First Report of Garlic virus X in Garlic Plants in Brazil

Garlic is the fifth most economically important vegetable in Brazil and is frequently infected by a complex of different viruses that cause significant degeneration of the crop under field conditions. The species of the genus Allexivirus that infect garlic are: Garlic virus A (GarV-A), Garlic virus B (GarV-B), Garlic virus C (GarV-C), Garlic virus D (GarV-D), Garlic virus E (GarV-E), Garlic virus X (GarV-X), Garlic mite-borne filamentous viru s (GarMbFV), and Shallot virus X (ShVX). So far, only GarV-A, GarV-B, GarV-C, GarV-D, and GarMbFV have been reported in Brazil (3). During the 2010 through 2013 seasons, between April and October, 302 garlic plants with yellow mosaic strips and distorted leaves from the cultivars Caçador, Quitéria, Tropical Bergamota, and Tropical Shangai were collected in the states of Paraná, Minas Gerais, São Paulo, and Goiás and analyzed for the presence of allexiviruses. Total plant RNA was extracted with the Total RNA Purification kit (Norgen Biotek Corp., Canada) according to manufacturer's instructions. RT-PCR reactions were performed initially with the primer pair named Cpallexi-senso2 (5′ CTACCACAAYGGNTCVTC 3′) and Cpallexi-anti1 (5′ CACNGCGTTRAAGAARTC 3′) specifically designed to amplify a ~230-bp fragment from all currently known allexiviruses. Positive samples were then analyzed with specific primers for GarV-A, GarV-C, and GarV-D (2), GarMbFV (1) and GarV-B named CPBS2 (5′ GCAGAATAARCCCCCYTC 3′) and CPBA1 (5′ RAAGGGTTTATTCTGTTG 3′) obtained in this work. Among the plants analyzed, 50 were positive for the Cpallexi-senso2/Cpallexi-anti1 primers but negative for all the specific primers tested, indicating the presence of a different allexivirus. These samples were then analyzed by RT-PCR for the presence of GarV-X, GarV-E, and ShVX and an amplicon of ~550 bp was obtained only with primers CPXS2 (5′ GCCTTCTGAAAATGACTTAG 3′) and CPXA1 (5′ CTAGGATTTGCTGTTGGG 3′) designed in this work to amplify a fragment of the capsid protein gene for GarV-X. Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (2), another set of primers, namely PIXS1 (GACGACGGYGCACTACTC) / PIXA1 (YGTGAATCGTGATGATCC) and PFXS2 (CRCTGAGACAATTYYGTGG) / PFXA2 (CAAAGCATCGGCCRTAGCG) derived from conserved regions of ORF4, ORF5 (CP), and ORF 6 sequences of allexiviruses available in the NCBI database, were used in RT-PCR to obtain the complete CP gene nucleotide sequence. A 1,071-nt sequence comprising 108 bp of ORF4 (partial), 732 bp of the CP, and 177 bp of ORF 6 was successfully amplified (GenBank Accession No. KF530328). The complete CP gene showed 98% nucleotide sequence identity with GarV-X from Australia (JQ807994.1). In summary, GarV-X was detected in the 50 samples collected from Minas Gerais, São Paulo, and Paraná, indicating widespread distribution in Brazil. To our knowledge, this is the first report of GarV-X in garlic in Brazil. References: (1) M. S. Fayad-Andre et al. Trop. Plant Pathol. 36:341, 2011. (2) P. A. Melo Filho et al. Pesq. Agropec. Bras. 39:735, 2004. (3) R. J. Nascimento et al. Summa Phytopathol. 34:267, 2008.

Download Full-text

First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

Plant Disease ◽

10.1094/pdis-06-13-0668-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 698-698 ◽

Cited By ~ 1

Author(s):

Y. Tomitaka ◽

T. Usugi ◽

R. Kozuka ◽

S. Tsuda

Keyword(s):

Nucleotide Sequence ◽

Solanum Lycopersicum ◽

Mosaic Disease ◽

Causal Agent ◽

Cultivated Plants ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

Tomato Plants ◽

First Report

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato in Georgia

Plant Disease ◽

10.1094/pdis-02-11-0122 ◽

2011 ◽

Vol 95 (7) ◽

pp. 881-881 ◽

Cited By ~ 1

Author(s):

S. Sundaraj ◽

R. Srinivasan ◽

C. G. Webster ◽

S. Adkins ◽

K. Perry ◽

...

Keyword(s):

Nucleic Acid Hybridization ◽

N Gene ◽

Natural Occurrence ◽

Rt Pcr ◽

Specific Primers ◽

Tomato Production ◽

First Report ◽

Interveinal Chlorosis ◽

Cp Gene ◽

Tomato Chlorosis Virus

Tomato yellow leaf curl virus (TYLCV) and Tomato spotted wilt virus (TSWV) are prevalent in field-grown tomato (Solanum lycopersicum) production in Georgia. Typical TYLCV symptoms were observed during varietal trials in fall 2009 and 2010 to screen genotypes against TYLCV at the Coastal Plain Experiment Station, Tifton, GA. However, foliar symptoms atypical of TYLCV including interveinal chlorosis, purpling, brittleness, and mottling on upper and middle leaves and bronzing and intense interveinal chlorosis on lower leaves were also observed. Heavy whitefly (Bemisia tabaci (Gennadius), B biotype) infestation was also observed on all tomato genotypes. Preliminary tests (PCR and nucleic acid hybridization) in fall 2009 indicated the presence of TYLCV, TSWV, Cucumber mosaic virus, and Tomato chlorosis virus (ToCV); all with the exception of ToCV have been reported in Georgia. Sixteen additional symptomatic leaf samples were randomly collected in fall 2010 and the preliminary results from 2009 were used to guide testing. DNA and RNA were individually extracted using commercially available kits and used for PCR testing for ToCV, TYLCV, and TSWV. Reverse transcription (RT)-PCR with ToCV CP gene specific primers (4) produced approximately 750-bp amplicons from nine of the 16 leaf samples. Four of the nine CP gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 100.0% identical with each other (GenBank Accession Nos. HQ879840 to HQ879843). They were 99.3 to 99.5%, 97.2 to 97.5%, and 98.6 to 98.9% identical to ToCV CP sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. The presence of ToCV was confirmed by amplifying a portion of the HSP70h gene using the primers HSP-1F and HSP-1R (1). RT-PCR produced approximately 900-bp amplicons in the same nine samples. Four HSP70h gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 99.7% identical to each other (Accession Nos. HQ879844 to HQ879847). They were 99.2 to 99.5%, 98.0 to 98.4%, and 98.9 to 99.3% identical to HSP70h sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. TYLCV was also detected in all 16 samples by PCR using degenerate begomovirus primers PAL1v 1978 and PARIc 496 (3) followed by sequencing. TSWV was also detected in two of the ToCVinfected samples by RT-PCR with TSWV N gene specific primers (2) followed by sequencing. To our knowledge, this is the first report of the natural occurrence of ToCV in Georgia. Further studies are required to quantify the yield losses from ToCV alone and synergistic interactions between ToCV in combination with TSWV and/or TYLCV in tomato production in Georgia. References: (1) T. Hirota et al. J. Gen. Plant Pathol. 76:168, 2010. (2) R. K. Jain et al. Plant Dis. 82:900, 1998. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) L. Segev et al. Plant Dis. 88:1160, 2004.

Download Full-text

Ocorrência de animais persistentemente infectados pelo vírus da diarréia viral bovina em rebanhos bovinos nos Estados de Minas Gerais e São Paulo

Pesquisa Veterinária Brasileira ◽

10.1590/s0100-736x2010001100006 ◽

2010 ◽

Vol 30 (11) ◽

pp. 933-939 ◽

Cited By ~ 3

Author(s):

Fabio C Dias ◽

Kerlei C Médici ◽

Bruna Alexandrino ◽

Andréa S.R Medeiros ◽

Amauri A Alfieri ◽

...

Keyword(s):

Minas Gerais ◽

Sao Paulo ◽

São Paulo ◽

Rt Pcr

A pesquisa de animais persistentemente infectados (PI) pelo vírus da diarréia viral bovina (BVDV) foi realizada em 26 rebanhos bovinos, não vacinados contra o BVDV, localizados nos Estados de Minas Gerais e São Paulo, Brasil. Utilizando uma estratégia de amostragem, de cada rebanho foram obtidas cinco amostras de sangue de bezerros, entre 6 e 12 meses de idade, e os soros sanguíneos foram submetidos ao teste de virusneutralização (VN) para o BVDV-1 e o BVDV-2. Os rebanhos que apresentaram pelo menos três das cinco amostras reagentes a um dos genótipos do BVDV, e com títulos de anticorpos superiores a 128, foram selecionados para a pesquisa de animais PI. Em três rebanhos que apresentaram tal condição, foram colhidas amostras pareadas de sangue de todos os bovinos do rebanho, com intervalo de 30 dias entre as colheitas, e o soro sanguíneo foi submetido ao teste de VN para o BVDV-1 e o BVDV-2. Nas amostras não reagentes a pelo menos um dos genótipos do BVDV e naquelas provenientes de bovinos com menos de seis meses de idade, realizou-se a pesquisa do BVDV pela reação em cadeia da polimerase precedida pela transcrição reversa (RT-PCR). Dos rebanhos analisados, foram detectados dois animais PI a partir de amostras obtidas nas colheitas pareadas provenientes de um rebanho localizado no Estado de Minas Gerais.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato Crops in Brazil

Plant Disease ◽

10.1094/pdis-92-12-1709c ◽

2008 ◽

Vol 92 (12) ◽

pp. 1709-1709 ◽

Cited By ~ 25

Author(s):

J. C. Barbosa ◽

A. P. M. Teixeira ◽

A. G. Moreira ◽

L. E. A. Camargo ◽

A. Bergamin Filho ◽

...

Keyword(s):

Consensus Sequence ◽

The United States ◽

Sao Paulo ◽

São Paulo ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Thin Sections ◽

First Report ◽

Tomato Chlorosis Virus ◽

Biotype B

During 2006 and 2007 in the region of Sumaré, state of São Paulo, Brazil, surveys were done on tomato (Solanum lycopersicum L.) virus diseases in three open field-grown crops. The data revealed low incidence (0.25 to 3.42%) of randomly distributed plants exhibiting interveinal chlorosis and some necrosis on the basal leaves. Symptoms were only observed on old fruit-bearing plants. Preliminary analysis of thin sections of symptomatic leaves from one plant by transmission electron microscopy revealed the presence of aggregates of thin, flexible, and elongated particles in some phloem vessels, suggesting infection with a member of the genus Crinivirus, family Closteroviridae. Total RNA was extracted separately from leaves of 10 symptomatic plants and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from 7 of the 10 plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Two amplicons of 463 bp were purified and directly sequenced in both directions. Sequence comparisons of the 463-bp consensus sequence (GenBank Accession No. EU868927) revealed 99% identity with the reported sequence of ToCV from the United States (GenBank Accession No. AY903448) (3). Virus-free adults of Bemisia tabaci biotype B confined on symptomatic tomato leaves for a 24-h acquisition access period were able to transmit the virus to healthy tomato plants, which reproduced the original symptoms on the bottom leaves 65 days after inoculation under greenhouse conditions. Infection from transmission was confirmed by RT-PCR using the HS-11/HS-12 primer pair. In addition to B. tabaci biotype B, the greenhouse whitefly, Trialeurodes vaporariorum, has also been reported as a vector of ToCV, although it is less efficient than the B. tabaci biotype B in transmission of this virus (4). T. vaporariorum, which was previously considered limited to greenhouses, was recently reported in tomato and green bean (Phaseolus vulgaris L.) crops under field conditions in São Paulo State (2). Therefore, it might also contribute to the spread of ToCV in tomato crops in São Paulo. To our knowledge, this is the first report of ToCV in Brazil and South America. References: (1) C. I. Dovas et al. Plant Dis.86:1345, 2002. (2) A. L. Lourenção et al. Neotrop. Entomol. 37:89, 2008. (3) W. M. Wintermantel et al. Arch. Virol. 15:2287, 2005. (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

Download Full-text

First report of cucurbit chlorotic yellows virus (CCYV) infecting pumpkin in India

Plant Disease ◽

10.1094/pdis-07-21-1473-pdn ◽

2021 ◽

Author(s):

Ashwini Kumar ◽

Bichhinna Maitri Rout ◽

Shakshi Choudhary ◽

Amish K. Sureja ◽

V. K. Baranwal ◽

...

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Amino Acid Sequence Identity ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Virus Particles ◽

Sequence Identity ◽

Cp Gene ◽

Cucurbit Chlorotic Yellows Virus

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3’ NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5’-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3’) and CP-R (5’-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3’) (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.

Download Full-text

First Report of a 16SrII-C Phytoplasma Associated with Asymptomatic Acid Lime (Citrus aurantifolia) in Brazil

Plant Disease ◽

10.1094/pdis-04-14-0431-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1577-1577 ◽

Cited By ~ 8

Author(s):

F. N. Silva ◽

R. B. Queiroz ◽

A. N. Souza ◽

A. M. Al-Sadi ◽

D. L. Siqueira ◽

...

Keyword(s):

16S Rdna ◽

In Silico ◽

Minas Gerais ◽

Sao Paulo ◽

Bacterial Disease ◽

São Paulo ◽

Santa Catarina ◽

Citrus Aurantifolia ◽

First Report ◽

Acid Lime

At present, the principal bacterial disease of citrus in Brazil is Huanglongbing, caused by the alpha-proteobacterium ‘Candidatus Liberibacter spp.’ (although a phytoplasma of the 16SrIX group is also associated with this disease [4]). While there is a wide diversity of phytoplasmas in crop species in Brazil (3), there have been no reports of symptoms associated with phytoplasma in Brazilian citrus. Asymptomatic infections of citrus cannot be excluded as a possibility and such plants could serve as a reservoir of phytoplasma inoculum. The aim of this study was to assess the presence of phytoplasma in asymptomatic Citrus aurantifolia (acid lime) in Brazil. Thirty-three leaf samples (young leaves from the upper canopies) were randomly collected from different plants in the states of Minas Gerais (n = 23), Santa Catarina (n = 2), and São Paulo (n = 8). Two additional samples of C. limonia (‘Rangpur’ lime) and one of C. latifolia (‘Persian’ or ‘Tahiti’ lime) were collected in Minas Gerais. Total DNA extraction was performed using NucleoSpin Plant II Kit (Macherey-Nagel) according to the manufacturer's recommendations. PCR was carried out with a universal P1/P7 primer set followed by nested primers R16F2n/R16R2 (2). Additionally, direct PCR was performed using primers specific for phytoplasma immune-dominant membrane protein IMP3F/IMP3R (1). ‘Rangpur’ and ‘Tahiti’ lime were not infected with phytoplasma. Of the C. aurantifolia samples, 52% were positive for phytoplasma in the direct and nested PCR assays. The numbers of positive samples in Minas Gerais, Santa Catarina, and São Paulo states were 12, 1, and 4, respectively. Of these, five were selected for DNA purification and 1,246-bp fragments were ligated to the pGEM T-easy vector (Promega) and partial 16Sr DNA was sequenced. Nucleotide sequences of Brazilian phytoplasma strains BR:MG:FNS10:2011, BR:MG:FNS53:2011, BR:SP:FNS73:2011, BR:SC:FNS86:2011, and BR:MG:FNS126:2012 (GenBank Accession Nos. KJ158173, KJ158174, KJ158175, KJ158176, and KJ158177, respectively) were subjected to RFLP analyses. The 16S rDNA RFLP in silico patterns for the five strains were identical to each other and to Cactus witches'-broom phytoplasma (16SrII-C subgroup, AJ293216). In addition, the highest similarity coefficient (5) and nucleotide sequence identity of Brazilian phytoplasma strains were 0.99 and 99%, respectively, with Cactus witches'-broom phytoplasma. PCR-RFLP analyses using the enzymes Bstu I, EcoR I, and Hpa II were consistent with RFLP in silico results, showing the same pattern as the 16SrII-C subgroup. Phylogenetic analyses based on 16S rDNA sequences (1,246 bp) demonstrated that all the Brazilian strains grouped in the same clade with other representative sequences from the 16S rDNAII group. To confirm the absence of any macroscopic symptoms, morphological characteristics of 10 uninfected and 10 phytoplasma-infected plants randomly selected from a single field in Minas Gerais were analyzed. There were no significant differences in leaf area, stalk diameter, or numbers of leaves, flowers, or fruits per branch. To our knowledge, this is the first report of the 16SrII-C subgroup phytoplasma associated with C. aurantifolia in Brazil, and the first report of asymptomatic citrus plants infected with phytoplasma. References: (1) N. Askari et al. J. Microbiol. Biotechnol. 21:81, 2011. (2) I. M. Lee et al. Phytopathology 84:559, 1994. (3) H. G. Montano et al. Bull. Insectol. 60:129, 2007. (4) D. C. Teixeira et al. Phytopathology 98:977, 2008. (5) Y. Zhao et al. Meth. Mol. Biol. 938:329, 2013.

Download Full-text

First Report of Maize chlorotic mottle virus on Sweet Corn in Taiwan

Plant Disease ◽

10.1094/pdis-06-14-0568-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1748-1748 ◽

Cited By ~ 23

Author(s):

T.-C. Deng ◽

C.-M. Chou ◽

C.-T. Chen ◽

C.-H. Tsai ◽

F.-C. Lin

Keyword(s):

Nucleotide Sequence ◽

Mosaic Virus ◽

Sweet Corn ◽

Mottle Virus ◽

Rt Pcr ◽

First Report ◽

Cp Gene ◽

Chlorotic Mottle Virus ◽

Maize Chlorotic Mottle Virus ◽

Chlorotic Mottle

In February 2014, a severe disease on maize (Zea mays L.) broke out in the fields of central and southwestern Taiwan and caused yield losses in sweet corn production. Chlorotic spots first appeared at the base of infected leaves and later developed into systemic mottling. Diffused necrotic patches were also found on leaves or husks of the diseased plants. Moreover, severe rosetting and stunting accompanied by abnormalities in ear production were observed on mature plants. Eighteen leaf samples from symptomatic plants were collected and submitted to our Plant Diagnostic Clinic for virus diagnosis. All of the samples were first tested by reverse transcriptase (RT)-PCR to detect Maize stripe virus (MSpV) and by indirect ELISA to detect Maize dwarf mosaic virus (MDMV) or Sugarcane mosaic virus (SCMV), which were endemic to this area (1). Only 2 out of 18 samples were positive for MDMV, SCMV, or mixed infection of both viruses. Sap inoculation tests conducted on seedlings of sweet corn cv. Honey 236 indicated that the MDMV- and SCMV-negative samples still had an unknown pathogen causing original symptoms in the receptor plants. The isolate from Yunlin county reacted only with the antibody to Maize chlorotic mottle virus (MCMV) (AC Diagnostics, Fayetteville, AR) in ELISA. For further identification, the MCMV-specific primers (forward: MCMVg3514F-GGGAACAACCTGCTCCA; reverse MCMVg4014R-GGACACGGAGTACGAGA) were designed from the nucleotide sequence of MCMV coat protein (CP) gene. In RT-PCR using the AccuPower RT/PCR PreMix kit (Bioneer, Daejeon, Korea), an expected 500-bp DNA fragment was observed. This PCR product was cloned and its nucleotide sequence was determined by Mission Biotech Co., Taipei, Taiwan. BLAST analysis of the CP gene of the MCMV-Yunlin revealed the maximum nucleotide identities (99%) with Chinese Sichuan isolates (GenBank Accession No. JQ984270) and 98% identities to four Chinese Yunnan isolates (GU138674, JQ982468, JQ982469, and KF010583) and one Kenya isolate (JX286709), compared with 97% to Kansas isolate (X14736) and 96% to Nebraska isolate (EU358605). Subsequently, the complete nucleotide sequence of the viral genome (KJ782300) was determined from five overlapping DNA fragments obtained from independent RT-PCR amplification. The virus isolate was infectious to sweet corn cultivars Bai-long-wang, Devotion, SC-34, SC2015, and Zheng-zi-mi, on which similar symptoms were developed after mechanical inoculation. During the spring of 2014, a total of 224 sweet corn samples were collected from the epidemic areas of Taichung, Yunlin, Chiayi, and Kaohsiung counties. Samples (n= 161) reacted positive for MCMV in ELISA and/or RT-PCR. In the field survey, more than 20 adult thrips might be observed on an MCMV-infected plant. Two species of Frankliniella were found on maize plants: F. williamsi Hood and F. intonsa Trybom. Maize thrips (F. williamsi), an occasional pest of maize occurring during winter and spring in Taiwan, was characterized by its abdominal sternite II on which 1 or 2 discal setae of equal length with posteromarginal setae were borne (2). Samples with 1, 5, 10, and 30 F. williamsi collected in the field were tested by RT-PCR; MCMV was detectable not only in the pooled crushed bodies but also in a single maize thrips. This is the first report of MCMV occurrence on maize in Taiwan and of the virus transmitted by maize thrips. References: (1) C. T. Chen et al. Taiwan Sugar 37(4):9, 1990. (2) C.-L. Wang et al. Zool. Stud. 49:824, 2010.

Download Full-text

First Report of Garlic virus X Infecting Garlic in India

Plant Disease ◽

10.1094/pdis-03-11-0198 ◽

2011 ◽

Vol 95 (9) ◽

pp. 1197-1197 ◽

Cited By ~ 7

Author(s):

V. K. Baranwal ◽

P. Singh ◽

R. K. Jain ◽

S. Joshi

Keyword(s):

Nucleotide Sequence ◽

Coat Protein ◽

Agricultural Research ◽

Indian Agricultural Research Institute ◽

Latent Virus ◽

Onion Yellow Dwarf Virus ◽

Rt Pcr ◽

First Report ◽

Blast Analysis ◽

Garlic Virus

Garlic (Allium sativum) is an important crop in several states of India. Filamentous viruses such as Onion yellow dwarf virus (OYDV), Shallot latent virus (SLV), and Garlic common latent virus (GarCLV) have been reported previously in different garlic cultivars from India (4). These viruses are transmitted from generation to generation through cloves and cause severe reduction in yield and quality. During December 2010, garlic plants were observed with mosaic leaf symptoms and stunting in an experimental field at the Indian Agricultural Research Institute, Delhi. Cloves and leaves from 3-month-old symptomatic plants of five different cultivars (G-282, IC-375416, Ruag, Yamuna Safed, and ACC-40), originally from different regions of India, were collected from the field in Delhi and total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen, Valencia, CA). The presence of OYDV and GarCLV was confirmed by reverse transcription (RT)-PCR in all cultivars, while the presence of SLV was only confirmed in cv. G-282 by RT-PCR. Since Allexiviruses are common in garlic, their detection in cloves was confirmed by RT-PCR using primers ALLEX 1 and ALLEX 2 (2). An ~200-bp amplification product was observed in all five cultivars. To further characterize the Allexivirus in these cultivars, an amplicon of ~900 bp was amplified with Allex-CP (1) and ALLEX 2 (2) primers and cloned and sequenced. BLAST analysis of the nucleotide sequences from five garlic cultivars showed identity with different allexiviruses, Garlic virus A (GarV-A) (74 to 83%), Garlic virus E (GarV-E) (74 to 80%), Garlic virus D (GarV-D) (76 to 79%), and Garlic virus X (GarV-X) (75 to 78%). Since species demarcation in the genus Allexivirus is based on the coat protein (CP) gene (3), another set of primers, 5′-MYT KGA GTG GCT VAC ACA YAT-3′ and 5′-ATT RAA GTC GTG RGG ATG CAT-3′ was designed. These primers were derived from conserved regions of ORF4 and ORF5 (CP) sequences of allexiviruses available in the NCBI database and used in RT-PCR to obtain the complete CP. An ~1.5-kb amplicon was obtained only in cv. G-282 that originated from the southern part of India. A similar amplicon was obtained from Chenopodium amaranticolor mechanically inoculated with leaf sap from cv. G-282. Sequences (1,422 bp) obtained from three clones each from garlic cv. G-282 and C. amaranticolor were identical and BLAST analysis of the consensus nucleotide sequence showed maximum identity of 75 to 81% with isolates of GarV-X. The 1,422 nucleotide sequence was comprised of 690 bp of ORF4 (partial) and 732 bp of the CP. The coat protein sequence (GenBank Accession No. HQ822272) shared a 79.6 to 81.1% identity in nucleotide and 89.3 to 90.9% in amino acid sequence with different isolates of GarV-X (GenBank Accession Nos. AJ292229, U89243, and GQ475426). To our knowledge, this is the first report of GarV-X in a garlic cultivar from India. The characterization and identification of allexiviruses is important for production of virus-free garlic plants through tissue culture in India. References: (1) J. Chen et al. Arch. Virol. 149:435, 2004. (2) C. I. Dovas et al. J. Phytopathol.149:731, 2001. (3) C. M. Fauquet et al. Virus Taxonomy-VIIIth Report of the ICTV, Academic Press, London, 2005. (4) S. Majumder and V. K. Baranwal. Plant Dis. 93:106, 2009.

Download Full-text

First Report of Garlic virus B and Garlic virus D in Garlic in the Pacific Northwest

Plant Disease ◽

10.1094/pdis-93-4-0431a ◽

2009 ◽

Vol 93 (4) ◽

pp. 431-431 ◽

Cited By ~ 6

Author(s):

S. L. Gieck ◽

P. B. Hamm ◽

N. L. David ◽

H. R. Pappu

Keyword(s):

Pacific Northwest ◽

Seed Production ◽

The Other ◽

Rt Pcr ◽

Specific Primers ◽

Sequence Comparisons ◽

First Report ◽

The Pacific ◽

The Impact ◽

Garlic Virus

With the recent report of several viruses infecting garlic (Allium sativum L.) grown in the Pacific Northwest (1–3), studies were initiated on cloves planted in the fall of 2006 to determine the presence of additional viruses infecting plants exhibiting mosaic and/or chlorotic leaves. Cloves from symptomatic plants of the cultivar ‘Early’ from two seed production fields in Benton County, WA and two seed production fields in Morrow County, OR were tested by two-step reverse transcription (RT)-PCR using primers specific to the coat protein (CP) of the allexiviruses (4), since garlic infected with this group had similar symptoms in Asia and South America (4). Of the 87 cloves tested, 84 were positive, and four representative samples of the RT-PCR amplicons from each location were cloned and sequenced. Sequence comparisons indicated that the cloves from both locations were infected with Garlic virus D (GarV-D), also known as Japanese garlic virus (JGV), since they shared 98% identity with known isolates (GenBank Accession Nos. L388922.1, AF519572.1, and AB010303.1). In addition, sequences of isolates from the Oregon cloves shared a 96% identity with a known isolate of Garlic virus B (GarV-B; GenBank Accession No. AF543829.1). Because no antiserum specific to these viruses was available, primers specific to the CP genes of GarV-D (JGV-F2/JGV-R2 5′-GCTCACTCRGATGTGTTAGC-3′ and 5′-CGCGTGGACATAAGTTGTTG-3′) and GarV-B (GVB-F1/GVB-R2 5′-GAGGAGAACTAACGCCACAC-3′ and 5′-ACGACCTAGCTTCCTACTTG-3′) were designed and the cloves were retested by RT-PCR using these virus-specific primers. With the GarV-D specific primers, 98 and 63% of the cloves were positive from Washington and Oregon, respectively, and 52% of the cloves from Oregon were positive using the GarV-B specific primers. None of the cloves tested from Washington were positive for GarV-B. The identity of the amplicons was verified by cloning and sequencing (GarV-D, GenBank Accession No. FJ643476; GarV-B, GenBank Accession No. FJ643475). Incidence of the two viruses differed between Oregon and Washington was likely due to the expansion of the seed lots in two different locations (California and Nevada) prior to planting in 2006. With such high infection rates, studies should be conducted to determine the impact of these viruses on yield when plants are singly infected as well as in combination with the other viruses known to infect garlic in this region. These and the other viruses (1) are likely to impact yield. To our knowledge, this is the first report of GarV-D (JGV) and GarV-B in garlic in the Pacific Northwest. References: (1) S. L. Gieck et al. Plant Dis. 91:461, 2007. (2) H. R. Pappu et al. Plant Dis. 89:205, 2005 (3) H. R. Pappu et al. Online publication. doi:10.1094/PHP-2008-0919-01-RS. Plant Health Progress, 2008. (4) T. Tsuneyoshi et al. Phytopathology 86:253, 1996.

Download Full-text

Diferenciação de estirpes de Potato virus Y (PVY) por RT-PCR

Horticultura Brasileira ◽

10.1590/s0102-05362005000400008 ◽

2005 ◽

Vol 23 (4) ◽

pp. 904-910 ◽

Cited By ~ 1

Author(s):

Leonardo N. Fonseca ◽

Alice K. Inoue-Nagata ◽

Tatsuya Nagata ◽

Rudra P. Singh ◽

Antonio Carlos de Ávila

Keyword(s):

Nicotiana Tabacum ◽

Potato Virus ◽

Potato Virus Y ◽

Rio Grande ◽

Minas Gerais ◽

Sao Paulo ◽

São Paulo ◽

Rio Grande Do Sul ◽

Rt Pcr ◽

Santa Catarina

O Potato virus Y (PVY) tornou-se o maior problema nas áreas de produção de batata semente do Brasil. Somente as estirpes comum (PVYº) e necrótica (PVY N) eram detectadas infectando batata no Brasil. Esta situação mudou drasticamente a partir de 1997 quando um surto epidêmico de uma variante da estirpe necrótica de PVY causando arcos e anéis necróticos na superfície do tubérculo (PVY NTN) foi observado no país. Este estudo visou avaliar e validar uma metodologia de diferenciação de estirpes que causam necrose em tubérculos, proposta por Weilguny e Singh (1998). Vinte e oito isolados de PVY originários de tubérculos infectados de batata, provenientes de quatro estados brasileiros, foram analisados em sua reação em plantas de fumo, por Elisa, utilizando anti-soro policlonal e pelo método 3-primer RT-PCR. Quatro isolados induziram clareamento de nervuras e manchas peroladas em folhas de Nicotiana tabacum conforme esperado para a estirpe comum. Os 24 isolados restantes induziram necrose de nervuras neste hospedeiro portanto, classificados como da estirpe necrótica. Todos os 28 isolados de PVY reagiram positivamente contra o anti-soro policlonal de PVY por Elisa. Três métodos de extração de RNA foram testados, sendo que o método de hidrocloreto de guanidina mostrou-se o mais eficiente e de menor custo. Dos 28 isolados submetidos ao RT-PCR, um isolado de Santa Catarina e três do Rio Grande do Sul foram diferenciados como PVYº, confirmando os resultados do teste biológico. Um isolado de PVY N foi detectado no Estado de Santa Catarina e quatro no Rio Grande do Sul. O PVY NTN foi detectado em Minas Gerais (seis isolados), Santa Catarina (três isolados) e São Paulo (dez isolados). Estes resultados confirmam a presença dessa variante necrótica, PVY NTN, nas principais regiões produtoras de batata do Brasil.

Download Full-text