scholarly journals Occurrence of Potato Soft Rot Caused by Erwinia carotovora (synonym Pectobacterium carotovorum) in Nepal: A First Report

Plant Disease ◽  
2010 ◽  
Vol 94 (3) ◽  
pp. 382-382 ◽  
Author(s):  
J. R. Lamichhane ◽  
G. M. Balestra ◽  
L. Varvaro
Keyword(s):  
16S Rdna ◽  
Solanum Tuberosum L ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Potato Tubers ◽  
Biochemical Tests ◽  
Wide Range ◽  
Fundamental Value ◽  
Negative Controls

Potato (Solanum tuberosum L.) is the fourth most important major crop of Nepal after rice, corn, and wheat, with an annual production of 1.94 million t and 153,000 ha of harvested area. It is a staple food crop in the remote hilly areas and the main vegetable in other parts of the country. Potato is grown in all three major agricultural zones (high hills, mid hills, and plain land) of Nepal, at an altitude ranging from 60 m to more than 4,000 m. Erwinia carotovora causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During the spring of 2009, a soft rot with a foul smell was noted in stored potato tubers of different local cultivars, especially Rato Alu and Seto Alu, in the Kathmandu District, central region of Nepal. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white-to-cream colored. Seven different potato fields, where the stored tubers originated, were surveyed and 23 samples consisting of approximately three symptomatic tubers were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar supplemented with 5% sucrose and incubated at 26 ± 1°C. After purification on tripticase soy agar medium, 17 isolates were identified as E. carotovora by the following deterministic tests: all strains were gram-negative rods; oxidase negative; facultatively anaerobic; able to degrade pectate; sensitive to erythromycin; negative for phosphatase; unable to produce acid from α-methyl-glucoside; and produced acid from trehalose. Pathogenicity of the strains was evaluated by depositing a bacterial suspension (106 CFU/ml) on potato slices (cv. Monalisa) and incubating at 30 ± 1°C. A reference strain of E. carotovora subsp. carotovora (NCPPB 2577) and sterile distilled water were used, respectively, as positive and negative controls. All strains caused soft rot within a week. Bacteria were reisolated from the slices and were shown to be identical to the original strains according to the above morphological, cultural, and biochemical tests. A 1,430-bp region of the 16S rDNA from all strains was amplified with primers NOC 1F (AGAGTTTGATCATGGCTCAG) and NOC 3R (ACGGTTACCTTGTTACGACTT) and sequenced (GenBank Accession No. GU075708; strain NEP ECC09). A BlastN search of GenBank revealed that the strains had 100% nt identity with the 16S rDNA sequence of E. carotovora subsp. carotovora type strain ATCC 15713 (GenBank Accession No. U80197). The finding of this pathogen is of fundamental value since this crop represents one of the economically important crops of Nepal. This pathogen has already been reported in the countries of China and India (1) with whom Nepal shares its boundaries. The pathogen may have been introduced to this region of Nepal via seed potato tubers from other countries. Reference: (1) G. S. Shekhawat et al. Potato Res. 19:241, 1976.

Use of 1,4-naphthoquinones for control of Erwinia carotovora

2004 ◽  
Vol 50 (11) ◽  
pp. 951-956 ◽  
Author(s):  
Luis F.C Medina ◽  
Valter Stefani ◽  
Adriano Brandelli
Keyword(s):  
Antimicrobial Effect ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Sodium Ascorbate ◽  
Bacterial Suspension ◽  
Oxygen Species ◽  
Potato Tubers ◽  
Phytopathogenic Bacteria ◽  
Minimal Inhibitory Concentrations

The antimicrobial effect of 5 naphthoquinones was tested against the phytopathogenic bacteria Erwinia carotovora. Disk diffusion tests and determination of minimal inhibitory concentrations (MIC) indicate that the compound naphthazarin (NTZ) has the best antibacterial activity among the naphthoquinones tested. Studies on the mode of action indicate the effect of NTZ was bactericidal at 10 µg/mL. When cultivation was done in the presence of sodium ascorbate, the restoration of E. carotovora growth was observed with 3 µg/mL NTZ, but not when a 10 µg/mL dose was used. The incubation of NTZ with bacterial suspension of E. carotovora resulted in important changes in the absorption spectra of this naphthoquinone, indicating that a redox reaction takes place. These results may suggest that NTZ induces an increase of reactive oxygen species that are toxic to the cell. The compound NTZ was also effective in preventing E. carotovora growth on potato tubers, inhibiting the soft rot development at a concentration of 2 mg/mL.Key words: antimicrobial, naphthazarin, phytopathogen, potato, 5,8-dihydroxy-1,4-naphthoquinone.

scholarly journals First Report of Pectobacterium punjabense causing potato soft rot and blackleg in Serbia

Plant Disease ◽  
2021 ◽  
Author(s):  
Marta Loc ◽  
Dragana Milošević ◽  
Maja Ignjatov ◽  
Žarko Ivanović ◽  
Dragana Budakov ◽  
...  
Keyword(s):  
16S Rdna ◽  
Potato Plant ◽  
Soft Rot ◽  
Economic Losses ◽  
Bacterial Suspension ◽  
Distilled Water ◽  
Potato Tubers ◽  
First Report ◽  
Potato Plants ◽  
16S Rdna Pcr

Soft rot and blackleg are common diseases affecting potato (Solanum tuberosum) production in Serbia. Pectinolytic plant pathogens belonging to the genera Pectobacterium cause soft rot and wilt diseases by plant cell wall degradation. These opportunistic phytopathogens lead to considerable economic losses in many potato-growing regions worldwide and are listed among top 10 plant pathogenic bacteria (Mansfield et al. 2012). Potato plants (cv. VR808) with symptoms of wilting, slow growth, stem blackening and tubers softening, were collected from a commercial potato field in Zobnatica (Serbia) in July 2019 and subjected to analysis. All symptoms occurred in the same field and the incidence of symptomatic plants was approximately 5%. Isolation was performed from 10 randomly chosen potato plant and tuber samples, expressing wilting and soft rot symptoms. Plant tissue was surface-disinfected and 1 cm length sections from the margins of lesions were macerated in sterile distilled water for 25 min and streaked on nutrient-agar medium. After 48 h of incubation at 26°C, predominant shiny, cream-colored, round colonies were obtained from all samples. Three representative isolates (MMZKVR1, MMZCVR2, and MMZKVR3) from independent samples were selected randomly and subjected to biochemical and pathogenicity tests. Isolates were gram-negative, nonfluorescent facultative anaerobes, exhibiting pectinolytic activity on potato tuber slices and hypersensitive response on tobacco leaves. They expressed catalase activity but did not express oxidase or acid phosphatase activity or produce indole. All strains grew at 37°C, in 5% NaCl, and reduced nitrate. Pathogenicity of the obtained isolates was tested on 3-week-old healthy potato plants (cv. VR808 and cv. Kiebitz) grown in commercial Baltic Tray Substrate (Hawita) in the greenhouse, as well as on potato tubers of the same varieties. Three potato plant stems per isolate were inoculated by the toothpick piercing method (Duarte et al. 2004) using bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated plants were incubated under plastic bags in a greenhouse at 25 ± 2°C. Blackleg symptoms and stem wilting developed 48 hours after inoculation. No symptoms were observed on plants inoculated with sterile toothpicks dipped in sterile distilled water. The pathogen was re-isolated from symptomatic plants, fulfilling Koch's postulates and sequencing of 16S rDNA confirmed the originally isolated pathogen. Three potato tubers per isolate were inoculated by toothpicks dipped in bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated tubers were placed in a sealed plastic container at 25 ± 2°C. Treatment with sterile distilled water was used as a negative control. Softening of the tissue around the inoculation point developed within 48 h from inoculation, and no symptoms developed on the control tubers. For molecular analyses, total DNA of the isolates was extracted using the DNeasy Plant Mini Kit (Qiagen). The isolates were not detected in diagnostic PCR assays using specific primers Br1F/L1R for the detection of P. brasiliense (Duarte et al. 2004) and primers EXPCCF/EXPCCR for P. catotovorum subsp. carotovorum (Kang et al. 2003). The 16S rDNA PCR amplification was performed using the universal PCR primer pair 27F/1492R (Fredriksson et al. 2013) and followed by Sanger sequencing (Macrogen Europe BV). The BLASTn analysis of sequences (GenBank Accession Numbers MZ048661, MZ048662, and MZ157274) revealed 100% query coverage and 100% identity to the sequences of Pectobacterium punjabense in NCBI (MT242589 and CP038498) isolated from potato in China and Pakistan (Sarfraz et al. 2018), respectively. All three obtained isolates were proposed to belong to Pectobacterium punjabense sp. nov. To further validate the identification, isolate MMZCVR2 of P. punjabense was selected for multilocus sequence analyses of 5 housekeeping genes (gyrA, recA, recN, rpoA and rpoS). The gyrA (MZ161817), recA (MZ161818), recN (MZ161819), rpoA (MZ161820) and rpoS (MZ161821) sequence analysis showed the highest nucleotide identity (99.44 to 100%) with P. punjabense strain SS95 (Sarfraz et al. 2018) previously deposited in NCBI GenBank database. To our knowledge, this is the first report of blackleg and soft rot caused by P. punjabense on potato in Serbia. Pectobacterium punjabense is a newly described species causing soft rot and blackleg disease in potato plants (Sarfraz et al. 2018). Its current geographic distribution is not well-described but important to know since soft rot bacteria are easily transported long distances in latently infected seed tubers and can cause significant economic losses in potato production worldwide.

Bacteriocin-like substance inhibits potato soft rot caused by Erwinia carotovora

2006 ◽  
Vol 52 (6) ◽  
pp. 533-539 ◽  
Author(s):  
Florencia Cladera-Olivera ◽  
Geruza R Caron ◽  
Amanda S Motta ◽  
André A Souto ◽  
Adriano Brandelli
Keyword(s):  
Electron Microscopy ◽  
Transmission Electron Microscopy ◽  
Bacillus Licheniformis ◽  
Membrane Lipids ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bactericidal Effect ◽  
Potato Tubers ◽  
Transmission Electron ◽  
Bacterial Surfaces

Soft rot is a major problem encountered in potatoes during postharvest storage. The soft rot bacterium Erwinia carotovora was inhibited by a novel bacteriocin-like substance (BLS) produced by Bacillus licheniformis P40. The BLS caused a bactericidal effect on E. carotovora cells at 30 µg mL–1. Transmission electron microscopy showed that BLS-treated cells presented wrinkled bacterial surfaces and shrinkage of the whole cell, indicating plasmolysis. Erwinia carotovora cells treated with BLS were analyzed by FTIR showing differences in the 1390 cm–1 and 1250–1220 cm–1 bands, corresponding to assignments of membrane lipids. BLS was effective in preventing E. carotovora spoilage on potato tubers, reducing the symptoms of soft rot at 240 µg mL–1 and higher concentrations. Soft rot development was completely blocked at 3.7 mg mL–1. This BLS showed potential to protect potato tubers during storage. Key words: bacteriocin, plant pathogen, potato, soft rot, storage.

scholarly journals Assessing Susceptibility of Carrot Roots to Bacterial Soft Rot

HortScience ◽  
1992 ◽  
Vol 27 (9) ◽  
pp. 1020-1022 ◽  
Author(s):  
Barbara Michalik ◽  
Philipp W. Simon ◽  
Warren H. Gabelman
Keyword(s):  
Screening Method ◽  
Erwinia Carotovora ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Bacterial Soft Rot ◽  
Severe Damage ◽  
Cross Sectional ◽  
Severity Of Disease ◽  
Disease Damage ◽  
Consistent Response

Four methods for screening carrot (Daucus carota L.) germplasm for resistance to bacterial soft rot were compared. There were differences in resistance among strains, with most severe damage caused by Erwinia carotovora pv. carotovora SR 394 (L.R. Jones) Holland and Erwinia carotovora pv. atroseptica SR 159 (van Hall) Jennison. Inoculation of cross-sectional root slices with bacteria applied in suspension-soaked paper disks produced the most consistent response. The severity of disease damage was proportional to bacterial suspension concentration. With the development of a standard screening method, it may be possible for breeders to breed carrots with reduced susceptibility to soft rot.

scholarly journals First Report of a Soft Rot of Phalaenopsis aphrodita Caused by Dickeya dieffenbachiae in China

Plant Disease ◽  
2012 ◽  
Vol 96 (5) ◽  
pp. 760-760 ◽  
Author(s):  
J. N. Zhou ◽  
B. R. Lin ◽  
H. F. Shen ◽  
X. M. Pu ◽  
Z. N. Chen ◽  
...  
Keyword(s):  
16S Rdna ◽  
Large Scale ◽  
Soft Rot ◽  
The Philippines ◽  
Gyrb Gene ◽  
Bacterial Suspension ◽  
Sterile Water ◽  
Gene Sequences ◽  
First Report ◽  
Tropical Asia

Phalaenopsis orchids, originally from tropical Asia, are mainly planted in Thailand, Singapore, Malaysia, the Philippines, and Taiwan and have gained popularity from consumers all over the world. The cultivation area of Phalaenopsis orchids has been rising and large-scale bases have been established in mainland China, especially South China because of suitable environmental conditions. In September 2011, a soft rot of Phalaenopsis aphrodita was found in a Phalaenopsis planting base in Guangzhou with an incidence of ~15%. Infected plants initially showed water-soaked, pale-to-dark brown pinpoint spots on leaves that were sometimes surrounded by a yellow halo. Spots expanded rapidly with rising humidity and temperatures, and in a few days, severely extended over the blade with a light tan color and darker brown border. Lesions decayed with odorous fumes and tissues collapsed with inclusions exuding. The bacterium advanced to the stem and pedicle. Finally, leaves became papery dry and the pedicles lodged. Six diseased samples were collected, and bacteria were isolated from the edge of symptomatic tissues after sterilization in 0.3% NaOCl for 10 min, rinsing in sterile water three times, and placing on nutrient agar for culture. Twelve representative isolates were selected for further characterization. All strains were gram negative, grew at 37°C, were positive for indole production, and utilized malonate, glucose, and sucrose but not glucopyranoside, trehalose, or palatinose. Biolog identification (version 4.20.05, Hayward, CA) was performed and Pectobacterium chrysanthemi (SIM 0.868) was confirmed for the tested isolates (transfer to genus Dickeya). PCR was used to amplify the 16S rDNAgene with primers 27f and 1492r, dnaX gene with primers dnaXf and dnaXr (3), and gyrB gene with primers gyrBf (5′-GAAGGYAAAVTKCATCGTCAGG-3′) and gyrB-r1 (5′-TCARATATCRATATTCGCYGCTTTC-3′) designed on the basis of the published gyrB gene sequences of genus Dickeya. BLASTn was performed online, and phylogeny trees (100% bootstrap values) were created by means of MEGA 5.05 for these gene sequences, respectively. Results commonly showed that the representative tested strain, PA1, was most homologous to Dickeya dieffenbachiae with 98% identity for 16S rDNA(JN940859), 97% for dnaX (JN989971), and 96% for gyrB (JN971031). Thus, we recommend calling this isolate D. dieffenbachiae PA1. Pathogenicity tests were conducted by injecting 10 P. aphrodita seedlings with 100 μl of the bacterial suspension (1 × 108 CFU/ml) and another 10 were injected with 100 μl of sterile water as controls. Plants were inoculated in a greenhouse at 28 to 32°C and 90% relative humidity. Soft rot symptoms were observed after 2 days on the inoculated plants, but not on the control ones. The bacterium was isolated from the lesions and demonstrated identity to the inoculated plant by the 16S rDNA sequence comparison. Previously, similar diseases of P. amabilis were reported in Tangshan, Jiangsu, Zhejiang, and Wuhan and causal agents were identified as Erwinia spp. (2), Pseudomonas grimontii (1), E. chrysanthemi, and E. carotovora subsp. carovora (4). To our knowledge, this is the first report of D. dieffenbachiae causing soft rot disease on P. aphrodita in China. References: (1) X. L. Chu and B. Yang. Acta Phytopathol. Sin. 40:90, 2010. (2) Y. M. Li et al. J. Beijing Agric. Coll. 19:41, 2004. (3) M. Sławiak et al. Eur. J. Plant Pathol. 125:245, 2009. (4) Z. Y. Wu et al. J. Zhejiang For. Coll. 27:635, 2010.

scholarly journals First Report of Bacterial Soft Rot of Potato Caused by Pectobacterium carotovorum subsp. carotovorum in Guangdong Province of China

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1819-1819 ◽  
Author(s):  
J. X. Zhang ◽  
B. R. Lin ◽  
H. F. Shen ◽  
X. M. Pu ◽  
Z. N. Chen ◽  
...  
Keyword(s):  
Guangdong Province ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Pectobacterium Carotovorum ◽  
Bacterial Soft Rot ◽  
First Report ◽  
Wide Range ◽  
Carotovorum Subsp ◽  
Agar Media

Potato (Solanum tuberosum L.) is a major crop in China, with 80.0 million tons being produced in 2010 on 3.3 million ha. Pectobacterium carotovorum subsp. carotovorum Jones 1901; Hauben et al. 1999 causes soft rot worldwide on a wide range of hosts including potato, carrot, and cabbage. During spring 2010, a soft rot with a foul smell was noted in stored potato tubers of different cultivars in the Guangdong Province. Symptoms on tubers appeared as tan, water-soaked areas with watery ooze. The rotted tissues were white to cream colored. Stems of infected plants with typical inky black symptoms could also be found in the fields prior to harvest. Three different potato fields were surveyed, and 13% of the plants had the symptoms. Twenty-seven samples (three symptomatic tubers per sample) were collected. Bacteria were successfully isolated from all diseased tissues on nutrient agar media supplemented with 5% sucrose and incubated at 26 ± 1°C for 36 h. After purification on tripticase soy agar media, four typical strains (7-3-1, 7-3-2, 8-3-1, and 8-3-2) were identified using the following deterministic tests: gram-negative rods, oxidase negative, facultatively anaerobic, able to degrade pectate, sensitive to erythromycin, negative for phosphatase, unable to produce acid from α-methyl-glucoside, and produced acid from trehalose. Biolog analysis (Ver 4.20.05, Hayward, CA) identified the strains as P. carotovorum subsp. carotovorum (SIM 0.808, 0.774, 0.782, and 0.786, respectively). The identity of strains 7-3-1 (GenBank Accession No. JX258132), 7-3-2 (JX258133), and 8-3-1 (JX196705) was confirmed by 16S rRNA gene sequencing (4), since they had 99% sequence identity with other P. carotovorum subsp. carotovorum strains (GenBank Accession Nos. JF926744 and JF926758) using BLASTn. Further genetic analysis of strain 8-3-1 was performed targeting informative housekeeping genes, i.e., acnA (GenBank Accession No. JX196704), gabA (JX196706), icdA (JX196707), mdh (JX196708), mtlD (JX196709), pgi (JX196710), and proA (JX196711) (2). These sequences from strain 8-3-1 were 99 to 100%, homologous to sequences of multiple strains of P. carotovorum subsp. carotovorum. Therefore, strain 8-3-1 grouped with P. carotovorum subsp. carotovorum on the phylogenetic trees (neighbor-joining method, 1,000 bootstrap values) of seven concatenated housekeeping genes when compared with 60 other strains, including Pectobacterium spp. and Dickeya spp. (3). Pathogenicity of four strains (7-3-1, 7-3-2, 8-3-1, and 8-3-2) was evaluated by depositing a bacterial suspension (106 CFU/ml) on the potato slices of cultivar ‘Favorita’ and incubating at 30 ± 1°C. Slices inoculated with just water served as non-inoculated checks. The strains caused soft rot within 72 h and the checks had no rot. Bacteria were reisolated from the slices and were shown to be identical to the original strains based on morphological, cultural, and biochemical tests. Although this pathogen has already been reported in northern China (1), to our knowledge, this is the first report of P. carotovorum subsp. carotovorum causing bacterial soft rot of potato in Guangdong Province of China. References: (1) Y. X. Fei et al. J. Hexi Univ. 26:51, 2010.(2) B. Ma et al. Phytobacteriology 97:1150, 2007. (3) S. Nabhan et al. Plant Pathol. 61:498, 2012. (4) W. G. Weisbury et al. J. Bacteriol. 173:697, 1991.

Sign in / Sign up

Export Citation Format

Share Document