scholarly journals First Report of Turnip mosaic virus on Watercress in Brazil

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1066-1066 ◽  
Author(s):  
H. Costa ◽  
J. A. Ventura ◽  
A. S. Jadão ◽  
J. A. M. Rezende ◽  
A. P. O. A. Mello
Keyword(s):  
Coat Protein ◽  
Mosaic Virus ◽  
Leaf Size ◽  
Turnip Mosaic Virus ◽  
Polyclonal Antiserum ◽  
Cauliflower Mosaic Virus ◽  
Mechanical Transmission ◽  
Rt Pcr ◽  
First Report ◽  
Coat Protein Region

Watercress (Nasturtium officinale L.), a member of the family Brassicaceae, is consumed mainly as salad. Medicinal properties have also been attributed to this species. In Brazil, watercress is grown mainly by very small farmers. The crop is primarily seed propagated and growers can harvest several times per year in an established planting. Very few diseases have been reported in this crop worldwide. In Brazil, watercress infection by Cauliflower mosaic virus (CaMV) (3), Cucumber mosaic virus (CMV) (1), and an unidentified potyvirus (2) were previously reported. In January 2009, 80% of watercress plants, cv. Gigante Redondo, exhibiting severe mosaic, leaf size reduction, and plant stunting were observed in a crop in Marechal Floriano Municipality, State of Espírito Santo, Brazil. Preliminary leaf dip analysis by transmission electron microscopy revealed the presence of potyvirus-like particles. Sap from five infected plants reacted in plate-trapped antigen (PTA)-ELISA with polyclonal antiserum against Turnip mosaic virus (TuMV), but not with antiserum against CMV. Both antisera were produced in the Plant Virology Laboratory, ESALQ/USP. Mechanically inoculated watercress plants developed similar systemic mosaic symptoms. The virus was also transmitted to Nicotiana benthamiana, which exhibited severe mosaic and stunting. The presence of TuMV on these inoculated plants was confirmed by PTA-ELISA and reverse transcription (RT)-PCR. Total RNA extracted from infected and healthy watercress and infected N. benthamiana was analyzed by RT-PCR using specific pairs of primers flanking the coat protein gene of TuMV. Degenerated anti-sense (5′-t/caacccctt/gaacgcca/cagt/ca-3′) and sense (5′-gcaggtgaa/gacg/acttgat/ca/gc-3′) primers were designed after analysis to an alignment of the nucleotide sequences for five isolates of TuMV available in the GenBank (Accession Nos. NC_002509, D10927, EU680574, AB362513, and D88614). One fragment of 838 bp was amplified from samples in the infected plants, but not in the healthy controls. Two amplicons were purified and directly sequenced in both directions. Comparisons of the 731-bp consensus nucleotide sequence (Accession No. HM008961) to several other isolates of TuMV revealed 94 to 95% identity in the coat protein region. To our knowledge, this is the first report of TuMV in watercress in Brazil. Management of the disease should include propagation by seeds instead of vegetative parts of the plants and rouging of diseased plants to prevent mechanical transmission during successive harvestings. References: (1) A. J. Boari et al. Fitopatol. Bras. 25:438, 2000. (2) A. J. Boari et al. Fitopatol. Bras. 27:S200, 2002. (3) M. L. R. Z. C. Lima et al. Fitopatol. Bras. 9:403, 1984.

scholarly journals First Report of Turnip mosaic virus in Rhubarb in Alaska

Plant Disease ◽  
2005 ◽  
Vol 89 (4) ◽  
pp. 430-430 ◽  
Author(s):  
N. L. Robertson ◽  
D. C. Ianson
Keyword(s):  
Coat Protein ◽  
Host Range ◽  
Mosaic Virus ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Turnip Mosaic Virus ◽  
The Arctic ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
First Report

In July 2003, noticeable red lesions were observed on rhubarb leaves (Rheum rhababarum cv. Kerwin) from a plant at the Arctic Plant Germplasm Research and Introduction Project in Palmer, AK. Extracts of leaf tissue tested positive for a potyvirus using indirect enzyme-linked immunosorbent assay (ELISA) and western blots with a monoclonal antibody specific to the potyvirus group (Agdia, Inc., Elkhart, IN). During the following growing season (June 2004), obvious chlorotic ringspots developed into red lesions on the same plant and an adjacent plant of the same cultivar. Partially purified particles that were isolated from the infected rhubarb plants were mechanically inoculated to an experimental host range (number of infected plants per total number of plants), resulting in lesions on leaves of Rheum palmatum (1 of 2) and Chenopodium amaranticolor (3 of 5) but none on C. quinoa (0 of 4). The leaves with local lesions from C. amaranticolor were ground in phosphate buffer (1 g of tissue per 10 ml of buffer), and the extract rubbed onto a set of plants resulting in lesions on R. hybridum (raponticum) (1 of 2), C. amaranticolor (1 of 4), and C. quinoa (1 of 4). The original diseased rhubarb plants and experimental symptomatic plants were confirmed to have a potyvirus using ELISA. Subsequent compound direct ELISA and western blot assays revealed that the virus reacted strongly to monoclonal or polyclonal antibodies to Turnip mosaic virus (TuMV) (Agdia, Inc.). Total RNA was extracted from leaves of the naturally infected rhubarb plants with an RNeasy Plant Mini Kit (Qiagen Sciences, Germantown, Maryland), and used in reverse-transcription-polymerase chain reaction (RT-PCR) with specific primers for TuMV (1) predicted to amplify a 1,134-bp 3′-terminal cDNA fragment encompassing the 3′-end of the nuclear inclusion protein gene (NIb), the coat protein gene, and the 3′-nontranslated region. A PCR product of approximately the expected size was obtained and then sequenced. Sequences (1,077 nt) that corresponded to the TuMV coat protein gene and 3′-terminal noncoding region were submitted to Genbank (Accession No. AY744930). Blast searches against NCBI (National Center for Biotechnology Information) contained high identities to many TuMV isolates with up to 96% (1,043 of 1,077) nucleotide identity (i.e., GenBank Accession No. AF169561). Similar high identities of up to 97% at the amino acid level occurred within the coat protein coding region (i.e., GenBank Accession No. BAC02892.1). Infected rhubarb plants were removed from the site and none of the remaining 109 plants tested positive for TuMV using ELISA. On the basis of the mechanical transmission to plant hosts, the definitive TuMV serology, and the consensus of sequenced regions with TuMV, we concluded that the causal agent of the diseased rhubarb plants was TuMV. Although TuMV has a wide plant host range occurring worldwide (2), to our knowledge, this is the first report of TuMV in rhubarb in Alaska and the first time that TuMV has been detected in Alaska. References: (1) P. Lehmann et al. Physiol. Mol. Plant Pathol. 51:195, 1997. (2) R. Provvidenti. Page 1340 in: Viruses of Plants. A. A. Brunt et al., eds. CAB International, Wallingford, UK, 1996.

scholarly journals First Report of Tobacco mild green mosaic virus in Capsicum chinense in Venezuela

Plant Disease ◽  
2006 ◽  
Vol 90 (8) ◽  
pp. 1108-1108 ◽  
Author(s):  
C. Córdoba ◽  
A. García-Rández ◽  
N. Montaño ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Seed Transmission ◽  
Tomato Mosaic Virus ◽  
Capsicum Chinense ◽  
Rt Pcr ◽  
Plant Host ◽  
First Report ◽  
Coat Protein Region ◽  
Pcr Product ◽  
First Time

In July 2003, noticeable deformations of leaves were observed on a local variety of Capsicum chinense, also called ‘Aji dulce’, from a pepper plantation located in Venezuela, (Monagas State). ‘Aji dulce’ is a basic ingredient of the Venezuelan gastronomy with an estimated cultivated area of 2,000 ha. The seeds of this local pepper are obtained by the growers who reproduce and multiply their own seeds every year. Seeds of affected plants were sent to our laboratory, and a group of approximately 100 seeds was sown in a controlled greenhouse that belongs to the Polytechnic University of Valencia, Spain. Three months later, obvious curling and bubbling developed on the leaves of the plants. Extracts of symptomatic plants tested negative for Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), Pepper mild mottle virus (PMMV), and Tobacco etch virus (TEV) by double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with policlonal antibodies specific to each virus (Loewe Biochemica GMBH, Sauerlach, Germany; Phyto-Diagnostics, INRA, France). Total RNA was isolated from 0.5 g of original seed sent from Venezuela and from 25 samples of leaves of plants grown in the greenhouse with an RNeasy Plant Mini Kit (Qiagen Sciences, Germantown, Maryland). The RNA isolated was used in reverse transcription-polymerase chain reaction (RT-PCR) with specific primers for Tobacco mild green mosaic virus (TMGMV) (1) predicted to amplify a 530 bp of the coat protein region. From all samples, a RT-PCR product of the expected size was obtained and then sequenced. BLAST analysis of one sequence (GenBank Accession No. DQ460731) showed high levels of identity with TMGMV isolates, with more than 99% nucleotide identity with the DSMZ PV-112 isolate (GenBank Accession No. AJ429096). The symptomatology observed on pepper plants, the TMGMV RT-PCR assay, and the consensus of sequenced regions with TMGMV lead us to conclude that TMGMV was the causal agent of the diseased C. chinense plants. Although TMGMV has a wide plant host range occurring worldwide (1), to our knowledge, this is not only the first time TMGMV has been detected in Venezuela, but also the first report of TMGMV in C. chinense in Venezuela and the first reliable probe of the TMGMV seed transmission. Reference: (1) J. Cohen et al. Ann. Appl. Biol. 138:153, 2001.

scholarly journals First Report of Alfalfa mosaic virus Infecting Basil (Ocimum basilicum) in California

Plant Disease ◽  
2012 ◽  
Vol 96 (2) ◽  
pp. 295-295 ◽  
Author(s):  
W. M. Wintermantel ◽  
E. T. Natwick
Keyword(s):  
Nucleic Acid ◽  
Mosaic Virus ◽  
Alfalfa Mosaic Virus ◽  
Plant Viruses ◽  
Ocimum Basilicum ◽  
Mechanical Transmission ◽  
Rt Pcr ◽  
Imperial Valley ◽  
First Report ◽  
Production Region

Basil (Ocimum basilicum L.) plants collected from three fields in Imperial County, CA in May, 2011 were found to be exhibiting yellowing, chlorotic sectors and spots on leaves, resulting in unmarketable plants. Dodder (Cuscuta spp.) was present in one of the fields, but was not visibly associated with symptomatic plants. Total nucleic acid was extracted from four symptomatic and three asymptomatic basil plants, as well as from the dodder plant with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). Nucleic acid extracts were tested by reverse transcription (RT)-PCR for the presence of Alfalfa mosaic virus (AMV) using primers designed to amplify a 350-nt region of the AMV coat protein gene (3). RT-PCR produced bands of the expected size in extracts from all symptomatic plants and the dodder sample. No amplification was obtained from symptomless plants. A 350-nt band amplified from one plant was gel-extracted, sequenced (TACGen, Richmond, CA), and confirmed to be AMV by comparison to sequences available in GenBank (Accession No. K02703). Although serological tests on an initial basil sample were negative for AMV by ELISA using antiserum produced against AMV by R. Larsen, USDA-ARS, Prosser, WA (unpublished), AMV was confirmed by ELISA and RT-PCR in symptomatic Nicotiana benthamiana, N. clevelandii, and Malva parviflora plants following mechanical transmission from basil source plants. The fields with AMV infections were located at opposite ends of the production region from one another, indicating widespread dispersal of AMV in the region. All AMV positive plants were adjacent to alfalfa. Two additional basil plantings in shade houses open to the outside environment did not have AMV symptomatic plants and were also confirmed negative by RT-PCR, but these plantings were at the extreme north end of Imperial Valley agriculture and well away from any alfalfa fields. At the time the basil plantations were sampled for AMV, no aphids were found in any plantations, but during the several weeks prior to finding the AMV-positive plants, cowpea aphid, Aphis craccivora Koch; pea aphid, Acyrthosiphon pisum Harris; blue alfalfa aphid, Acyrthosiphon kondoi Shinji; and spotted alfalfa aphid, Therioaphis maculata Buckton were colonizing Imperial Valley alfalfa fields, producing winged adults. AMV is transmitted by at least 14 aphid species (1), and most aphid populations increase during the late spring in this important desert agricultural region. The acquisition of AMV by dodder suggests the parasitic plant may serve as a vector of AMV within basil fields, although further study will be necessary for clarification. Significant acreage of basil is grown in the Imperial Valley. This acreage is surrounded by extensive and increasing alfalfa production totaling 55,442 ha (137,000 acres) in Imperial County and representing a 21% increase in acreage over 2009 for the same region (2). To our knowledge, this is the first report of basil infected by AMV in California. The proximity of basil production to such a large alfalfa production region warrants the need for enhanced efforts at aphid management in basil production to reduce vector populations and reduce transmission to basil crops. References: (1) E. M. Jaspars and L. Bos. Alfalfa mosaic virus. No. 229 in: Descriptions of Plant Viruses. Commonw. Mycol. Inst./Assoc. Appl. Biol., Kew, England, 1980. (2) C. Valenzuela. Imperial County California Crop and Livestock Report, 2010. (3) H. Xu and J. Nie. Phytopathology 96:1237, 2006.

scholarly journals First Report of Tomato torrado virus Infecting Tomato in Single and Mixed Infections with Cucumber mosaic virus in Panama

Plant Disease ◽  
2009 ◽  
Vol 93 (2) ◽  
pp. 198-198 ◽  
Author(s):  
J. A. Herrera-Vásquez ◽  
A. Alfaro-Fernández ◽  
M. C. Córdoba-Sellés ◽  
M. C. Cebrián ◽  
M. I. Font ◽  
...  
Keyword(s):  
Coat Protein ◽  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Potato Virus ◽  
Plant Viruses ◽  
Tomato Mosaic Virus ◽  
Rt Pcr ◽  
Tomato Production ◽  
Related Sequence ◽  
First Report

In February of 2008, in open-field-grown tomato crops (Solanum lycopersicum L.) from the central regions of Coclé, Herrera, Los Santos, and Veraguas of Panama, unusual disease symptoms, including deformation, necrosis, purple margins, interveinal yellowing, downward and upward curling of the leaflets alternately, necrotic lines in sepals and branches, fruits distorted with necrotic lines on the surface, and severe stunting, were observed. Tomato production was seriously damaged. To verify the identity of the disease, five symptomatic tomato plants from four fields of these regions were selected and analyzed by double-antibody sandwich (DAS)-ELISA using specific antibodies to Cucumber mosaic virus (CMV), Potato virus X (PVX), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted from all plants and tested using reverse transcription (RT)-PCR with three pairs of specific primers: one pair designed to amplify 586 bp of the coat protein gene of CMV (CMV-F 5′-CCTCCGCGGATGCTAACTT-3′ and CMV-R 5′-CGGAATCAGACTGGGAGCA-3′) and the other two pairs to Tomato torrado virus (ToTV) that amplify 580 and 574 bp of the polyprotein (4) and coat protein (Vp23) (3) region of RNA2, respectively; and by dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the aforementioned polyprotein. The serological analysis for PVX, PVY, ToMV, TSWV, and PepMV were negative. ToTV was detected in all samples analyzed. Three of these samples were also positive for CMV by serological and molecular analysis. No differences in symptom expression were observed between plants infected with both viruses or with ToTV alone. RT-PCR products were purified and directly sequenced. BLAST analysis of one CMV sequence (GenBank Accession No. EU934036) showed 98% identity with a CMV sequence from Brazil (most closely related sequence) (GenBank Accession No. AY380812) and 97% with the Fny isolate (CMV subgroup I) (GenBank Accession No. U20668). Two ToTV sequences were obtained (GenBank Accession Nos. EU934037 and FJ357161) and showed 99% and 98% identities with the polyprotein and coat protein region of ToTV from Spain (GenBank Accession No. DQ388880), respectively. CMV is transmitted by aphids and is distributed worldwide with a wide host range (2), while ToTV is transmitted by whiteflies and has only been reported in tomato crops in Spain and Poland and recently on weeds in Spain (1). To our knowledge, this is the first time ToTV has been detected in Panama and the first report of CMV/ToTV mixed infection. References: (1) A. Alfaro-Fernández et al. Plant Dis. 92:831, 2008. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

scholarly journals First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1664-1664 ◽  
Author(s):  
B. Babu ◽  
H. Dankers ◽  
S. George ◽  
D. Wright ◽  
J. Marois ◽  
...  
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
The United States ◽  
Turnip Mosaic Virus ◽  
Brassica Carinata ◽  
Rt Pcr ◽  
First Report ◽  
Ethiopian Mustard ◽  
Plant Pathol ◽  
Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

scholarly journals First Report of Bean common mosaic virus Infecting Lablab purpureus in India

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 881-881 ◽  
Author(s):  
A. C. Udayashankar ◽  
S. Chandra Nayaka ◽  
S. R. Niranjana ◽  
O. S. Lund ◽  
H. S. Prakash
Keyword(s):  
Coat Protein ◽  
Mosaic Virus ◽  
Yield Loss ◽  
Bean Common Mosaic Virus ◽  
Lablab Purpureus ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Degenerate Primers ◽  
First Report ◽  
Field Samples

Lablab bean (Lablab purpureus L. Sweet) is a widely cultivated, highly drought tolerant legume vegetable crop grown in diverse environmental conditions worldwide. In India and elsewhere, the young pods are consumed as a fresh vegetable and mature dry seeds are important in the diet of people preferring vegetarian food (2). Small-holding farmers use their own saved seeds for sowing. During October 2008, L. purpureus exhibiting symptoms of stunting, mosaic, vein-banding, vein-clearing, mottling, and blisters suggestive of a viral infection were observed in and around the Mysore District of Karnataka State, India. Incidence of the disease ranged from 1 to 10% in different fields. Symptomatic leaves were collected from fields of Daripura Village, Mysore District, Karnataka. Viruses that were tested by indirect ELISA included Cucumber mosaic virus, Tobacco mosaic virus, Cowpea aphid-borne mosaic virus, Cowpea mosaic virus, Cowpea mottle virus, Southern bean mosaic virus, and Bean common mosaic virus (BCMV). Results of the ELISA tests indicated that all 28 samples collected from different fields were infected with BCMV. Examination of tissue sap from symptomatic plants by electron microscopy revealed flexuous rod-shaped particles (~750 nm long). An immunocapture-reverse transcription (IC-RT)-PCR assay employing degenerate primers for amplifying partial coat protein (CP) and 3′-UTR of potyviruses (1) yielded a ~700-bp product that was cloned and sequenced (GenBank Accession No. HM776637). Sequence identity at the nucleotide level was 96% with BCMV strain NL-7n (GenBank Accession No. GQ456169) infecting common bean from Himachal Pradesh, India. RTPCR was performed with a virus-specific primer pair (FW3-5′-GCAGTAGCACAGATGAAGGCA-3′: Rv3-5′-GGTTCTTCCGGCTTACTCATAAACAT-3′) designed to amplify 340 bp, the partial coat protein gene of BCMV. All symptomatic L. purpureus field samples and screenhouse-grown seedlings manually inoculated with infected sap were positive for BCMV infection in RT-PCR assay employing specific primers with amplification of a 340-bp product. To our knowledge, this is the first report of BCMV infecting L. purpureus in India. BCMV has also been reported in L. purpureus in Uganda (4) and Nigeria (3). Plants that were confirmed by ELISA to be infected were tagged, and from these plants, seeds were collected and pooled. Four hundred seeds were germinated and a rate of 6.5% seed transmission was determined based on symptoms, ELISA, and PCR. From December 2008 to December 2010, different L. purpureus plantings were monitored for BCMV incidence. Plants infected at different growth stages were tagged and pods were harvested from infected and healthy plants. Data from at least 100 BCMV-infected L. purpureus plants from each of 12 different fields were recorded for yield loss analysis. In terms of number of pods per plant, number of seeds per pod, and seed weight, an average as much as 40% yield loss was recorded from 12 different fields. Because seeds collected from these plants are used for subsequent plantings, these plants may act as virus reservoirs or foci of infection. References: (1) A. S. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) M. N. Maruthi et al. Ann. Appl. Biol. 149:187, 2006. (3) O. O. Odedara et al. J. Gen. Virol. 74:322, 2008. (4) T. N. Sengooba et al. Plant Pathol. 46:95, 1997.

scholarly journals First Report of Tomato torrado virus Infecting Tomato in Hungary

Plant Disease ◽  
2009 ◽  
Vol 93 (5) ◽  
pp. 554-554 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
G. Bese ◽  
C. Córdoba-Sellés ◽  
M. C. Cebrián ◽  
J. A. Herrera-Vásquez ◽  
...  
Keyword(s):  
Coat Protein ◽  
Mosaic Virus ◽  
Polyclonal Antibodies ◽  
Blot Hybridization ◽  
Sandwich Elisa ◽  
World Intellectual Property Organization ◽  
Tomato Mosaic Virus ◽  
Rt Pcr ◽  
Dot Blot ◽  
First Report

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

scholarly journals First Report of Turnip Mosaic Virus in Peanut (Arachis hypogaea L.) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Miaomiao Li ◽  
Qi Lin ◽  
Yi Chen ◽  
Fei Xu ◽  
Jiejun Peng ◽  
...  
Keyword(s):  
Western Blot ◽  
Mosaic Virus ◽  
Arachis Hypogaea ◽  
Rna Extraction ◽  
Turnip Mosaic Virus ◽  
Viral Agent ◽  
Rt Pcr ◽  
First Report ◽  
Arachis Hypogaea L ◽  
Beijing China

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer’s instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5’-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5’RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.

scholarly journals First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 762-762 ◽  
Author(s):  
R. K. Sampangi ◽  
C. Almeyda ◽  
K. L. Druffel ◽  
S. Krishna Mohan ◽  
C. C. Shock ◽  
...  
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Great Basin ◽  
Natural Infection ◽  
The United States ◽  
Native Plant ◽  
Rt Pcr ◽  
Cmv Infection ◽  
Spot Virus ◽  
First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

scholarly journals First Report of Cucumber mosaic virus Subgroup II Infecting Lycopersicon esculentum in India

Plant Disease ◽  
2006 ◽  
Vol 90 (11) ◽  
pp. 1457-1457 ◽  
Author(s):  
N. Sudhakar ◽  
D. Nagendra-Prasad ◽  
N. Mohan ◽  
K. Murugesan
Keyword(s):  
Coat Protein ◽  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Tamil Nadu ◽  
Indian Subcontinent ◽  
Enzyme Linked Immunosorbent Assay ◽  
Infected Leaf ◽  
Polymorphism Analysis ◽  
First Report ◽  
Subgroup Ii

During a survey in January 2006 near Salem in Tamil Nadu (south India), Cucumber mosaic virus was observed infecting tomatoes with an incidence of more than 70%. Plants exhibiting severe mosaic, leaf puckering, and stunted growth were collected, and the virus was identified using diagnostic hosts, evaluation of physical properties of the virus, compound enzyme-linked immunosorbent assay (ELISA) (ELISA Lab, Washington State University, Prosser), reverse-transcription polymerase chain reaction (RT-PCR), and restriction fragment length polymorphism analysis (DSMZ, S. Winter, Germany). To determine the specific CMV subgroup, total RNA was extracted from 50 infected leaf samples using the RNeasy plant RNA isolation kit (Qiagen, Hilden, Germany) and tested for the presence of the complete CMV coat protein gene using specific primers as described by Rizos et al. (1). A fragment of the coat protein was amplified and subsequently digested with MspI to reveal a pattern of two fragments (336 and 538 bp), indicating CMV subgroup II. No evidence of mixed infection with CMV subgroup I was obtained when CMV isolates representing subgroups I (PV-0419) and II (PV-0420), available at the DSMZ Plant Virus Collection, were used as controls. Only CMV subgroup I has been found to predominantly infect tomato in the Indian subcontinent, although Verma et al. (2) identified CMV subgroup II infecting Pelargonium spp., an ornamental plant. To our knowledge, this is the first report of CMV subgroup II infecting tomato crops in India. References: (1) H. Rizos et al. J. Gen. Virol. 73:2099, 1992. (2) N. Verma et al. J. Biol. Sci. 31:47, 2006.

Sign in / Sign up

Export Citation Format

Share Document