First Report of Phytophthora pini Causing Foliage Blight and Shoot Dieback of Rhododendron pulchrum in China

During a 2019–2020 survey for plant pathogenic oomycetes in Nanjing, China, severe foliage blight and dieback were observed on approximately 20 Rhododendron pulchrum plants at three public parks and gardens. Approximately 25% of leaves and shoots were affected. Symptoms included brown to black lesions on leaves and stems, dieback of shoot tips, and wilting. Diseased tissues were collected from a five-year-old shrub with typical disease symptoms at Xuanwuhu Park. They were cut into 10×10 mm2 squares, immersed in 70% ethanol for 30 sec, and placed onto fresh clarified V8 juice agar (cV8A) containing pimaricin, ampicillin, rifampicin, and pentachloronitrobenzene. Phytophthora-like hypae were transferred to new cV8A plates daily. A total of five isolates were obtained after five days of incubation at 25°C. After approximately 20 days, all isolates were identical in morphological traits including semi-papillate sporangia and gametangia (homothallic). Thirty sporangia of a representative isolate Ppi were randomly selected and examined. They were mostly ovoid and sometimes obpyriform, averaging 41.0 ± 3.9 × 24.8 ± 3.2 µm. Antheridia of 30 randomly selected gametangia were paragynous, averaging 16.7 ± 0.7 × 12.4 ± 1.5 µm. Average diameters of oogonia and plerotic oospores were 29.2 ± 0.3 µm and 26.4 ± 1.6 µm, respectively. Chlamydospores were not observed. The above morphological traits suggested the causal agent belonging to the “P. citricola-complex”. Isolate Ppi was subjected to sequencing of the rDNA internal transcribed spacer (ITS) region and the ras‐related GTP‐binding protein 1 (Ypt1) gene. ITS sequence of Ppi (GenBank ACN. MT672594) has 100% identity to that of P. pini (MG865565). It has a 3-nt difference from the ITS sequences of P. acerina (MG518642) and P. citricola (MG865475) and a 4-nt difference from that of P. plurivora (FJ665225). Ypt1 sequence of Ppi (MT680000) has 100% identity to that of P. pini (MK058416). Pathogenicity of Ppi on R. pulchrum was tested using both detached-leaf and whole-plant assays. In the former assay, each of six asymptomatic leaves was symmetrically wounded at both sides using a sterile inoculation needle. A 5×5 mm2 Ppi-colonized cV8A plug was placed on each wound of five leaves. Sterile agar plugs were used for a control leaf. All six leaves were placed on a wet filter paper in a closed container at 25°C. This assay was repeated twice. On the fifth day, all inoculated leaves had necrotic tissues around the wounds, while the control leaves remained asymptomatic. In the whole-plant assay, 20-inch-tall plants were used. Five attached leaves and the twig base of each plant were wounded. A control plant was inoculated in the same manner above, while sterile agar plugs were used. Each plant was covered with a plastic bag and maintained at 25°C. Wet cotton balls were placed in the bags to maintain humidity. After two days, the bag containing cotton balls was removed. This assay was repeated three times. After two weeks, all three inoculated plants in the three replicated trials had severe foliage blight and dieback, whereas control plants remained healthy. Phytophthora isolates recovered from artificially inoculated tissues were identical to isolate Ppi in morphological characters. Rhododendron diseases caused by P. pini were reported in the USA and Finland . This is the first report of P. pini causing foliage blight and dieback on R. pulchrum, an important nursery and landscape plant in China. Additional surveys are ongoing to determine the distribution of this pathogen in Nanjing. Management programs are under development to contain the spread of P. pini and treat diseased plants.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Albugo candida Causing White Rust on Lunaria annua in Italy

Plant Disease ◽

10.1094/pdis-07-10-0513 ◽

2011 ◽

Vol 95 (1) ◽

pp. 72-72

Author(s):

I. Camele ◽

S. M. Mang ◽

G. L. Rana

Keyword(s):

Direct Sequencing ◽

Morphological Characteristics ◽

Its Region ◽

First Report ◽

Albugo Candida ◽

White Rust ◽

Landscape Plant ◽

Average Maximum ◽

Mother Plants ◽

Health Progress

Money plant or annual honesty (Lunaria annua L.) is an ornamental landscape plant used in flower beds and borders and also in flower arrangements. It is a biennial plant with large, pointed, oval leaves. Plants of L. annua showing white-to-cream, blister-like lesions on leaves and siliques (2) were found in private gardens where approximately 800 plants of 1,000 (approximately 80 to 90%) that were observed showed symptoms. The disease was also found in two ornamental nurseries, although it was limited to a few mother plants because of extensive fungicide treatments. The gardens and ornamental nurseries were located in Potenza Province (Basilicata Region, southern Italy). Sporangiophores were mostly straight or arched and almost cylindrical with attenuated base and flat or rounded apex and measured 29.2 to 33.4 × 12.8 to 13.4 μm. Sporangia, produced in chains and joined by short connectives, exhibited a spherical or angular shape, were subhyaline, contained vacuoles, and had average maximum and minimum diameters ranging from 15.8 to 18.8 and 14 to 16 μm, respectively. The morphological characteristics closely resembled those reported for Albugo candida (Pers.) Kuntze (3). Sori were collected from naturally and artificially inoculated tissues of L. annua, with the aid of a stereomicroscope, and used to extract genomic DNA via a DNeasy Plant Mini DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer's directions. The extracted DNA was used as a template for amplification of the internal transcribed spacer (ITS) region of rDNA with primer pair ITS4/DC6 (1,4) and sequenced. One sequence, GenBank Accession No. GQ328846, matched several sequences of A. candida (Pers). Kuntze (e.g., GenBank Accession Nos. GQ328837, GQ328836, GQ328835, GQ328834, and AF271231), showing 98% identity. Pathogenicity tests were performed and repeated twice. Leaves of 10 healthy seedlings of L. annua were surface cleaned during several washings with distilled water and then spray inoculated with a suspension of 103 sporangia/ml of A. candida. Five healthy seedlings were spray inoculated with the same volume of sterile water and served as controls. Inoculated seedlings were maintained in a moist chamber for 48 h at 20°C before being moved to a shaded glasshouse at 16 to 24°C and 90% relative humidity. White rust symptoms, similar to those observed in natural conditions, appeared on leaves of inoculated seedlings 10 to 14 days later, demonstrating that A. candida was the causal agent of the disease. Control plants remained symptomless. White rust has been reported on L. annua in Europe (Czech Republic, Germany, Poland, and the United Kingdom) and in the northwestern United States (3). To our knowledge, this is the first report of A. candida infecting annual honesty plant in Italy. References: (1) P. Bonants et al. Eur. J. Plant Pathol. 103:345, 1997. (2) D. Choi et al. Mycotaxon 53:261, 1995. (3) D. A. Glawe et al. Online publication. doi:10.1094/PHP-2004-0317-01-HN. Plant Health Progress, 2004. (4) T. J. White et al. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols. A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Wilt on Alfalfa in China Caused by Verticillium nigrescens

Plant Disease ◽

10.1094/pdis-07-11-0580 ◽

2011 ◽

Vol 95 (12) ◽

pp. 1591-1591 ◽

Cited By ~ 3

Author(s):

X. P. Hu ◽

M. X. Wang ◽

D. F. Hu ◽

J. R. Yang

Keyword(s):

Vascular Tissue ◽

Its Region ◽

Morphological Characters ◽

Deionized Water ◽

Nuclear Ribosomal Dna ◽

Cow Dung ◽

Its Sequence ◽

Its Sequencing ◽

First Report

Alfalfa (Medicago sativa Linn.), widely grown throughout the world, is an important perennial forage crop. It is high in protein and digestible fiber and is an excellent source of several vitamins (A, D, E, and K) and minerals for beef cattle, horses, sheep, goats, and even humans (2). Wilt symptoms on alfalfa were observed during a disease survey in Yangling, Shaanxi, China in 2009. Symptoms included discoloration, shortened internode, and plant death. However, the vascular tissue of diseased alfalfa plants did not exhibit discoloration and typical “V” symptoms of Verticillium albo-atrum infection. Eleven fungal isolates were obtained from diseased alfalfa plants in Yangling by a tissue isolation method (1). Isolates were cultured on Czapek Dox Agar (CDA; pH 7.2) slants at 22 ± 1°C in darkness. Colonies on CDA plates were whitish and cream-white when viewed from the underside, later becoming dark gray due to the formation of gray or dark brown chlamydospores in single or in short chains. DNA was extracted from each isolate and the internal transcribed spacer (ITS) region of the nuclear ribosomal DNA (rDNA) was amplified and sequenced using primers ITS-1F and ITS4. The 11 isolates were divided into five groups based on their in vitro morphological characters. A single isolate from each of the five groups was chosen for ITS sequencing. All five isolates had the same ITS sequence (GenBank Accession No. AB551216). On the basis of the ITS sequence and morphology (4), these isolates were identified as V. nigrescens Pethyhr. (recently renamed as Gibellulopsis nigrescens). Five representative isolates were used to fulfill Koch's postulates. Alfalfa seeds (cv. Cossack) were surface sterilized with 75% ethanol for 5 min, allowed to dry, and planted into cow dung compost that had been autoclaved at 160°C for 2 h. Plants were cultivated under controlled greenhouse conditions at 23 to 25°C with a photoperiod of 14 h. Inoculum was prepared by comminuting 15-day-old cultures and sterile deionized water into a suspension of mycelial fragments and conidia (105 to 106 CFU/ml) in a blender. Seedlings (four-leaf stage) were inoculated by immersing roots in the inoculum suspension for 60 min (3). Each isolate was inoculated onto 30 seedlings, six in each pot; another 30 seedlings were soaked with sterile deionized water for 60 min as a control. After 20 days in the greenhouse, all inoculated plants exhibited wilt symptoms similar to the original wilt symptoms observed on diseased alfalfa plants. In contrast, none of the control plants showed wilt symptoms. The pathogen was reisolated from all diseased plants and confirmed to the original ones. To our knowledge, this is the first report of V. nigrescens infecting M. sativa in China, indicating V. nigrescens as one possible important pathogen of alfalfa. References: (1) O. D. Dhingra and J. B. Sinclair. Basic Plant Pathology Methods. CRC Press, Boca Raton, FL, 1995. (2) D. Jasjeet et al. J. Adv. Sci. Res. 2:50, 2011. (3) H. A. Melouk and C. E. Horner. Phytopathology 64:1267, 1974. (4) R. Zare et al. Nova Hedwigia 85:463, 2007.

Download Full-text

First Report of Alfalfa mosaic virus Occurrence in Tecoma capensis in the USA

Plant Health Progress ◽

10.1094/php-2012-0824-02-br ◽

2012 ◽

Vol 13 (1) ◽

pp. 38 ◽

Cited By ~ 1

Author(s):

Benham E. Lockhart ◽

Dimitre Mollov

Keyword(s):

Mosaic Virus ◽

Alfalfa Mosaic Virus ◽

Crop Species ◽

Western Usa ◽

First Report ◽

Landscape Plant ◽

Source Of Infection ◽

The Usa

Tecoma capensis or cape honeysuckle is an evergreen vine-line shrub that is widely used as a landscape plant in many areas of the southern and western USA. This is the first report of Alfalfa mosaic virus (AMV) infection associated with a disease of T. capensis outside of Israel and Spain. In addition to the effect on marketability, AMV infection in cape honeysuckle may be a source of infection of other susceptible crop species since AMV is readily transmitted in a nonpersistent manner by at least 13 species of aphid. Accepted for publication 11 July 2012. Published 24 August 2012.

Download Full-text

First report of a sexual state in an ambrosia fungus: Ambrosiella cleistominuta sp. nov. associated with the ambrosia beetle Anisandrus maiche

Botany ◽

10.1139/cjb-2016-0297 ◽

2017 ◽

Vol 95 (5) ◽

pp. 503-512 ◽

Cited By ~ 6

Author(s):

Chase G. Mayers ◽

Thomas C. Harrington ◽

Christopher M. Ranger

Keyword(s):

Dna Sequences ◽

Morphological Characters ◽

Its Rdna ◽

Ambrosia Beetle ◽

Ambrosia Beetles ◽

First Report ◽

The Usa ◽

Sexual State

Genera of ambrosia beetles in the tribe Xyleborini with large, mesonotal mycangia host unique fungal symbionts in the genus Ambrosiella. The symbiont of a recent invasive to the USA from Asia, Anisandrus maiche Stark, had not been previously characterized. We found the mycangium anatomy of An. maiche collected in Ohio to be similar to that of Anisandrus dispar and consistently isolated a novel fungus, Ambrosiella cleistominuta sp. nov., from An. maiche mycangia and galleries. The fungus was distinguished from other named Ambrosiella by morphological characters and DNA sequences (ITS rDNA and tef-1α). The mycangial symbionts of ambrosia beetles had been assumed to be strictly asexual, but A. cleistominuta produces cleistothecious ascomata with ascospores in beetle galleries and in culture. In contrast to ascomata of other Ceratocystidaceae, the relatively small ascomata of A. cleistominuta are neckless and without ostioles. The ascospores are relatively large, and single-ascospore colonies produced ascomata and ascospores in culture, showing that A. cleistominuta is homothallic.

Download Full-text

First Report of Web Blight on Rosemary (Rosmarinus officinalis) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-11-12-1012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Ground Cover ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Rosmarinus Officinalis ◽

Economic Losses ◽

Pathogenicity Test ◽

First Report ◽

Wheat Kernels

Rosmarinus officinalis L., family Labiatae, is an evergreen shrub used in gardens as an aromatic or ground cover plant. In the summer of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 20% of 150,000 70-day-old plants, grown in trays. Water soaked lesions appeared on leaves and stems. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. A light mycelium spread on the substrate. Disease progressed from infected plants to healthy ones and, eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently and readily recovered. Three isolates of R. solani obtained from affected plants were successfully paired with R. solani tester strains AG 1, 2, 3, 4, 6, 7, or 11 and examined microscopically. Three pairings were made for each recovered isolate. The isolates of R. solani from rosemary anastomosed only with tester strain AG 1 (ATCC 58946). Results were consistent with other reports on anastomosis reactions (2). Tests were repeated once. Mycelium of 10-day-old isolates from rosemary appeared light brown, compact, and radiate. Numerous dark brown sclerotia, 0.7 to 2.0 mm diameter (average 1.3), developed within 10 days at 20 to 26°C. The descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced (GenBank Accession No. KC005724). BLASTn analysis (1) of the 657-bp showed a 99% similarity with the sequence of R. solani GU596491. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks for 8 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Fifteen 90-day-old rosemary plants were grown in 15-liter pots in a steam disinfested peat:pomice:pine bark:clay mix (50:20:20:10) infested with 3 g/liter of infested wheat kernels, placed at the base of the stem. Fifteen plants inoculated with non-infested wheat kernels served as control treatments. Plants were covered with plastic bags and arranged in a growth chamber at 20 to 24°C with 12 h light/dark for 15 days. The first symptoms, similar to those observed in the farm, developed 10 days after inoculation. About 10 colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on R. officinalis in United States (3), India, and Brazil. This is, to our knowledge, the first report of blight of R. officinalis caused by R. solani in Italy. This disease could cause serious economic losses, because rosemary is one of the most cultivated aromatic plants in the Mediterranean region. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, 1996. (3) G. E. Holcomb. Plant Dis. 76:859, 1992. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Circular Leaf Spot of Persimmon Caused by Mycosphaerella nawae in Spain

Plant Disease ◽

10.1094/pdis-94-3-0374b ◽

2010 ◽

Vol 94 (3) ◽

pp. 374-374 ◽

Cited By ~ 11

Author(s):

M. Berbegal ◽

A. Pérez-Sierra ◽

J. Armengol ◽

C. S. Park ◽

J. García-Jiménez

Keyword(s):

Leaf Spot ◽

Its Region ◽

Morphological Characters ◽

Diospyros Kaki ◽

Korean Isolate ◽

Individual Tree ◽

First Report ◽

Leaf Spots ◽

Fallen Leaves ◽

Dark Green

Production of persimmon (Diospyros kaki L. f.) has increased significantly during the last decade in Spain as a profitable alternative for fruit growers. In August 2008, after a mild and rainy spring, symptoms of a new disease were observed in commercial persimmon fields located in Valencia Province (eastern-central Spain). Symptoms included circular necrotic spots on the leaves and defoliation. Early fruit maturation and premature abscission were associated with early symptom development in the trees. A fungus was consistently isolated from the margins of leaf lesions. All isolates obtained were hyphal-tipped twice and transferred to potato dextrose agar (PDA). The cultures grew slowly and reached a diameter of 21 to 29 (mean 26) mm within 4 weeks on PDA at 25°C in the dark. Mycelium was initially dark green and ultimately became dark gray to black. Several media and incubation conditions were tested to induce sporulation, but conidia formation was not observed. In April 2009, mature spherical pseudothecia were observed in lesions on fallen leaves that had remained in affected fields during the winter. Ascospores were uniseptate and mostly spindle shaped, 10 to 11.5 (mean 10.3) μm long, and 3 to 3.9 (mean 3.4) μm wide. Fungal colonies obtained from the ascospores were identical to those isolated from the leaf lesions. Morphological characters observed matched those described for the pathogen Mycosphaerella nawae Hiura & Ikata (1). In Korea, the circular leaf spot of persimmon caused by M. nawae was considered an economically important disease in the 1990s, especially in the southern regions (2). Sequences of the internal transcribed spacer (ITS) region of the rDNA were obtained for isolates MY2 and MY3 and deposited in GenBank (Accession Nos. GQ465767 and GQ465768). These sequences were identical to each other and to the sequence obtained from a Korean isolate of M. nawae. Symptoms of the disease were reproduced after inoculation of 2-year-old persimmon trees growing in individual pots. A ground mycelial suspension (5 × 105 CFU ml–1) of strain MY2 was sprayed onto 20 potted trees (200 ml per individual tree) in late May of 2009. Ten trees were sprayed with sterile distilled water as a control. Trees were incubated at 20°C in a growth chamber with a 12-h photoperiod and covered with a semitransparent plastic hood for the first 10 days after inoculation, after which the plastic was punctured for ventilation and trees were incubated at 22°C. The first symptoms (small circular spots on the leaves) appeared on inoculated trees 15 days after inoculation. One month after inoculation, all inoculated trees showed circular leaf spots and severe defoliation, whereas noninoculated trees remained healthy. M. nawae was successfully reisolated from the lesions. To our knowledge, this is the first report of M. nawae causing circular leaf spot of persimmon in Spain. References: (1) J. H. Kwon et al. Plant Dis. Agric. 1:18, 1995. (2) J. H. Kwon et al. Korean J. Plant Pathol. 14:397, 1998.

Download Full-text

First Report of Gliocephalotrichum bulbilium Causing Fruit Rot of Posthavest Mangosteen in China

Plant Disease ◽

10.1094/pdis-09-13-0917-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 994-994 ◽

Cited By ~ 1

Author(s):

Y. X. Li ◽

W. X. Chen ◽

A. Y. Liu ◽

Q. L. Chen ◽

S. J. Feng

Keyword(s):

Its Region ◽

The United States ◽

Psidium Guajava ◽

Morphological Characters ◽

Fruit Rot ◽

Diseased Plant ◽

Garcinia Mangostana ◽

Single Spore ◽

Tropical Fruit ◽

First Report

Mangosteen (Garcinia mangostana L., Guttiferae) is a tropical fruit renowned for its pleasant taste, rich nutrition, and medicinal value. Little research about mangosteen diseases during storage and transport has been reported. In June of 2012, fruit rots on mangosteens imported from Thailand were observed in Guangzhou, China. In infected fruits, pericarps showed an increased firmness, were discolored to deep pink, and the edible aril became brown and rotten. In order to search for the etiological agent of this rot symptom, infected mangosteens were analyzed. Diseased mangosteen tissues were surface-sterilized with 70% alcohol, then with 0.1% HgCl2, dipped in sterilized water three times, and placed onto potato dextrose agar (PDA) at 26°C. The fungi isolated from tissues of the pericarp and aril were similar in morphology and grew rapidly, covering the plate surface (9 mm diameter) after 2 to 3 days of incubation at 26°C. The morphological characters of 10 single-spore isolates were observed. These isolates showed light yellow to light brown fertile colonies on PDA. On corn meal agar (CMA), conidiophores were erect, arising from wide hyphae; they were composed of a basal stipe ending in a penicillate conidiogenous apparatus with directly subtending sterile stipe extensions ranging from 74.5 to 195.0 μm long. Conidia were unicellular, smooth, oblong to elliptical, 6.3 to 8.5 × 2.5 to 3.0 μm, and accumulated in a mucilaginous mass. Chlamydospores were multicellular, dark brown, regular in shape and thick-walled, and 40.0 to 52.5 μm in diameter. On the basis of these morphological characters, these isolates were identified as Gliocephalotrichum bulbilium (2). To confirm the identity of this fungus, genomic DNA of two isolates was extracted, and fragments of ITS region and β-tubulin gene were amplified by PCR, sequenced, and compared with sequences of Gliocephalotrichum species available in NCBI GenBank. Both DNA regions (GenBank Accession Nos. KF716166 and KF716168) had sequence similarities of 99% and 97%, respectively, to other G. bulbilium sequences at GenBank. Pathogenicity tests were conducted on three detached fruits for two isolates. Fruits were inoculated using 5-mm mycelial disks with conidia taken from 3-day-old cultures of G. bulbilium isolate Gb1 and Gb10 grown on PDA. Controls were inoculated with PDA disks only. All treated fruits were kept individually in a humid chamber at 26°C. Tests were repeated twice. Three days after inoculation, white mycelial growth for Gb was observed at inoculation sites. Eight days after inoculation, mycelium of Gb nearly covered the fruit, causing fruit rot, and the pericarp became hard and light in color. The control fruit did not rot. G. bulbilium was re-isolated from diseased plant tissue, thus fulfilling Koch's postulates. G. bulbilium has been reported causing postharvest fruit rot of rambutan (Nephelium lappaceum) and guava (Psidium guajava) in some locations (3,4). Moreover, the fungus caused cranberry fruit rot in the United States (1). To our knowledge, this is the first report of G. bulbilium causing postharvest fruit rot of mangosteen in China. It is uncertain whether the fungus infected mangosteen in Thailand and was carried to China due to commercial relationship. References: (1) C. Constantelos et al. Plant Dis. 95:618, 2011. (2) C. Decock et al. Mycologia 98:488, 2006. (3) L. M. Serrato-Diaz et al. Plant Dis. 96:1225, 2012. (4) A. Sivapalan et al. Australas. Plant Pathol. 27:274, 1998.

Download Full-text

First Report of Stemphylium vesicarium as Causal Agent of Wilting and Root Rotting of Radish Sprouts in Italy

Plant Disease ◽

10.1094/pdis-92-4-0651c ◽

2008 ◽

Vol 92 (4) ◽

pp. 651-651 ◽

Cited By ~ 3

Author(s):

A. Belisario ◽

S. Vitale ◽

L. Luongo ◽

S. Nardi ◽

S. Talevi ◽

...

Keyword(s):

Its Region ◽

Mediterranean Area ◽

Morphological Characters ◽

Causal Agent ◽

Brown Spot ◽

Stemphylium Vesicarium ◽

First Report ◽

Radish Sprouts ◽

Pleospora Allii ◽

Artificial Inoculations

A consistent contamination from a Stemphylium sp. was detected on radish (Raphanus sativus) seeds by a seed blotter test. Twenty-five percent of seed lots were contaminated. Stemphylium vesicarium (teleomorph Pleospora allii) was identified on the basis of morphological characters of conidia and conidiophores (4). Conidia were golden brown to dark drown, oblong to oval with one to four transverse and one to three longitudinal septa, constricted at one to three of the major transverse septa. Conidia dimensions ranged from 12 to 22 × 30 to 40 μm. Conidiophores were straight or occasionally one-branched with a swollen apex and one to four septate. Pseudothecia with asci and ascopores were observed on radish seeds. Asci were cylindrical to clavate with eight ascospores with up to six transverse septa and numerous longitudinal septa. Species identification was also confirmed after comparing the sequences of the internal transcribed spacer (ITS) region of rDNA and gpd (glyceraldehyde-3-phosphate dehydrogenase) (3) of four isolates with those of Stemphylium species already present in the NCBI database. Accessions Nos. AM 746020 to AM746023 and AM883174 to AM883177 were deposited for ITS and gpd, respectively. Artificial inoculations were carried out on radish seeds previously disinfected with 1% sodium hypochlorite for 10 min and then plated on S. vesicarium sporulating colonies grown on potato dextrose agar (PDA). The four sequenced isolates were tested for pathogenicity. Disinfected seeds were plated onto PDA only and used as a control. After 48 h of incubation, seeds were sown in sterilized soil in plastic plates. The emerging and the eventually dead plants were counted. Stem necrosis and root rotting developed on sprouts within the first week after sowing. On the surviving infected plantlets, wilting and death occurred on more than 70% of the plants within 4 weeks after sowing. Control plantlets obtained from disinfected seeds remained healthy. The fungus reisolated from wilted and dead plants was morphologically identical to the original isolates, thus confirming S. vesicarium as the causal agent. In Italy, this pathogen is common on asparagus (1), but it has also been reported on Allium spp., tomato, and pear. On European pear it is the causal agent of brown spot (2), a destructive disease in the Mediterranean area but also in the Netherlands and other continental European countries. On the basis of these results, seed contamination with S. vesicarium can represent a threat for the production of radish for sprout consumption. To our knowledge, this is the first report of S. vesicarium on radish plantlets in Italy. References: (1) F. Del Zan et al. L'informatore Agrario 11:95, 1989. (2) I. Llorente and E. Montesinos. Plant Dis. 90:1368, 2006. (3) B. M. Pryor and D. M. Bigelow. Mycologia 95:1141, 2003. (4) E. G. Simmons. Sydowia 38:284, 1985.

Download Full-text