Invasive Weed
Recently Published Documents


TOTAL DOCUMENTS

847
(FIVE YEARS 446)

H-INDEX

38
(FIVE YEARS 15)

Insects ◽  
2021 ◽  
Vol 12 (10) ◽  
pp. 927
Author(s):  
Wenjing Wu ◽  
Yahui Hou ◽  
Shijun Zhang ◽  
Yong Chen ◽  
Wenhui Zeng ◽  
...  

Effective approaches to exploiting the biomass of the abundant invasive weed Mikania micrantha Kunth are limited. Termites have been a focus of significant attention as mediators of biomass-processing owing to their ability to digest lignocellulose. Here, the GC/TOF-MS approach was employed to assess the effects of a diet composed of M. micrantha leaves on Coptotermes formosanus workers, with the growth performance of these workers also being assessed. The workers increased their dietary intake when fed M. micrantha leaves, with a concomitant gradual increase in mortality rate. A total of 62 differentially abundant metabolites and nine significantly affected pathways were found when comparing termites fed M. micrantha leaves to pinewood. Key metabolites, including carbohydrates, polyols, 4-hydroxyphenylacetic acid, and their related metabolic pathways, suggested that termites can digest and utilize M. micrantha-derived lignocellulose. However, changes in the tryptophan metabolism, tyrosine metabolism, and sphingolipid metabolism suggest an adverse effect of M. micrantha leaves on antioxidant activity and signal transduction in termites. Overall, this study identified the key metabolites and pathways associated with the response of these termites to dietary changes and the effect of M. micrantha on termites.


Plants ◽  
2021 ◽  
Vol 10 (10) ◽  
pp. 2157
Author(s):  
Aakansha Chadha ◽  
Singarayer Florentine

Lactuca serriola L. (wild lettuce) is a highly invasive C3 weed in many countries, including Australia, Canada, and the USA. This weed is a severe threat to agricultural systems, especially in crops grown with reduced or no-tillage approaches, which commonly include wheat, cereals and pulses. Owing to the vertical orientation of its leaves in the north-south plane and its root architecture, L. serriola can maintain high water use efficiency under drought conditions, giving it the ability to expand its range under a drying climate. Each plant can produce up to 100,000 seeds which have no primary dormancy and form a short-term seedbank lasting up to three years. Most seedlings emerge in autumn and overwinter as a rosette, with a small flush of emergence in spring depicting staggered germination. Research into control methods for this weed has been performed, and these methods include chemical herbicides applied alone and in combination, the establishment of plant competition, tillage, mowing and bioherbicide. Herbicides can provide effective control when applied in the seedling or rosette stage; however, spring germination is difficult to control, as it skips the rosette stage. Some biotypes are now resistant to ALS inhibitor and synthetic auxins, causing concern regarding using herbicides. A dedicated integrated management plan for 3–4 years is recommended for the control of this troublesome species. This review will explore the biology, ecology, distribution, current control techniques and previous research on this weed, allowing us to make recommendations for its future research and management.


Author(s):  
P. Rajesh ◽  
Francis H. Shajin ◽  
G. Kodeeswara Kumaran

This manuscript proposes an improved DC-DC converter framework using hybrid control algorithm for minimizing brushless DC motor (BLDC) torque ripple (TR). At first, the modeling of the brushless DC motor is intended by an enhanced Cuk converter (ECC). The function and performance of the Cuk converter are updated using application of switched inductor. In this way, the control system integrates two control loops such as speed and torque control loop, which is employed for improving BLDC performance. Therefore, the Invasive Weed Optimization (IWO) and Local Random Search (LRS) are proposed to enhance control loop operations. In the IWO algorithm, the LRS approach is used as part of the dispersion process to build up the course of action to find precision. This manuscript explores the IWO-LRS algorithm for limiting BLDC motor speed and torque error. Nevertheless, the exit from the proposed approach is subject to the speed and torque controller input. The better optimal gain parameters have been worked out for the update of the controller operation through the aid of necessary goal functions. The proposed controller topology is activated in MATLAB/Simulink site and the performance is evaluated using other existing methods, like Particle Swarm Optimization (PSO), Bacterial Foraging (BF) algorithm.


2021 ◽  
Vol 99 (Supplement_3) ◽  
pp. 350-350
Author(s):  
J B Adkins ◽  
J P Gulizia ◽  
Kevin M Downs ◽  
S Cui

Abstract Kudzu (Pueraria montana var. lobata) is an invasive weed species native to eastern Asia affecting much of the southeastern United States. Its broad leaves and viny growth allow it to outcompete native plant species for sunlight and nutrients. Kudzu, however, is a leguminous plant, making it a potential feedstock for ruminant species. Browsing ruminants in areas affected by kudzu could benefit animal productivity while serving to ameliorate rapid plant growth. This study specifically sought to assess the overall rumen degradability, rate of digestion, digestible fraction, and indigestible fraction using an in situ methodology. In situ rumen degradability was analyzed using four ruminally fistulated steers as individual experimental units over two repeated trials. Samples were incubated at 1, 12, 24, 36, 48, 60, and 72 h. Kudzu used in these trials was collected during September, making analysis in this study a reflection of degradability toward the end of the growing season. Data were analyzed as a randomized complete block design with repeated measures showing no significant differences between steers or trials (P > 0.05). Overall degradability across all steers and times was 69.79%. Significant changes in dry matter disappearance across all steers were observed at 1, 12, and 24 h (P < 0.05) with values of 33.86, 64.78, and 74.26%, respectively, and highest observed degradability at 72 h (79.55%). Incubation times between 24 and 72 h were not used in determining rate of digestion as dry matter disappearances throughout these times were not significantly different (P > 0.05). Rate of digestion (kd) was determined, using linear regression, to be 1.68% ∙ h-1 along with a digestible fraction (Do) of 28.29% and indigestible fraction (U) of 22.03%. The results of this study reflect that kudzu maintains a relatively high level of rumen degradability toward seasonal senescence, making it a functional feedstock even into the cooler months.


2021 ◽  
Vol 23 (10) ◽  
pp. 295-300
Author(s):  
F.Johnsy Mary ◽  
◽  
Dr.M.Senthil Kumar ◽  
E. Vijaykumar ◽  
G. Yadeshwaran ◽  
...  

Parthenium hysterophorus, often known as congers grass, is a noxious weed that is a member of the Asteraceae family of plants. Its natural habitats include the areas surrounding the Gulf of Mexico, Central America, Southern North America, the West Indies, and Central South America, among other places. Congress grass has risen to become one of the world’s seven most destructive and deadly weeds, according to the World Health Organization. This invasive plant is also a significant concern in India. It is responsible for a variety of illnesses and allergies in both people and animals. Aside from that, there is some potential for this plant to be used as an insecticide, herbicide, fungicide, wood preservative, anti-amoebic, and even for medicinal purposes. If any species, particularly an invasive weed, is to be evaluated for its ability to benefit living organisms, it is necessary to have a thorough understanding of both its positive and negative impacts. As a result, this review paper is an attempt to describe the present state of knowledge regarding the hazardous and helpful effects of Parthenium hysterophorus on people and animals.


2021 ◽  
Author(s):  
Atiqur Rahman Bora ◽  
Dasi Sunil Babu ◽  
Sita Chetry ◽  
Sontara Kalita

The world’s problematic perennial weed Mikania micrantha hampers in crop production and causes enormous losses due to its interference. Management of M. micrantha by mechanical and chemical methods has not met with any reasonable success. So, it has become a target for classical biological control. Numerous natural indigenous plant species, fungi and insects were tried as bio-control agents for effective control of M. micrantha. However, along with bio-control, appropriate mechanical, chemical and cultural methods are required to be integrated for controlling it. Thus, integrated management approaches for control of M. micrantha should be evolved against this invasive weed in long run.


2021 ◽  
pp. 1-22
Author(s):  
Mark E. Thorne ◽  
Drew J. Lyon

Rush skeletonweed is an invasive weed in winter wheat (WW)/summer fallow (SF) rotations of the low to intermediate rainfall areas of the inland Pacific Northwest. Standard weed control practices are not effective, resulting in additional SF tillage or herbicide applications. The objective of this field research was to identify herbicide treatments that control rush skeletonweed during the SF phase of the WW/SF rotation. Trials were conducted near LaCrosse, WA in 2017-2019 and 2018-2020, and near Hay, WA in 2018-2020. The LaCrosse 2017-2020 trial was in tilled SF; the other two trials were in no-till SF. Fall post-harvest applications in October included clopyralid, clopyralid plus 2,4-D, clopyralid plus 2,4-D plus chlorsulfuron plus metsulfuron, aminopyralid, picloram, and glyphosate plus 2,4-D. Spring treatments of clopyralid, aminopyralid, and glyphosate were applied to rush skeletonweed rosettes. Summer treatments of 2,4-D were applied when rush skeletonweed initiated bolting. Plant density was monitored through the SF phase in all plots. Picloram provided complete control of rush skeletonweed through June at all three locations. Fall-applied clopyralid, clopyralid plus 2,4-D, and clopyralid followed by 2,4-D in summer reduced rush skeletonweed through June at the two LaCrosse sites but were ineffective at Hay. In August, just prior to winter wheat seeding, the greatest reductions in rush skeletonweed density were achieved with picloram and fall-applied clopyralid at the two LaCrosse sites. No treatments provided effective control into August at Hay. Wheat yield in the next crop compared to the nontreated control was reduced only at one LaCrosse site by a spring-applied aminopyralid treatment, otherwise no other reductions were found. Long-term control of rush skeletonweed in WW/SF may be achieved by a combination of fall application of picloram, after wheat harvest, followed by an effective burn-down treatment in August prior to winter wheat seeding.


Plant Disease ◽  
2021 ◽  
Author(s):  
Daniel Dalvan Nascimento ◽  
Edicleide Macedo da Silva ◽  
Ana Paula Mendes Lopes ◽  
Rivanildo Junior Ferreira ◽  
Vanessa Rafaela Carvalho ◽  
...  

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel’s Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56'60.0"S 48°29'16.0"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel’s Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel’s Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.


2021 ◽  
Author(s):  
Hemn Barzan Abdalla

Abstract The increasing demand for information and rapid growth of big data has dramatically increased textual data. The amount of different kinds of data has led to the overloading of information. For obtaining useful text information, the classification of texts is considered an imperative task. This paper develops a technique for text classification in big data using the MapReduce model. The goal is to design a hybrid optimization algorithm for classifying the text. Here, the pre-processing is done with the steaming process and stop word removal. In addition, the Extraction of imperative features is performed wherein SentiWordNet features, contextual features, and thematic features are generated. Furthermore, the selection of optimal features is performed using Tanimoto similarity. The Tanimoto similarity method estimates the similarity between the features and selects the relevant features with higher feature selection accuracy. After that, a deep residual network is utilized for dynamic text classification. The Adam algorithm trains the deep residual network. In addition, the dynamic learning is performed with the proposed Rider invasive weed optimization (RIWO)-based deep residual network along with fuzzy theory. The proposed RIWO algorithm combines Invasive weed optimization (IWO) and the Rider optimization algorithm (ROA). The method mentioned above is solved under the MapReduce framework. The proposed RIWO-based deep residual network outperformed other techniques with the highest True positive rate (TPR) of 85%, True negative rate (TNR) of 94%, and accuracy of 88.7%.


Sign in / Sign up

Export Citation Format

Share Document