing system at Berry Genomics Corporation (Beijing, China). A total of 6,899,143 high-quality clean reads were obtained after trimming and used for contig assembly. BLASTn and BLASTx analyses on the contigs (n = 128,400) showed that one contig (9,245 bp in length) exhibited a sequence identity of 84.0% with the reference sequence of dasheen mosaic virus (DsMV, NCBI reference seq. NC_003537, genus Potyvirus, family Potyviridae) , suggesting infection of the plants by DsMV. No other viral sequences were detected in the sample. To confirm these results, a near full-length genomic sequence of DsMV was obtained from one sample (sample no. 39) by reverse transcription polymerase chain reaction (RT-PCR) of three overlapping fragments with the following primer pairs: DsMV-1F (5′-AAATTAAAACATCTCAACAAAACCTACA-3′) /DsMV-4130R (5′-TTCATGGTCCTCGTGGAGTATA-3′), DsMV-3870F (5′-GAGGACGTGAGAATTCAAAGTCT-3′)/DsMV-8250R (5′-GTCCAACCTTGCTTGATGCATGC-3′), DsMV-7690F (5′-GGAGCGACTCCTCTTCCAAAGTTGTG-3′)/DsMV-10100R (5′-TGAACACCGTGCACGAAGCATCTC-3′). The PCR products were cloned into pMD19-T vector (TAKARA Biotech, Dalian, China) and sequenced. The near full-length genomic sequence of the isolate (DsMV-BF39) was 9,737 nt in length and deposited into GenBank under the accession no. MZ043618. BLASTn analysis of this sequence demonstrated that it shared an identity ranging from 78.6% (MG602234) to 85.6% (MG602227) with various DsMV isolates. To determine whether DsMV was closely associated with the symptoms observed in T. giganteum Engl., leaf tissues from 30 symptomatic plants and 22 asymptomatic plants were analyzed by RT-PCR using primer pairs DsMV-CPF (5′-TGTTCTGTGAACATGATGAAGTTG-3′, sense) and DsMV-CPR (5′-GTAACTGTGGCCTGTTTACCAG-3′, antisense) targeting a 916 bp fragment of the CP gene of DsMV. Amplicons with the expected size were detected from the 30 symptomatic plants but not from the 22 asymptomatic plants, suggesting a close association between DsMV infection and the observed symptoms. To our knowledge, this is the first report of DsMV infecting T. giganteum Engl.. Further study is needed to identify the specific symptoms induced by this virus in T. giganteum Engl. and to understand the biological characteristics, epidemiology, prevalence of this virus in China.

scholarly journals First Report of Turnip mosaic virus on Watercress in Brazil

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1066-1066 ◽  
Author(s):  
H. Costa ◽  
J. A. Ventura ◽  
A. S. Jadão ◽  
J. A. M. Rezende ◽  
A. P. O. A. Mello
Keyword(s):  
Coat Protein ◽  
Mosaic Virus ◽  
Leaf Size ◽  
Turnip Mosaic Virus ◽  
Polyclonal Antiserum ◽  
Cauliflower Mosaic Virus ◽  
Mechanical Transmission ◽  
Rt Pcr ◽  
First Report ◽  
Coat Protein Region

Watercress (Nasturtium officinale L.), a member of the family Brassicaceae, is consumed mainly as salad. Medicinal properties have also been attributed to this species. In Brazil, watercress is grown mainly by very small farmers. The crop is primarily seed propagated and growers can harvest several times per year in an established planting. Very few diseases have been reported in this crop worldwide. In Brazil, watercress infection by Cauliflower mosaic virus (CaMV) (3), Cucumber mosaic virus (CMV) (1), and an unidentified potyvirus (2) were previously reported. In January 2009, 80% of watercress plants, cv. Gigante Redondo, exhibiting severe mosaic, leaf size reduction, and plant stunting were observed in a crop in Marechal Floriano Municipality, State of Espírito Santo, Brazil. Preliminary leaf dip analysis by transmission electron microscopy revealed the presence of potyvirus-like particles. Sap from five infected plants reacted in plate-trapped antigen (PTA)-ELISA with polyclonal antiserum against Turnip mosaic virus (TuMV), but not with antiserum against CMV. Both antisera were produced in the Plant Virology Laboratory, ESALQ/USP. Mechanically inoculated watercress plants developed similar systemic mosaic symptoms. The virus was also transmitted to Nicotiana benthamiana, which exhibited severe mosaic and stunting. The presence of TuMV on these inoculated plants was confirmed by PTA-ELISA and reverse transcription (RT)-PCR. Total RNA extracted from infected and healthy watercress and infected N. benthamiana was analyzed by RT-PCR using specific pairs of primers flanking the coat protein gene of TuMV. Degenerated anti-sense (5′-t/caacccctt/gaacgcca/cagt/ca-3′) and sense (5′-gcaggtgaa/gacg/acttgat/ca/gc-3′) primers were designed after analysis to an alignment of the nucleotide sequences for five isolates of TuMV available in the GenBank (Accession Nos. NC_002509, D10927, EU680574, AB362513, and D88614). One fragment of 838 bp was amplified from samples in the infected plants, but not in the healthy controls. Two amplicons were purified and directly sequenced in both directions. Comparisons of the 731-bp consensus nucleotide sequence (Accession No. HM008961) to several other isolates of TuMV revealed 94 to 95% identity in the coat protein region. To our knowledge, this is the first report of TuMV in watercress in Brazil. Management of the disease should include propagation by seeds instead of vegetative parts of the plants and rouging of diseased plants to prevent mechanical transmission during successive harvestings. References: (1) A. J. Boari et al. Fitopatol. Bras. 25:438, 2000. (2) A. J. Boari et al. Fitopatol. Bras. 27:S200, 2002. (3) M. L. R. Z. C. Lima et al. Fitopatol. Bras. 9:403, 1984.

scholarly journals First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 762-762 ◽  
Author(s):  
R. K. Sampangi ◽  
C. Almeyda ◽  
K. L. Druffel ◽  
S. Krishna Mohan ◽  
C. C. Shock ◽  
...  
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Great Basin ◽  
Natural Infection ◽  
The United States ◽  
Native Plant ◽  
Rt Pcr ◽  
Cmv Infection ◽  
Spot Virus ◽  
First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

scholarly journals First Report of Yam mild mosaic virus in Yam in Guangxi Province, China

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1320-1320 ◽  
Author(s):  
C. Zou ◽  
J. Meng ◽  
Z. Li ◽  
M. Wei ◽  
J. Song ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Viral Genome ◽  
Terminal Region ◽  
Mild Mosaic ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Germplasm Exchange ◽  
First Report ◽  
Pcr Products ◽  
Mild Mosaic Virus

Yams (Dioscorea spp.) are widely grown in China as vegetables and herbal medicine. However, studies on viral diseases on yams are still limited. As a pilot project of a government initiative for improving yam productivity, a small study was conducted in Guangxi, a southern province of China, on viral disease in yams. Incidence of virus-like disease for the three extensively grown D. alata cultivars, GH2, GH5, and GH6, were 12 to 40%, 12 to 29%, and 11 to 25%, respectively, as found in a field survey with a five-plot sampling method in 2010. A total of 112 leaf samples showing mosaic or mottling or leaves without symptoms were collected from the cvs. GH2, GH5, GH6, and seven additional cultivars (D. alata cvs. GY2, GY23, GY47, GY69, GY62, GY72, and D. batatas cv. Tiegun). To determine if the symptoms were caused by Yam mild mosaic virus (YMMV; genus Potyvirus, family Potyviridae), total RNA was extracted from leaves with a commercial RNA purification kit (TIANGEN, Beijing, China), and reverse-transcription (RT)-PCR was conducted with a YMMV-specific primer pair (4) that amplifies the 3′-terminal portion of the viral genome. A PCR product with the predicted size of 262 bp was obtained from samples of GH5 (number testing positive of total number of leaves = 5 of 12), GH6 (24 of 42), and GY72 (1 of 1), but not from asymptomatic leaves. PCR products from a GH5 sample (YMMV-Nanning) and a GH6 sample (YMMV-Luzhai) were cloned and sequenced using an ABI PRISM 3770 DNA Sequencer. The two PCR products were 97% identical at nucleotide (nt) level and with the highest homology (89% identity) to a YMMV isolate (GenBank Accession No. AJ305466). To further characterize the isolates, degenerate primers (2) were used to amplify viral genome sequence corresponding to the C-terminal region of the nuclear inclusion protein b (NIb) and the N-terminal region of the coat protein (CP). These 781-nt fragments were sequenced and a new primer, YMMV For1 (5′-TTCATGTCGCACAAAGCAGTTAAG-3′) corresponding to the NIb region, was designed and used together with primer YMMV UTR 1R to amplify a fragment that covers the complete CP region of YMMV by RT-PCR. These 1,278-nt fragments were sequenced (GenBank Accession Nos. JF357962 and JF357963). CP nucleotide sequences of the YMMV-Nanning and YMMV-Luzhai isolates were 94% similar, while amino acid sequences were 99% similar. BLAST searches revealed a nucleotide identity of 82 to 89% and a similarity of 88 to 97% for amino acids to sequences of YMMV isolates (AF548499 and AF548519 and AAQ12304 and BAA82070, respectively) in GenBank. YMMV is known to be prevalent on D. alata in Africa and the South Pacific, and has recently been identified in the Caribbean (1) and Colombia (3). To our knowledge, this is the first report of the natural occurrence of YMMV in China and it may have implications for yam production and germplasm exchange within China. References: (1) M. Bousalem and S. Dallot. Plant Dis. 84:200, 2000. (2) D. Colinet et al. Phytopathology 84:65, 1994. (3) S. Dallot et al. Plant Dis. 85:803, 2001. (4) R. A. Mumford and S. E. Seal. J. Virol. Methods 69:73, 1997.

scholarly journals First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽  
2021 ◽  
Author(s):  
Ahmed Sabra ◽  
Mohammed Ali Al Saleh ◽  
I. M. Alshahwan ◽  
Mahmoud A. Amer
Keyword(s):  
Saudi Arabia ◽  
Mosaic Virus ◽  
Solanum Lycopersicum ◽  
Tomato Mosaic Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
First Report ◽  
Pcr Products ◽  
Dark Green ◽  
Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Sign in / Sign up

Export Citation Format

Share Document