First Report of Tomato chlorosis virus Infecting Tomato Crops in Brazil

During 2006 and 2007 in the region of Sumaré, state of São Paulo, Brazil, surveys were done on tomato (Solanum lycopersicum L.) virus diseases in three open field-grown crops. The data revealed low incidence (0.25 to 3.42%) of randomly distributed plants exhibiting interveinal chlorosis and some necrosis on the basal leaves. Symptoms were only observed on old fruit-bearing plants. Preliminary analysis of thin sections of symptomatic leaves from one plant by transmission electron microscopy revealed the presence of aggregates of thin, flexible, and elongated particles in some phloem vessels, suggesting infection with a member of the genus Crinivirus, family Closteroviridae. Total RNA was extracted separately from leaves of 10 symptomatic plants and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from 7 of the 10 plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Two amplicons of 463 bp were purified and directly sequenced in both directions. Sequence comparisons of the 463-bp consensus sequence (GenBank Accession No. EU868927) revealed 99% identity with the reported sequence of ToCV from the United States (GenBank Accession No. AY903448) (3). Virus-free adults of Bemisia tabaci biotype B confined on symptomatic tomato leaves for a 24-h acquisition access period were able to transmit the virus to healthy tomato plants, which reproduced the original symptoms on the bottom leaves 65 days after inoculation under greenhouse conditions. Infection from transmission was confirmed by RT-PCR using the HS-11/HS-12 primer pair. In addition to B. tabaci biotype B, the greenhouse whitefly, Trialeurodes vaporariorum, has also been reported as a vector of ToCV, although it is less efficient than the B. tabaci biotype B in transmission of this virus (4). T. vaporariorum, which was previously considered limited to greenhouses, was recently reported in tomato and green bean (Phaseolus vulgaris L.) crops under field conditions in São Paulo State (2). Therefore, it might also contribute to the spread of ToCV in tomato crops in São Paulo. To our knowledge, this is the first report of ToCV in Brazil and South America. References: (1) C. I. Dovas et al. Plant Dis.86:1345, 2002. (2) A. L. Lourenção et al. Neotrop. Entomol. 37:89, 2008. (3) W. M. Wintermantel et al. Arch. Virol. 15:2287, 2005. (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

Download Full-text

First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽

10.1094/pdis-93-9-0970a ◽

2009 ◽

Vol 93 (9) ◽

pp. 970-970 ◽

Cited By ~ 4

Author(s):

R. M. Castro ◽

E. Hernandez ◽

F. Mora ◽

P. Ramirez ◽

R. W. Hammond

Keyword(s):

Costa Rica ◽

Sequence Analysis ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Download Full-text

First Report of the Occurrence of Grapevine fanleaf virus in Washington State Vineyards

Plant Disease ◽

10.1094/pdis-92-8-1250a ◽

2008 ◽

Vol 92 (8) ◽

pp. 1250-1250 ◽

Cited By ~ 3

Author(s):

T. Mekuria ◽

R. R. Martin ◽

R. A. Naidu

Keyword(s):

Pacific Northwest ◽

Mixed Infection ◽

Consensus Sequence ◽

Amino Acid Level ◽

Pairwise Comparison ◽

The United States ◽

Washington State ◽

Rt Pcr ◽

Grapevine Fanleaf Virus ◽

First Report

Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5′-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231–2250) and reverse primer (5′-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533–2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.

Download Full-text

First Report of Tomato chlorosis virus in Potato in Brazil

Plant Disease ◽

10.1094/pdis-12-11-1068-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 593-593 ◽

Cited By ~ 18

Author(s):

D. M. S. Freitas ◽

I. Nardin ◽

N. Shimoyama ◽

J. A. C. Souza-Dias ◽

J. A. M. Rezende

Keyword(s):

Leaf Roll ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Interveinal Chlorosis ◽

Potato Plants ◽

The World ◽

Tomato Chlorosis Virus ◽

Biotype B

Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system. References: (1) J. C. Barbosa et al. Plant Dis. 92:1709, 2008. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) F. R. Fernandes et al. Trop. Plant Pathol. 35:43, 2010. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

Download Full-text

First Report on the Susceptibility of Sweet Pepper Crops to Tomato chlorosis virus in Brazil

Plant Disease ◽

10.1094/pdis-94-3-0374c ◽

2010 ◽

Vol 94 (3) ◽

pp. 374-374 ◽

Cited By ~ 16

Author(s):

J. C. Barbosa ◽

L. D. D. Teixeira ◽

J. A. M. Rezende

Keyword(s):

United States ◽

Consensus Sequence ◽

The United States ◽

Sweet Pepper ◽

Pepper Plant ◽

Rt Pcr ◽

Hsp 70 ◽

Universal Primer ◽

Access Period ◽

Tomato Chlorosis Virus

In June of 2009, sweet pepper (Capsicum annuum cvs. Elisa and Prador) plants exhibiting interveinal chlorosis, some necrosis, and mild upward leaf curling on the intermediate leaves were found in three protected crops in the municipality of São Miguel Arcanjo, São Paulo state, Brazil. Incidence of symptomatic plants varied from 70 to 100%. Abundant whitefly adults were seen in all crops. Initially, total DNA was separately extracted from seven symptomatic plants and submitted to a PCR reaction using the universal primer pairs PAL1v1978/PAR1c496 and PBL1v2040/PCRc1 for begomovirus (3). The results were negative. The same samples were also analyzed for infection with Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae). Total RNA was extracted separately from leaves of each symptomatic plant and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for TICV and ToCV (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from the five plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Four purified amplicons of 463 bp were directly sequenced in both directions. Sequence comparisons of the 419-bp consensus sequence, encompassing nucleotides 750 and 1,167 of the HSP-70 homolog gene, revealed 98% identity with the reported sequences of tomato infecting isolates of ToCV from Brazil (GenBank Accession No. EU868927) and the United States (GenBank Accession No. AY903448). Virus-free adults of Bemisia tabaci biotype B were confined on symptomatic pepper leaves for a 48-h acquisition access period. Twenty adults were transferred to one plant of sweet pepper cv. Magda for a 24-h inoculation access period. The sweet pepper plant exhibited the original symptoms on the leaves 67 days after inoculation under greenhouse conditions. Infection by ToCV was confirmed by RT-PCR. The susceptibility of sweet pepper plants to ToCV was previously reported in Spain (2), whereas in the United States, this species was experimentally found as nonhost for this virus (4). Further studies are needed to better understand the variable susceptibility of sweet pepper to ToCV. References: (1) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (2) G. Lozano et al. Plant Dis. 88:224, 2004. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. M. Wintermantel et al. Plant Dis. 90:814, 2006.

Download Full-text

First Report of Potato mop top virus Causing Potato Tuber Necrosis in Colorado and New Mexico

Plant Disease ◽

10.1094/pdis-08-14-0819-pdn ◽

2015 ◽

Vol 99 (1) ◽

pp. 164-164 ◽

Cited By ~ 6

Author(s):

I. Mallik ◽

N. C. Gudmestad

Keyword(s):

New Mexico ◽

North Dakota ◽

Consensus Sequence ◽

The United States ◽

Economic Losses ◽

Acid Extraction ◽

Rt Pcr ◽

First Report ◽

Tuber Necrosis ◽

Potato Mop Top Virus

Potato mop top virus (PMTV) is considered the type member of the genus Pomovirus. PMTV is an important pathogen of potato vectored by the plasmodiophorid Spongospora subterranea f. sp. subterranea (Sss), which causes powdery scab of potato (1). Sss and PMTV are usually associated with cool and humid environments. PMTV-infected potato tubers generally exhibit internal hollow necrotic spots or concentric rings, and the virus is known to cause significant economic losses in Northern Europe, North and South America, and Asia (4). PMTV in the United States was first reported in Maine (2). Potato (Solanum tuberosum L.) tubers cv. FL2048 and cv. Atlantic were sent to our laboratory from fields in Saguache County in Colorado and in San Juan County in New Mexico, respectively, during the spring of 2013. The tubers from both locations had multiple, internal, concentric, necrotic arcs and circles. Internal tissue with necrotic lesion from six symptomatic tubers from each location were crushed in liquid nitrogen followed by ribonucleic acid extraction using a Total RNA Isolation kit (Promega Corp., Madison, WI). These extracts were tested by reverse transcription (RT)-PCR using three different sets of previously published primers for molecular detection of PMTV. The primer set H360/C819 targeting the coat protein (CP) on RNA 3 of PMTV yielded an amplicon (H360-CO and H360-NM) of 460 bp (4). The second set of primers, pmtF4/pmtR4 (5), amplified a 417-bp product (PMTF-CO and PMTF-NM) in RNA 2, and the third set, PMTV-P9/PMTV-M9 (3), designed to amplify the region encoding an 8-KD cysteine-rich protein in RNA 3 of PMTV, yielded a 507-bp amplicon (PMTV9-CO and PMTV9-NM). The amplicons generated from RT-PCR using all three sets were cloned (PGEMT-easy) and sequenced. Since the sequences from symptomatic tuber extracts from each location were identical to their respective primer sets, a consensus sequence from each primer set was submitted to National Center for Biotechnology Information (NCBI) GenBank. Sequences obtained from the H360/C819 primer set (GenBank Accession Nos. KM207013 and KM207014 for H360-CO and H360-NM, respectively) were 100% identical to the corresponding CP regions of PMTV isolates from North Dakota (HM776172). Sequences from the pmtF4/pmtR4 primer set (KM207015 and KM207016 for PMTF-CO and PMTF-NM, respectively) were 100% identical to the corresponding protein in RNA2 of PMTV isolates from North Dakota (GenBank HM776171), and sequences from the PMTV-P9/PMTV-M9 primer set (KM207017 and KM207018 for PMTV9-CO and PMTV9-NM respectively) were 99% identical to the corresponding protein in RNA3 of PMTV isolates (AY187010). The 100-99% homology of the sequences from this study to the corresponding PMTV sequences published in NCBI confirmed the occurrence of symptoms in the tubers from both Colorado and New Mexico due to PMTV. None of the symptomatic tubers tested positive for Tobacco rattle virus, Tomato spotted wilt virus, Alfalfa mosaic virus, Potato leafroll virus, or the necrotic strains of Potato virus Y by RT-PCR. To our knowledge, this is the first report of PMTV in potato in states of Colorado and New Mexico. References: (1) R. A. C. Jones and B. D. Harrsion. Ann. Appl. Biol. 63:1, 1969. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) T. Nakayama et al. Am. J. Pot. Res. 87:218, 2010. (4) J. Santala et al. Ann. Appl. Biol. Online publication. DOI: 10.1111/j.1744-7348.2010.00423.x (5) H. Xu et al. Plant Dis. 88:363, 2004.

Download Full-text

First Report of Tomato infectious chlorosis virus in Tomato in Indonesia

Plant Disease ◽

10.1094/pdis.2003.87.7.872b ◽

2003 ◽

Vol 87 (7) ◽

pp. 872-872 ◽

Cited By ~ 8

Author(s):

J. Th. J. Verhoeven ◽

T. M. Willemen ◽

J. W. Roenhorst ◽

R. A. A. van der Vlugt

Keyword(s):

The United States ◽

Rt Pcr ◽

First Report ◽

Tomato Seedlings ◽

Large Numbers ◽

Lateral Shoots ◽

Young Leaves ◽

Polymerase Chain ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

In 2002, a breeding company submitted several samples of tomato (Lycopersicon esculentum) for diagnosis. Samples originated in Indonesia and were taken from protected and nonprotected crops. Plants exhibited severe chlorosis on fully expanded leaves, while young leaves were symptomless. Symptoms resembled those of the criniviruses Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV). Moreover, large numbers of whiteflies, potential vectors of these viruses, had been observed at the plots with symptomatic plants. A reverse transcription-polymerase chain reaction (RT-PCR) with specific primers for TICV (1) yielded amplicons of the expected size of approximately 500 bp for all samples. One of the amplicons was sequenced (Genbank Accession No. AY221097) and revealed more than 98.9% identity to six isolates of TICV in NCBI Genbank. cDNA synthesis using the universal crinivirus primer HSP_M2-DW (5′ -TCRAARGTWCCKCCNCCRAA-3′) followed by PCR with a ToCV specific primerset (ToCV-UP 5′-TCATTAAAACTCAATGGGACCGAG-3′ and ToCV-DW 5′-GCGACGT AAATTGAAACCC-3′) was negative in all cases. Grafting of symptomatic shoots onto healthy tomato seedlings of cv. Money-maker showed transmission of the virus, as chlorosis appeared on fully expanded leaves of lateral shoots after 6 weeks. The presence of TICV in the graft-inoculated plants was confirmed by RT-PCR. Furthermore, mechanical inoculation to a range of herbaceous test plants did not evoke any virus symptoms, indicating the absence of mechanically transmissible viruses. Although other nonmechanically transmissible viruses cannot be fully excluded, the results together with the symptoms observed, indicate that TICV is the cause of the disease. TICV has been reported from Greece, Italy, Japan, Spain, and the United States, but to our knowledge, this is the first report of TICV in Indonesia. Reference: (1) A. M. Vaira et al. Phytoparasitica 30:290, 2002.

Download Full-text

First Report of Orchid fleck virus in Costa Rica

Plant Disease ◽

10.1094/pdis.2002.86.12.1402d ◽

2002 ◽

Vol 86 (12) ◽

pp. 1402-1402 ◽

Cited By ~ 10

Author(s):

Juliana Freitas-Astúa ◽

Lisela Moreira ◽

Carmen Rivera ◽

Carlos M. Rodríguez ◽

Elliot W. Kitajima

Keyword(s):

Costa Rica ◽

Consensus Sequence ◽

Pcr Amplification ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

Thin Sections ◽

Orchid Fleck Virus ◽

First Report ◽

Nucleocapsid Gene ◽

Pcr Product

Orchid fleck virus (OFV), a tentative member of the family Rhabdoviridae, infects orchids in several countries. The virus is vectored worldwide by the mite Brevipalpus californicus (Banks) (Acari: Tenuipalpidae). Eleven plants of Oncidium spp. and one plant each of the genera Cymbidium and Maxillaria exhibiting numerous yellow flecks and necrotic ringspot lesions on leaves were collected in two private orchid collections in Costa Rica. Presence of OFV was assessed by plate-trapped antigen enzyme-linked immunosorbent assay (PTA-ELISA) using an antiserum developed against an OFV isolate in Japan (2), analyses of ultrathin sections of the host cell with transmission electron microscopy (TEM), and reverse transcription-polymerase chain reaction (RT-PCR) amplification using specific primers for the viral nucleocapsid gene (1). Eight of eleven Oncidium samples, and both Cymbidium and Maxillaria samples tested positive for OFV with PTA-ELISA having A405 values ranging from 3.9 to 14.6 times higher than negative controls. Thin sections from individual samples of Cymbidium, Oncidium, and Maxillaria revealed electron-lucent intranuclear viroplasm and short, rodlike particles (40 to 50 × 100 nm) in the nucleus or cytoplasm typical of OFV-infected cells. RT-PCR amplifications from one sample of each genera resulted in PCR-product bands of approximately 800 bp. The Cymbidium RT-PCR product was cloned into a pGEM-T-Easy expression vector and sequenced using an ABI 3700 sequencer. The 619-bp nucleocapsid gene consensus sequence had 98% homology with the OFV isolate 0023 identified in Germany (GenBank Accession No. AF343870) (1). However, it had only approximately 85% nucleocapsid gene homology with other OFV isolates available through GenBank, including those from countries geographically closer to Costa Rica, such as Brazil (1). To our knowledge, this is the first report of OFV infecting orchids in Costa Rica. References: (1) A. L. Blanchfield et al. J. Phytopathol. 149:713, 2001. (2) H. Kondo et al. Bull. Res. Inst. Bioresour. Okayama Univ. 4:149, 1996.

Download Full-text

First Report of Potato mop-top virus in North Dakota

Plant Disease ◽

10.1094/pdis-07-10-0522 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1506-1506 ◽

Cited By ~ 14

Author(s):

N. David ◽

I. Mallik ◽

J. M. Crosslin ◽

N. C. Gudmestad

Keyword(s):

North Dakota ◽

Consensus Sequence ◽

The United States ◽

Economic Losses ◽

Northern Europe ◽

Rt Pcr ◽

Total Rna ◽

First Report ◽

Freeze Dried ◽

Potato Mop Top Virus

Potato mop-top virus (PMTV) is the type member of the genus Pomovirus. PMTV is an important pathogen of potato, causing significant economic losses in Northern Europe, North and South America, and Asia (3). PMTV in the United States was first reported in Maine (2). PMTV is vectored by the plasmodiophoromycete Spongospora subterranea cv. subterranea, which causes powdery scab of potato (1). S. subterranea and PMTV are usually associated with cool and humid environments. In the spring of 2010, six potato tubers of cv. Russet Burbank were received from a commercial potato farm in Grand Forks County in North Dakota. The tubers had multiple, internal, concentric, necrotic arcs and circles. The presence of PMTV in the necrotic lesions was verified by a positive double-antibody sandwich-ELISA (Agden Ltd., Ayr, Scotland). The tuber lesions had an absorbance value (405 nm) at least two times greater than that of the negative control sample, which consisted of a healthy tuber. Total RNA was extracted from lesions of six different tubers that tested positive by ELISA using a Total RNA Isolation kit (Promega Corp. Madison, WI). These extracts were tested for PMTV by reverse transcription (RT)-PCR using two different sets of primers. The primer set H360/C819 targeted the coat protein (CP) of PMTV and yielded an amplicon of 460 bp (4). The amplicons generated from the necrotic lesions were cloned (TOPO Cloning; Invitrogen, Carlsbad, CA) and sequenced. Another set of primers, pmtF4/pmtR4, designed to bind to a region in RNA 2 of PMTV, yielded a 417-bp amplicon that also was cloned and sequenced (3). The sequences from all six tuber lesions were identical for the respective primer sets. A consensus sequence for each primer pair was submitted to GenBank (Accession No. HM776171 for primers pmtF4/pmtR4 and No. HM776172 for primers H360/C819). The sequences obtained from the H360/C819 and pmtF4/pmtR4 amplicons were 99% identical to the corresponding regions of PMTV isolates from Northern Europe (GenBank Accession Nos. AM503629 and AJ277556, respectively). Freeze-dried, necrotic tuber tissue from all six tubers was also tested at a USDA Laboratory in Prosser, WA by RT-PCR with the H360/C819 primer pair (4), confirming the results above. Cloning and sequencing of one of the amplicons revealed 100% similarity to the sequence described above for these primers (GenBank Accession No. HM776172), confirming the presence of PMTV in the symptomatic tubers. None of the symptomatic tubers tested positive for Tobacco rattle virus, Tomato spotted wilt virus, Alfalfa mosaic virus, Potato leafroll virus, or the necrotic strains of Potato virus Y by RT-PCR. To our knowledge this is the first report of PMTV in North Dakota. References: (1) R. A. C. Jones and B. D. Harrsion. Ann. Appl. Biol. 63:1, 1969. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) J. Santala et al. Ann. Appl. Biol. Online publication. DOI: 10.1111/j.1744-7348.2010.00423.x (4) H. Xu et al. Plant Dis. 88:363, 2004.

Download Full-text

First Report of Beet pseudo yellows virus in Blackberry in the United States

Plant Disease ◽

10.1094/pdis.2004.88.2.223c ◽

2004 ◽

Vol 88 (2) ◽

pp. 223-223 ◽

Cited By ~ 15

Author(s):

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

South Carolina ◽

The United States ◽

Cdna Clones ◽

Broad Host Range ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

First Report ◽

Beet Pseudo Yellows Virus ◽

Symptomatic Plant

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAGATGTCCRCTAATGATA 3′) that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. References: (1) I. E. Tzanetakis et al. (Abstr.) Phytopathology 93:S85, 2003. (2) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (3) W. M. Wintermantel. Plant Dis. 88:82, 2004.

Download Full-text

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽

10.1094/pdis.2004.88.8.907b ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 18

Author(s):

J. D. Postman ◽

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

North America ◽

Consensus Sequence ◽

The United States ◽

Ringspot Virus ◽

Yellow Vein ◽

Cdna Clones ◽

Meristem Culture ◽

Rt Pcr ◽

First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

Download Full-text